Volume 11 Number 3 2 October 2023

The Taxonomic Report

OF THE INTERNATIONAL LEPIDOPTERA SURVEY

ISSN 2643-4776 (print) / ISSN 2643-4806 (online)

Butterfly classification and species discovery using genomics

Jing Zhang'**, Qian Cong', Jinhui Shen'”, Leina Song'”, and Nick V. Grishin’

Departments of 'Biophysics, 7Biochemistry, and 7Eugene McDermott Center For Human Growth & Development,

University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390-9050, USA;

“Corresponding author: grishin@chop.swmed.edu

ABSTRACT. Genomic sequencing of worldwide butterfly fauna followed by phylogenetic analysis of protein-coding

genes informs butterfly classification throughout the taxonomic hierarchy, from families to species. As a rule, we attribute the

same taxonomic rank to more prominent clades of comparable divergence (i.e., at the same level in the tree). For species

delimitation, we use criteria based on relative genetic differentiation and the extent of gene exchange between populations. We

analyze the current taxonomic classification of butterflies in the light of genomic phylogenies and encounter clades that

correspond to yet unnamed taxa. As a result, 11 tribes, 33 subtribes, 2 genera, 11 subgenera, and 12 species are proposed as

new. New tribes are: in family Nymphalidae Rafinesque, 1815: in subfamily Heliconiinae Swainson, 1822: Vindulini Grishin,

trib. n. (type genus Vindula Hemming, 1934) and Algiini Grishin, trib. n. (type genus A/gia Herrich-Schaffer, 1864),

Lebadeini Grishin, trib. n. (type genus Lebadea C. Felder, 1861, in subfamily Limenitidinae Behr, 1864), and Amnosiini

Grishin, trib. n. (type genus Amnosia E. Doubleday, 1849, in subfamily Pseudergolinae Jordan, 1898) and in family

Lycaenidae [Leach], [1815]: in subfamily Aphnaeinae Distant, 1884: Cigaritini Grishin, trib. n. (type genus Cigaritis Donzel,

1848) and Axiocersini Grishin, trib. n. (type genus Axiocerses Hubner, [1819]) and in subfamily Theclinae: Drinini Grishin,

trib. n. (type genus Drina Nicéville, 1890), Hypochrysopini Grishin, trib. n. (type genus Hypochrysops C. Felder & R. Felder,

1860), Jalmenini Grishin, trib. n. (type genus Ja/menus Hubner, 1818), Pseudalmenini Grishin, trib. n. (type genus

Pseudalmenus H. H. Druce, 1902), and Rapalini Grishin, trib. n. (type genus Rapala F. Moore, 1881). New subtribes are: in

Papilionidae Latreille, [1802], Meandrusina Grishin, subtrib. n. (type genus Meandrusa F. Moore, 1888, in Papilionini

Latreille, [1802]); in Pieridae Swainson, 1820: Gandacina Grishin, subtrib. n. (type genus Gandaca F. Moore, 1906, in

Coliadini Swainson, 1821), Hebomoiina Grishin, subtrib. n. (type genus Hebomoia Hubner, [1819], in Anthocharidini

Scudder, 1889), and Pseudopierina Grishin, subtrib. n. (type genus Pseudopieris Godman & Salvin, 1890, in Dismorphiini

Schatz, 1886); in Nymphalidae: Lachnopterina Grishin, subtrib. n. (type genus Lachnoptera E. Doubleday, 1847, in Algiini

Grishin, trib. n.), in Vagrantini Pinratana & Eliot, 1996: Terinosina Grishin, subtrib. n. (type genus Terinos Boisduval, 1836)

and Smerinina Grishin, subtrib. n. (type genus Smerina Hewitson, 1874), in Adoliadini Doubleday, 1845: Evenaina Grishin,

subtrib. n. (type genus Evena Westwood, 1850) and Pseudathymina Grishin, subtrib. n. (type genus Pseudathyma Staudinger,

1891), and Kumothalina Grishin, subtrib. n. (type genus Kumothales Overlaet, 1940, in Cymothoini Dhungel & Wahlberg,

2018); in Riodinidae Grote, 1895 (1827): Teratophthalmina Grishin, subtrib. n. (type genus Teratophthalma Stichel, 1909, in

Mesosemiini Bates, 1859), Argyrogrammanina Grishin, subtrib. n. (type genus Argyrogrammana Strand, 1932, in

Symmachiini Reuter, 1896), in the tribe Calydnini Seraphim, Freitas & Kaminski, 2018: Echenaidina Grishin, subtrib. n. (type

genus Echenais Hubner, [1819]) and Echydnina Grishin, subtrib. n. (type genus Echydna J. Hall, 2002), and Cariina Grishin,

subtrib. n. (type genus Caria Hubner, 1823, in Riodinini Grote, 1895 (1827); in Lycaenidae: Megalopalpina Grishin, subtrib.

n. (type genus Megalopalpus Rober, 1886, in Miletini Reuter, 1896), Pseudaletidina Grishin, subtrib. n. (type genus

Pseudaletis H. H. Druce, 1888, in Cigaritini Grishin, trib. n.), in Aphnaeini Distant, 1884: Aloeidina Grishin, subtrib. n. (type

genus Aloeides Hubner, [1819]) and Phasisina Grishin, subtrib. n. (type genus Phasis Hubner, [1819]), Pilodeudorigina

Grishin, subtrib. n. (type genus Pilodeudorix H. H. Druce, 1891, in Rapalini Grishin, trib. n.), Hemiolaina Grishin, subtrib. n.

(type genus Hemiolaus Aurivillius, 1922, in Oxylidini Eliot, 1973), Cupidopsina Grishin, subtrib. n. (type genus Cupidopsis

Karsch, 1895, in Hypotheclini Eliot, 1973), and in tribe Polyommatini Swainson, 1827: Theclinesthina Grishin, subtrib. n.

(type genus Theclinesthes Rober, 1891), Azanina Grishin, subtrib. n. (type genus Azanus F. Moore, 1881), Unina Grishin,

subtrib. n. (type genus Una Nicéville, 1890), Ionolycina Grishin, subtrib. n. (type genus Jonolyce Toxopeus, 1929),

Pithecopina Grishin, subtrib. n. (type genus Pithecops Horsfield, 1828), Zizulina Grishin, subtrib. n. (type genus Zizula

Chapman, 1910), Jamidina Grishin, subtrib. n. (type genus Jamides Hubner, [1819]), Fameganina Grishin, subtrib. n. (type

genus Famegana Eliot, 1973), Oboroniina Grishin, subtrib. n. (type genus Oboronia Karsch, 1893), and Uranothaumatina

Grishin, subtrib. n. (type genus Uranothauma Butler, 1895); and in Hesperiidae Latreille, 1809, Cupithina Grishin, subtrib. n.

(type genus Cupitha F. Moore, 1884, in Astictopterini Swinhoe, 1912). The new genera are Balenga Grishin, gen. n. (type

species Proteides balenge Holland, 1891, in Gretnini Grishin, 2019) and Tulsia Grishin, gen. n. (type species Parnara tulsi

Nicéville, 1884, in Baorini Doherty, 1886). New subgenera are: in Pieridae, Lirinia Grishin, subgen. n. (type species Terias

lirina H. Bates, 1861, in genus Pyrisitia A. Butler, 1870); in Nymphalidae: Hyperanartia Grishin, subgen. n. (type species

Vanessa dione Latreille, [1813], in genus Hypanartia Hubner, [1821]) and Paranartia Grishin, subgen. n. (type species

Hypanartia hippomene Hubner, [1823], in genus Vanessa [Fabricius], 1807); in Lycaenidae, Auricirrus Grishin, subgen. n.

(type species Papilio thysbe Linnaeus, 1764, in genus Chrysoritis Butler, 1898); and in Hesperiidae: /soc/eros Grishin, subgen.

n. (type species Pamphila (?) mackenii Trimen, 1868, in genus Acleros Mabille, 1885), Mesna Grishin, subgen. n. (type

species Parnara leucophaea Holland, 1894, in genus Fresna Evans, 1937), Lippina Grishin, subgen. n. (type species Carystus

telesinus Mabille, 1878, in genus Xanthoneura Eliot, 1978), Ganda Grishin, subgen. n. (type species Zophopetes ganda Evans,

1937, in genus Leona Evans, 1937), Zarida Grishin, subgen. n. (type species Hesperia lacida Hewitson, 1876, in genus Gretna

Evans, 1937), and in genus Gegenes Hiibner, 1819: Flanga Grishin, subgen. n. (type species Parnara perobscura H. H. Druce,

1912), and Havea Grishin, subgen. n. (type species Hesperia havei Boisduval, 1833). New species are: in Nymphalidae:

Microtia elvira Grishin, sp. n. (type locality in the USA: AZ, Pima/Santa Cruz Cos.) and Cyllopsis brocki sp. n. (type locality

in Mexico: Sonora, Yécora), in Riodinidae, Argyrogrammana astuta Grishin, sp. n. (type locality in Peru: Madre de Dios), in

Hesperiidae: Cecropterus (Thorybes) rockiensis Grishin, sp. n. (type locality in USA: CO, Jefferson Co.), Cecropterus

(Thorybes) floridianus Grishin, sp. n. (type locality in USA: FL, Volusia Co.), Cecropterus (Thorybes) oaxacensis Grishin, sp.

n. (type locality in Mexico: Oaxaca), Nascus (Bron) lux Grishin, sp. n. (type locality in Brazil: Amapa), Cogia chiagua

Grishin, sp. n. (type locality in Guatemala), Celotes sabinus Grishin, sp. n. (type locality in USA: AZ, Pima Co.), Acleros togo

Grishin, sp. n. (type locality in Togo), Ceratrichia notata Grishin, sp. n. (type locality in Central African Republic), and

Semalea malawi Grishin, sp. n. (type locality in Malawi). Furthermore, we elevate a tribe to subfamily, resurrect 3 tribes, 3

subtribes, 5 genera (and confirm 1), 3 subgenera, change the rank of 5 currently recognized tribes to subtribes (and confirm 1),

10 genera to subgenera, synonymize 4 genera, and present evidence to support 21 taxa as species instead of subspecies and 3

taxa as subspecies instead of synonyms. Namely, we reinstate Liphyrinae Doherty, 1889 as a subfamily (was a tribe of

Miletinae Reuter, 1896), treat the following as tribes: Leptidiini Grote,1897 (in Dismorphiinae Schatz, 1886) and in Theclinae

Swainson, 1830: Surendrini Kogak & Seven, 1997 (not a subtribe of Arhopalini Bingham, 1907) and Myrinini Toxopeus, 1929

(not a synonym of Amblypodiini Doherty, 1886), and subtribes: Callidryina Kirby, 1896 and Gonepterygina Verity, 1920 (in

Coliadini Swainson, 1821), Abrotina Hemming, 1960 and Bebearitna Hemming, 1960 (in Adoliadini Doubleday, 1845), and

Sarotina Bridges, 1988 (in Helicopini Stichel, 1928). We confirm Libytheana Michener, 1943 as a valid genus, not a junior

subjective synonym of Prolibythea Scudder, 1889 and resurrect from synonymy the following genera: Pseudanaphaeis

Bernardi, 1953 (not Be/enois Hubner, [1819]), Charmion Nicéville, 1894 (not Celaenorrhinus Hubner, [1819]), Sape Mabille,

1891 (not Sarangesa F. Moore, [1881]), Milena Evans, 1912 (not Caltoris Swinhoe, 1893) and subgenera: Neofieldia

Ozdikmen, 2008 and Bassaris Hubner, [1821] of Vanessa [Fabricius], 1807 and Spindasis Wallengren, 1857 of Cigaritis

Donzel, 1848. We change the status of the following taxa from tribes to subtribes: Nathalina Balint, 2022 and Kricogonina

Balint, 2022 of Euremini Grote, 1898, Tarakina Eliot, 1973 of Spalgini, 1929, Horagina Swinhoe, 1910 and Loxurina Swinhoe,

1910 of Cheritrini Swinhoe, 1910, and Niphandina Sibatani & Ito, 1942 of Polyommatini; from genus to subgenus: Leucidia E.

Doubleday, 1847 of Abaeis Hubner, [1819], Cesa Seven, 1997 of Crudaria Wallengren, 1875, Paralycaeides Nabokov, 1945

of /tylos Draudt, 1921, Eldoradina Balletto, 1993 of Nabokovia Hemming, 1960, Pyrrhochalcia Mabille, 1904 of Coeliades

Hubner, 1818, Paracleros Berger, 1978 of Acleros Mabille, 1885, Mopala Evans, 1937 of Leona Evans, 1937, Afrogegenes

Jong & Coutsis, 2017 and Torbenlarsenia Kemal & Kocgak, 2020 of Gegenes Htibner, 1819, and Zenonoida Fan & Chiba, 2016

of Zenonia Evans, 1935; and from genus to junior subjective synonym: Vansomerenia Heath, 1997 of Chloroselas Butler,

1886, Ceratricula Larsen, 2013 of Paronymus Aurivillius, 1925, Xanthodisca Aurivillius, 1925 of Semalea Holland, 1896,

Perrotia Oberthtr, 1916 of Galerga Mabille, 1898. The following taxa are species, not subspecies or synonyms: Pyrisitia

mayobanex (M. Bates, 1939), stat. nov. and Pyrisitia memulus (A. Butler, 1871), stat. rest. (not Pyrisitia dina (Poey, 1832)),

Abaeis gratiosa (E. Doubleday, 1847), stat. rest. and Abaeis angulata (Wallengren, 1860), stat. rest. (not Abaeis arbela

(Geyer, 1832)), Teriocolias doris (Rober, 1909), stat. rest. (not Teriocolias deva (E. Doubleday, 1847)), Vanessa

madegassorum (Aurivillius, 1899), stat. nov. (not Vanessa hippomene (Hubner, 1823)), Eresia (Anthanassa) seminole Skinner,

1911, stat. rev. (not Eresia (Anthanassa) texana (W. H. Edwards, 1863)), Cecropterus (Thorybes) albosuffusa (H. Freeman,

1943), stat. nov. and Cecropterus (Thorybes) indistinctus (Austin & J. Emmel, 1998), stat. nov. (not Cecropterus (Thorybes)

pylades (Scudder, 1870)), Cogia hiska Evans, 1953, stat. nov. (not Cogia hippalus (W. H. Edwards, 1882)), Cogia moschus

(W. H. Edwards, 1882), stat. rest. (not Cogia caicus (Herrich-Schaffer, 1869)), Pholisora albicirrus Glassberg 2023, stat.

nov. (not Pholisora catullus (Fabricius, 1793)), Acleros (Isocleros) instabilis Mabille, 1889, stat. rest. and Ac/eros (Isocleros)

olaus (Pl6tz, 1884), stat. rest. (not Acleros ([socleros) mackenii (Trimen, 1868)), Fresna (Mesna) bassa (Lindsey & L. Miller,

1965), stat. nov., comb. nov. (not Meza leucophaea (Holland, 1894)), Paronymus volta (L. Miller, 1971), stat. nov., comb.

nov. (not Meza cybeutes (Holland, 1894)), Paronymus indeterminabilis (Strand, 1912), stat. rest., comb. nov. and Paronymus

congdoni (Larsen, 2013), stat. nov., comb. nov. (not Ceratricula semilutea (Mabille, 1891)), Semalea corvinus (Mabille,

1890), stat. rest. (not Semalea sextilis (Plotz, 1886)), Xanthoneura patmapana (Fruhstorfer, 1911), stat. nov. (not

Xanthoneura corissa (Hewitson, 1876)), Gretna capra Evans, 1937, stat. nov. (not Gretna carmen Evans, 1937), and Lerodea

dysaules Godman, 1900, stat. rest. (not a synonym of Lerodea arabus (W. H. Edwards, 1882)), while Vernia verna sequoyah

(H. Freeman, 1942), stat. rest. (not a synonym of Vernia verna W. H. Edwards, 1862) and Euphyes vestris osceola (Lintner,

1878), stat. rev. (not a synonym of Euphyes vestris vestris (Boisduval, 1852)) are subspecies. In addition, we propose new

genus-species combinations: Pyrisitia amelia (Poey, [1852]), Pyrisitia lirina (H. Bates, 1861), Abaeis paulina (H. Bates,

1861), Abaeis xantochlora (Kollar, 1850), Abaeis fabiola (C. Felder & R. Felder, 1861), Abaeis tupuntenem (Lichy, 1976), and

Abaeis adamsi (Lathy, 1898) (not Eurema Hubner, [1819]), Shijimia potanini (Alphéraky, 1889) (not Tongeia Tutt, 1908),

Fresna (Mesna) larea (Neave, 1910), Fresna (Mesna) leucophaea (Holland, 1894), Fresna (Mesna) mabea (Holland, 1894),

Paronymus banda (Evans, 1937), Paronymus cybeutes (Holland, 1894), Paronymus elba (Evans, 1937), Paronymus gardineri

(Collins & Larsen, 2008), Paronymus indusiate (Mabille, 1891), and Paronymus mabillei (Holland, 1893) (not Meza

Hemming, 1939), Paronymus punctata (Holland, 1896) (not Ceratrichia Butler, 1870), Galerga ariel (Mabille, 1878) (not

Xanthodisca Aurivillius, 1925), I[soteinon anomoeus (Pl6tz, 1879), Isoteinon bruno (Evans, 1937), Isoteinon inornatus

(Trimen, 1864), and /soteinon punctulata (A. Butler, 1895) (not Astictopterus C. Felder & R. Felder, 1860), Borbo gemella

(Mabille, 1884) (not Torbenlarsenia Kemal & Kogak, 2020), and Gegenes (Torbenlarsenia) cottrelli (Larsen, 2013), Gegenes

(Torbenlarsenia) fallax (Gaede, 1916), Gegenes (Torbenlarsenia) fanta (Evans, 1937), Gegenes (Torbenlarsenia) micans

(Holland, 1896), and Gegenes (Torbenlarsenia) sirena (Evans, 1937) (not Borbo Evans, 1949); and a new species-subspecies

combination Cogia hiska hester Evans, 1953 (not Cogia hippalus). Acleros nyassicola Strand, 1921 is a junior subjective

synonym of Acleros (Isocleros) olaus (Pl6tz, 1884), not of Acleros (Isocleros) mackenii (Trimen, 1868). We transferred the

tribes Oxylidini Eliot, 1973, Remelanini Eliot, 1973, and Hypolycaenini Swinhoe, 1910 from Theclinae Swainson, 1831 to

Polyommatinae Swainson, 1827. We conclude that [No genus] osibius Draudt, 1924 is an unavailable name. The lectotype is

designated for Eudamus caicus Herrich-Schaffer, 1869 (type locality likely in Mexico: Oaxaca, as deduced by sequence

comparison), and the neotype is designated for Telemiades solon P\6tz, 1882 (type locality becomes Brazil: Bahia). The type

localities of Ceratrichia punctata Holland, 1896 and Osmodes staudingeri Holland, 1896 are Sierra Leone: Freetown and

Cameroon: Efoulan, respectively, as determined from the locality labels of primary type specimens. Finally, we provide

taxonomic lists for Euremini (to worldwide subgenera and American species) and Lycaenidae (to subtribes).

Additional keywords: taxonomy, classification, genomics, phylogeny, biodiversity.

ZooBank registration: http://zoobank.org/I9CAA87E5-B1FE-4948-BD3B-EFAA9B95575D

INTRODUCTION, CONCEPTS, AND METHODS

This work continues a series of studies derived from genomic sequencing of butterflies and uses the same

principles and methods (Cong et al. 2019a, b; Li et al. 2019; Zhang et al. 2019a—d; Cong et al. 2020;

Zhang et al. 2020; Cong et al. 2021; Zhang et al. 2021; Robbins et al. 2022; Zhang et al. 2022b, c; Zhang

et al. 2023c,e). The goal is to improve butterfly classification through genomic data analyses. The

approach is that of screening. Specimens of various taxa throughout the butterfly phylogeny worldwide

are selected. The emphasis is placed on species recorded from the United States, and specimens across the

range are taken for each species. Most specimens come from collections, both museum and private (see

acknowledgments section for their list); specimen age varies from ~250 years to recently collected.

Whenever possible, we sequence primary type specimens to have an objective reference for the name

(Zhang et al. 2022a). Primarily, legs are used for DNA extraction. Our protocol is non-destructive, and

legs are preserved. Extracted DNA is fragmented (unless a specimen is old and its DNA is already short)

and sequenced at 150 bp on Illumina next-generation sequencing platform. We do not rely on the

amplification of specific genes or segments, and every extracted DNA piece is sequenced. Therefore, the

protocol succeeds with very old specimens, in which DNA may be fragmented into 30—50 bp segments.

Sequence data (1.e., sequence segments of 150 bp or shorter) of each specimen are used to

assemble exons of protein-coding genes as guided by a reference genome available for the

phylogenetically closest species. These protein-coding genes are used for phylogeny reconstruction. Three

trees are constructed using IQtree v1.6.12 under the GTR+GAMMA model (Nguyen et al. 2015): from

autosomes in the nuclear genome, the gene predicted to be in the Z chromosome, and the mitochondrial

genome. To decrease computational load, 100,000 codons (resulting in 300,000 base pairs, about 2% of

the total) are randomly selected from the entire dataset to use for the nuclear trees. Statistical support for

branches is estimated from 100 replicates of 10,000 codons each, sampled from the total set of codons,

and trees are constructed from each replicate. Statistical support value (from 0 to 100) is simply the

number of replicates with a particular bipartition identical to the one in the 100,000-codon tree. For

further methods details, see our previous publications (Li et al. 2019; Zhang et al. 2022b).

The resulting trees were visualized, rotated, and colored in FigTree (Rambaut 2018). The current

taxonomic classification was overlaid on the trees to find non-monophyletic taxa and clades

corresponding to taxa without names. Genomic trees frequently reveal “levels,” 1.e., timepoints when

diversification occurred in several lineages independently (Zhang et al. 2021). These “synchronized”

diversifications result from geological events affecting all major lineages at the same time, offering an

opportunity to match taxonomic ranks (tribe, subtribe, genus, subgenus) to the levels in genomic trees,

which leads to a more objective and internally consistent classification tied to both genetic differentiation

and paleontological history. In classification decisions, we strongly rely on genomic trees and use

morphological considerations as secondary evidence to rationalize the results. This is because, contrary to

a small set of gene markers, genomes offer a comprehensive picture of an organism richer than the

morphology of adults typically used to classify butterflies. Genomes encode life histories, habitat and

mating preferences, and food sources. All this information is present in the genomic sequence. While we

lack the knowledge to extract it and predict phenotypes, we can use a genetic equivalent of this

information in an aggregate, in a way that the organism balances it in its genome (we select random

codons from all protein-coding genes), to deduce phylogenetically sound taxonomic classification.

Taxa we define are monophyletic groups in nuclear genome trees that correspond to prominent

clades. By “prominent,” we mean tree branches strongly supported statistically (typically by 100% of

replicates) and usually longer than neighboring branches. The length of a branch is proportional to the

number of base-pair substitutions along the branch. Not only are longer branches better supported

statistically, but the larger number of genetic changes along them likely leads to more pronounced

phenotypic changes that should be reflected in some morphological characters, not necessarily in adults,

but could be in immature stages or other aspects of the phenotype. Nevertheless, due to highly non-linear

relationships between the number of genetic changes and visually drastic phenotypic differences (Zhang

et al. 2019a), there are short tree branches that correspond to visually recognizable taxa, and each case

should be considered individually. It is unclear, however, if some drastic phenotypic change in adult

appearance that was caused by a small number of genetic changes (maybe even a single inversion of a

genomic segment) should be grounds for erection of a separate taxon for this lineage because all other

characters, e.g., those of caterpillars, would remain rather similar to the relatives of this lineage.

Generally, we prefer to avoid monotypic (or nearly monotypic, 1.e., consisting of very close relatives) taxa

unless they cannot be confidently assigned to other taxa of the same rank or show prominent genetic

differentiation from them at the level of the tree that corresponds to their rank. Furthermore, currently

employed taxonomy is considered, and currently used names and their taxonomic ranks serve, on average,

as a reference point to define levels in the trees and new taxa.

Tribes are defined as a prominent level in genomic trees between subfamilies and genera that

supports most tribes as they are currently circumscribed in each subfamily. Subtribes correspond to a

notable tree level between tribes and genera. Genera are defined as the most prominent level in genomic

trees between tribes and species that largely corresponds to the current classification into genera.

Subgenera correspond to a rather prominent level between genera and species. We attempt to define

secondary levels (subtribes and subgenera) in the classification whenever possible if we see noteworthy

clustering of genera or species into groups of relatives prominently differentiated from other such groups.

We find these subdivisions useful in taxonomic lists, even if for no other reason than to place closer

relatives close to each other in alphabetically sorted hierarchical lists.

Species are delineated by a combination of criteria that include genetic differentiation in the Z

chromosome measured by Fs (>0.20 usually corresponds to distinct species) and gene exchange Gmin

(<0.05 for distinct species) (Cong et al. 2019a), COI barcode difference (typically >2% for distinct

species) (Hebert et al. 2003) and its correlation with phenotypic differences (Lukhtanov et al. 2016), and

the prominence of species-level clades (Zhang et al. 2022c). However, COI barcodes (together with

mitochondria) frequently introgress between species (Bachtrog et al. 2006; Cong et al. 2017a), and some

distinct species may possess highly similar or identical barcodes (Burns et al. 2008; Zhang et al. 2023a).

See the “Species, subspecies, and genomics” section in Zhang et al. (2022a) for further discussion.

Sections below are arranged in the taxonomic order deduced from genome-scale phylogeny

complemented by phenotypic considerations. For most new taxa, in addition to brief phenotypic

diagnoses (genitalia terminology follows Carneiro et al. (2013), we use “harpe” for Evans’ “cuiller”

(Evans 1949)) frequently accompanied by references that discuss and illustrate morphological characters

in greater detail, we provide diagnostic DNA characters in the nuclear genome and/or (when meaningful)

in the COI barcode. DNA characters are found in nuclear protein-coding regions using our previously

developed procedure (see SI Appendix to Li et al. 2019). The logic behind the character selection was

described in Cong et al. (2019b) and is aimed at finding more robust characters likely to stand when

additional specimens and species are sequenced.

The character states are given in species diagnoses as abbreviations for one of the six reference

genomes: Pterourus glaucus (Linnaeus, 1758) (pg) (Cong et al. 2015), Pieris rapae (Linnaeus, 1758)

(pra) (Shen et al. 2016), Heliconius melpomene (Linnaeus, 1758) (hm) (Davey et al. 2016), Calephelis

nemesis (W. H. Edwards, 1871) (cne) (Cong et al. 2017b), Calycopis cecrops (Fabricius, 1793) (cce)

(Cong et al. 2016), or Cecropterus lyciades (Geyer, 1832) (aly, because this species was formerly in the

genus Achalarus Scudder, 1872) (Shen et al. 2017). E.g., aly728.44.1:G672C means position 672 in exon

1 of gene 44 from scaffold 728 of the Cecropterus lyciades (Geyer, 1832) (aly) reference genome (Shen et

al. 2017) is C, changed from G in the ancestor. When characters are given for the sister clade of the

diagnosed taxon, the following notation is used: aly5294.20.2:A548A (not C), which means that position

548 in exon 2 of gene 20 on scaffold 5294 is occupied by the ancestral base pair A, which was changed to

C in the sister clade (so it is not C in the diagnosed taxon). The same notation is used for COI barcode

characters but without a prefix ending with *:’. The sequences of exons from the reference genome with

the positions used as character states highlighted in green are in the supplemental file deposited at

< https://osf.10/7tngy/ >. This link to the DNA sequences accessible from this publication ensures that

DNA characters given in the diagnoses can be readily associated with actual sequences.

Whole genome shotgun datasets we obtained and used in this work are available from the NCBI

database < https://www.ncbi.nlm.nih.gov/ > as BioProject PRJNA1022154 and BioSample entries of the

project contain the locality and other collection data of the sequenced specimens shown in the trees. For

each specimen in tree figures, the following information is provided (separated by “|’’): taxon name with

comments in square brackets, DNA sample code, type status, general locality, and year of collection

(“old” if not dated and likely collected 100—150 years ago). Type status abbreviations are: HT holotype,

LT lectotype, ST syntype, T type (could be ST, LT, paralectotype, or HT, status not investigated), PT

paratype; and if a synonym name is given (in parenthesis, preceded by “=”, and in addition by “t” for

unavailable names), type status refers to the synonym. COI barcode sequences reported here have been

deposited in GenBank with accessions OR578710—OR578722 and OR589636—OR589640. Several

photographs shown in this work were taken from iNaturalist (2023). Links to observations by observation

number reported in figure legends are < https://www. inaturalist.org/observations/xxx >, where xxx is the

observation number. Abbreviations or acronyms for collections are listed in the acknowledgments section.

Family Papilionidae Latreille, [1802]

Meandrusina Grishin, new subtribe

http://zoobank. org/72EO085A2-EA04-4D25-8124-04A86D17F26B

Type genus. Veandrusa F. Moore, 1888.

Definition. Meandrusa (type species Papilio evan E. Doubleday, 1845 currently treated as a subspecies of

Papilio payeni Boisduval, 1836) was placed in the subtribe Teinopalpini Grote, 1899, but our genomic

trees show that it is not monophyletic with Teinopalpus Hope, 1843 (type species Teinopalpus imperialis

Hope, 1843) and instead is sister to Papilionini Latreille, [1802] with 100% support (Fig. 1). Genetic

differentiation of Meandrusa from Papilionini is approximately the same as of Battus Scopoli, 1777 (type

species Papilio polydamas Linnaeus, 1758) from other Troidini Talbot, 1939 (comparable distance from

the root, Fig. 1). Therefore, we consider that Meandrusa belongs to the tribe Papilionini. However, the

tree shows that Meandrusa is prominently separated from the rest of Papilionini and, therefore, belongs to

a distinct subtribe analogously to Battus. This subtribe does not have a name and is proposed as new. As

detailed by Miller (1987) for Meandrusa, the new subtribe is characterized by bifid tarsal claws and

differs from the rest of Papilionini by strongly incurved middle discocellular vein on the forewing, shorter

Baronia brevicornis|16105HO7|Mexico:Mor|1981

100 Bhutanitis lidderdalii]19116A07|India:Assam|1947

100 98 Archon apollinus|19116E10|Turkey|1988

Parnassius apollo|5528|Turkey|1991

Eurytides thyastes|15112E10|Peru|1982

Iphiclides podalirius|20055G12|Greece

i ; Teinopalpus imperialis|17113C07|Vietnam|2016

Battina 700 -Battus polydamas|17116E12|USA:TX,Hidalgo Co.|1972

Battus zetides|19116A03|Dominican Republic|1987

100] Troidina Pharmacophagus antenor|19083C01|Madagascar|2019

ie mo Cressida cressida|19126F07|Australia|1990

; Troides helena|9144|F|Vietnam|2016

Meandrusina we Meandrusa lachinus|17112F06|Thailand|2013

Meandrusa payeni|9315|M|China:Sichuan

ane Heraclides thoas|14081G01|Peru:Tingo Maria|1985

a Wes an Pterourus troilus|4262|USA:IN,Montgomery Co.|2015

Papilionina 7 Chilasa clytia|19083D04|no data

Alexanoria alexanor|14081C11|France|1994

100 Papilio anactus|19083B12|Australia

0.06 100 Papilio demodocus|19083D03|C. African Rep.

100 Papilio helenus|19116D07|Myanmar|2001

Papilio machaon|LADJOO000000|China:Sichuan

100 100

Fig. 1. The phylogenetic tree of selected Papilionidae inferred from protein-coding regions of the nuclear genome (autosomes).

Family-group names are shown above or below the corresponding branches. A new subtribe proposed in this work is shown in

red. Names of other subtribes are shown in black, and names of subfamilies and tribes are shown in shades of gray.

forewing discal cell (less than half of the wing), and scaled tibiae and tarsi, and from Teinopalpini by

scaled antennae and prodiscrimen (equivalent to the prosternum of other insects) with a spine. Visually,

species in the new subtribe are recognized by the distinct shape of curved forewings (especially in males)

with produced and somewhat hooked apex narrowing to a point (less prominently in Meandrusa sciron

(Leech, 1890)). A combination of the following nuclear genomic base pairs is diagnostic: pgl2854.3.1:

A400G, pgl827.10.7:G122A, pgl827.10.7:G138A, pgl1898.30.3:G202A, pgl1397.11.1: GI138A.

Genera included. Only the type genus.

Parent Taxon. Tribe Papilionini Latreille, [1802].

Family Pieridae Swainson, 1820

Lirinia Grishin, new subgenus

http://zoobank. org/A59BC65A-CEE7-4380-8D40-877A90B74CFD

Type species. 7erias lirina H. Bates, 1861.

Definition. Our genomic tree reveals that the 7. Jirina (type locality in Brazil: Para) lineage is mono-

phyletic with neither Abaeis Hiibner, [1819] (type species Papilio nicippe Cramer, 1779) nor Eurema

Hiibner, [1819] (type species Papilio delia Cramer, 1780, a junior homonym, valid name for this species

is Pieris daira Godart, 1819), and instead is a confident sister to all other Pyrisitia A. Butler, 1870 (type

species Papilio proterpia Fabricius, 1775), but is genetically differentiated from them at the level of a

subgenus (Fig. 2). Therefore, we transfer T. lirina to Pyrisitia forming a new combination Pyrisitia lirina

(H. Bates, 1861) and propose that its lineage represents a distinct subgenus of Pyrisitia. This new

subgenus differs from its relatives by the characters given and illustrated for Eurema furtadoi Casagrande

& O. Mielke, 1979 in its original description (Casagrade and Mielke 1979). In brief, wings rounded,

mostly white with black forewing apex, reminiscent of Abaeis albula (Cramer, 1775) (type locality in

Suriname), with which it was lumped in the past (Klots 1929), but with very different genitalia: in males,

uncus broader, with two shot side processes (absent in A. albula); saccus shorter, about the same length as

tegumen with uncus; aedeagus bow-shaped, broader and shorter, twice as long as saccus; valva shaped as

a half-circle, harpe with robust ventral tooth and much smaller vestigial dorsal tooth; in females, corpus

bursae smaller with much smaller signum and a small bubble-shaped appendix (instead of the appendix as

long as corpus). A combination of the following nuclear genomic base pairs is diagnostic: pse1181.9.1:

G68A, pse988.17.1:A57G, pse6193.9.1:G135T, pse5030.21.1:A392T, pse5030.21.1:T376G, pse907.3.2:

A270C, pse1899.1.7:G805A, pse1899.1.7:T806C, pse2087.5.1:C260T, pse102.3.4:C1026G.

Etymology. The name is a feminine noun in the nominative singular formed from the type species name.

Species included. Only the type species.

Parent taxon. Genus Pyrisitia A. Butler, 1870.

100

Tribes Subtribes Genera Subgenera

Nathalina Nathalis

=*132|Mya Kricogonia

100

: . 2M Prestoni

Kricogonina Mya resto

Maiva

100

Terias

100

Euremini Uictiai

100

“oo Aliya: Eurema

section

100

Eurema

100

Pyrisitia 16 Mya

100

Euremina Ro

Ua Pyrisitia we

100

Lirinia subgen. n.

Leucidia

Lucidia

Abaeis |__|

100 ne

100

Sphaenogona ne

0.04 100 aANya

Abaeis 100

section

Abaeis

100

Teriocolias

Nathalis iole|3572|USA:TX,Cameron Co.|2015

Nathalis plauta]19079D05|Colombia|1990

Kricogonia lyside|3423|USA:TX,Cameron Co.|2015

Kricogonia cabrerai|21096A11|HT|Cuba|1914

Prestonia clarki|16104H08|Mexico:0ax|1980

Terias brigitta]19067F02|Cameroon|1987

Terias laeta|19067F09|Myanmar|2001

Terias herla|19078G03|Australia|1968

Terias sari|19067FO7|Myanmar|2015

Terias sarilata|19078H04|Philippines,_Luzon|1985

Terias andersonii|19078F09|Myanmar|2001

Terias celebensis|19078F 12|Indonesia:Bangkei|1885

Terias laceola|19078G04|Javalold

Terias nicevillei|19078G08|Indonesia:Sumatra|1991

Terias puella|19078G11|Papua New Guinea|2011

Terias blanda|19067F08|China:Hong Kong|1988

Terias floricola|19078G06|Cameroon|1989

Terias senegalensis|19078H05|Cameroon|1989

Terias hecabe|20038H12|Thailand

Terias tecmessa|19078G12|Malaysia:Pahang|1990

Terias ada|19078F07|Indonesia:_Lombok|1990

Terias hapale|19078G02|Ethiopia|1957

Terias smilax|19078H01|Australia:NT|1992

Eurema priddyi|21076A09|Dominican Republic|1985

Eurema lucina|19078E11|Cubalold

Eurema daira|4872|USA:FL,Monroe Co.|2015

Eurema elathea|10279|Jamaica|2017

Eurema nigrocincta|19078E12|Ecuador:Loja|2002

Eurema agave|22084E02|Venezuela|1987

Eurema phiale|19078F02|Brazil:DF|1985

Pyrisitia proterpia|10506|Jamaica|2017

Pyrisitia westwoodii|20067E07|Mexico:Gro|1981

to eubai dina|5351|USA:FL,Miami-Dade Co.|2015

We yrisitia parvumbra|10554|Jamaica|2017

Pyrisitia leuce|19078H11|Venezuela|1985

Pyrisitia larae|22083G02|Cuba|1995

Pyrisitia venusta|19079A05|Guyana|2000

700 Pyrisitia chamberlaini|20129A07|Bahamas|1978

Pyrisitia nise]|5207|USA:TX,Starr Co.|2015

Pyrisitia lisa|4880|USA:FL,Monroe Co.|2015

Pyrisitia euterpiformis|19078H12|DR|1994

Pyrisitia amelia|19078E03|Cubal|old

joo Pyrisitia portoricensis|19079A02|Puerto Rico|old

100 Pyrisitia pyro|22084B02|Dominican Republic|2000

Pyrisitia messalina|10508|Jamaica|2017

Pyrisitia lirina|21075H04|Brazil:RO|1994

Abaeis brephos|19063C09|French Guiana|1999

Abaeis elvina|19067HO05|Brazil:RJ|1996

Abaeis albula|22086A07|Suriname|2002

jofibaeis paulina|22085D02|Brazil:RO|1991

Abaeis xantochlora|19078F06|Peru:Cuzco|2016

Abaeis fabiola|19078E10|Peru:Cuzco|2016

Abaeis salome|11922|Mexico:Tam|1972

Abaeis mexicana|6239|USA:TX,Wise Co.|2016

Abaeis boisduvaliana|3357|USA:TX,Hidalgo Co.|2015

Abaeis angulata|19078E05|Peru:Piura|2000

joo Abaeis gratiosa|22085C01|Venezuela:Zulia|1982

Abaeis arbela|19078E06|Brazil:RJ|1995

Abaeis adamsi|19078E01|Jamaica|1984

idpbaeis nicippe|8877|USA:NM, Santa Fe Co.|2017

Abaeis nicippiformis|21075G12|Dominican Republic|1988

Teriocolias deva|19063C07|Bolivia|2009

Teriocolias doris (=pseudomorpha)|20124D11|T|Bolivialold

Teriocolias zelia|19067HO8|Argentina: Tucuman|2013

Teriocolias reticulata|19078F03|Peru:Cuzco|2013

100

T00

100

100 100

100

Gonepteryx rhamni|15112H05|Finland|2003

a 100

Coliadini

100

Phoebis sennae eubule|3314|USA:TX,San Jacinto Co.|2015

Anteos maerula|10234|USA:TX,Cameron Co.|2017

Catopsilia crocale|19067E07|Taiwan|1973

Fig. 2. The phylogenetic tree of Euremini inferred from protein-coding regions of the nuclear genome (autosomes). Levels in

the tree that correspond to the taxonomic hierarchy are marked above as Tribes, Subtribes, Genera, and Subgenera. The

translucent vertical lime bar denotes the level approximately corresponding to genera. Family-group names (roman font) and

genus-group names (genera in bold italics and subgenera in italics) are shown by corresponding branches. Different genera of

Euremini are shown in different colors. Numbers in cyan on a yellow background followed by “Mya” placed on the right of

several tree nodes indicate the approximate ages of these nodes in million years (rounded) as estimated by Kawahara et al.

(2023); smaller numbers are statistical support values of the tree branches (in %, most are 100% implying high confidence).

The red asterisk denotes Euremini's arrival in the Old World from the New World, and the genus 7Jerias originated as a result.

Pyrisitia mayobanex (M. Bates, 1939) and Pyrisitia memulus (A. Butler, 1871)

are species-level taxa

As we previously concluded, Pyrisitia westwoodii (Boisduval, 1836) (type locality in Mexico) is a distinct

Species, not a subspecies of Pyrisitia dina (Poey, 1832) (type locality in Cuba) (Zhang et al. 2021).

Sequencing of additional specimens that included the nominal P. dina (Fig. 3 blue) confirms this

conclusion, also confirming Pyrisitia parvumbra (Kaye, 1925) (type locality in Jamaica) (Fig. 3 magenta)

as a distinct species (Turner and Turland 2017): Fst/Gmin between P. parvumbra and P. dina dina of

0.59/0.002 and the COI barcode difference of 2.7% (18 bp). Furthermore, we find prominent genetic

differentiation between P. dina and the taxon originally proposed as Eurema helios mayobanex M. Bates,

1939 (type locality in Haiti): Fs/Gmin of 0.39/0.00, COI difference of 1.8% (12 bp). Therefore, we propose

that Pyrisitia mayobanex (M. Bates, 1939), stat. nov. is a species-level taxon. Inspecting the genomic

trees, we see that Terias memulus Butler, 1871 (type locality in Haiti), currently regarded as a subspecies

of Pyrisitia leuce (Boisduval, 1836) (type locality in Brazil: Rio Grande do Sul), is most strongly

differentiated from it genetically: Fst/Gmin 0.60/0.00 and the COI barcode difference of 7.3% (48 bp) (Fig.

3 orange), while other P. /euce subspecies cluster closely together in the tree (Fig. 3 violet). Therefore, we

reinstate Pyrisitia memulus (A. Butler, 1871), stat. rest. as a species.

P. westwoodii|22079HO9|USA:AZ,Santa Cruz Co.|1989 b

Pyrisitia westwoodii|20067E07|Mexico:Gro|1981

Pyrisitia westwoodii|20067E08|Mexico:Mor|1981

Pyrisitia westwoodii|17116H10|Mexico:Roo|1979

Pyrisitia westwoodii|20061D04|Mexico:Chia|1988

Pyrisitia westwoodii|22083A02|Costa Rica|2006

32 Pyrisitia dina helios|5351|USA:FL,Miami-Dade Co.|2015

90 Pyrisitia dina helios|5358|USA:FL,Miami-Dade Co.|2015

» Pyrisitia dina helios|5357|USA:FL,Miami-Dade Co.|2015

Pyrisitia dina helios|22079H01|Bahamas|1990

Pyrisitia dina helios|22079H03|Bahamas|1988

Pyrisitia dina dina]22042D05|ST|Cuba|old

Pyrisitia dina dina|22079D01|Cuba:Havana|1993

Pyrisitia dina dina|22079C12|Cuba:GTMO|1994

Pyrisitia dina dina|22079C11|Cuba:Granma|1995

Pyrisitia dina dina|22079D03|Cuba:Baracoa|1994

Pyrisitia mayobanex [not dina]|22079H05|DR|1986

Pyrisitia mayobanex [not dina]|22079H06|DR|1986

Pyrisitia parvumbra|10554|Jamaica|2017

Pyrisitia parvumbra|10553|Jamaica|2017

Pyrisitia parvumbra|10398|Jamaica|2017

Pyrisitia parvumbra|22079HO7|Jamaica|1962

Pyrisitia memulus [not leuce]|22083H04|DR|1988

Pyrisitia memulus [not leuce]|22083H05|DR|1995

Pyrisitia memulus [not leuce]|22083H11|DR|1986

Pyrisitia leuce antillarum|22083H06|Nevis|1992

Pyrisitia leuce antillarum|22083HO7|VI:Tortola|1977

Pyrisitia leuce antillarum|22083H10|Guadeloupe|1992

Pyrisitia leuce flavilla (=hahneli)|21128F06|ST|Perulold

P. leuce athalia|22083G04|Panama|1998

Pyrisitia leuce leuce|22083H03|Paraguay|1984

P. leuce flavilla|22083H12|Brazil: AM|old

Pyrisitia leuce leuce|22083H01|Bolivia|1999

,P. westwoodii|22079H09|USA:AZ,Santa Cruz Co.|1989

rod yrisitia westwoodii|20067E07|Mexico:Gro|1981

Pyrisitia westwoodii|20067E08|Mexico:Mor|1981

2 2yrisitia westwoodii|17116H10|Mexico:Roo|1979

igyrisitia westwoodii|20061D04|Mexico:Chia|1988

Pyrisitia westwoodii|22083A02|Costa Rica|2006

Pyrisitia parvumbra|10554|Jamaica|2017

yrisitia parvumbra|22079H0O7|Jamaica|1962

Ryrisitia parvumbra|10398|Jamaica|2017

Pyrisitia parvumbra|10553|Jamaica|2017

yrisitia dina helios|5357|USA:FL,Miami-Dade Co.|2015

yrisitia dina helios|5358|USA:FL,Miami-Dade Co.|2015

Ryrisitia dina helios|5351|USA:FL,Miami-Dade Co.|2015

Pyrisitia dina helios|22079H01|Bahamas|1990

Pyrisitia dina helios|22079H03|Bahamas|1988

1 See dina dina|22042D05|ST|Cubalold

yrisitia dina dina]22079D01|Cuba:Havana|1993

Pyrisitia dina dina|22079C12|Cuba:GTMO|1994

iPyrisitia dina dina|22079D03|Cuba:Baracoa|1994

Pyrisitia dina dina|22079C11|Cuba:Granma|1995

Pyrisitia mayobanex [not dina]|22079HO5|DR|1986

Pyrisitia mayobanex [not dina]|22079H06|DR|1986

fe vicitie memulus|22083H05|DR|1995

—_______} yrisitia memulus|22083H04|DR|1988

Pyrisitia memulus|22083H11|DR|1986

Pyrisitia leuce antillarum|22083H0O7|VI:Tortola|1977

‘Pyrisitia leuce antillarum|22083H06|Nevis|1992

SPyrisitia leuce antillarum|22083H10|Guadeloupe|1992

so. leuce athalia|22083G04|Panama|1998

Pyrisitia leuce leuce|22083H01|Bolivia|1999

2Byrisitia leuce flavilla (=hahneli)|21128F06|ST|Perujold

P. leuce flavilla]22083H12|Brazil: AM|old

Pyrisitia leuce leuce|22083H03|Paraguay|1984

Fig. 3. Phylogenetic trees of Pyrisitia dina relatives inferred from protein-coding regions of a) the nuclear (autosomes) and b)

the mitochondrial genomes. Different species are shown in different colors: P. westwoodii (green), P. dina (blue), P.

mayobanex stat. nov. (red), P. parvumbra (magenta), P. memulus stat. rest. (orange), and P. /euce (violet).

Abaeis gratiosa (E. Doubleday, 1847) and Abaeis angulata (Wallengren, 1860)

are species-level taxa, not subspecies of Abaeis arbela (Geyer, 1832)

Genomic sequencing of taxa treated as subspecies of Eurema arbela Geyer, 1832 (type locality in “Java”,

possibly southern Brazil) in Lamas (2004), currently in the genus Abaeis Hiibner, [1819] (type species

Papilio nicippe Cramer, 1779) (Zhang et al. 2019b), confirms that Abaeis boisduvaliana (C. Felder & R.

Felder, 1865) (type locality in Mexico) is a distinct species due to its genetic differentiation from A.

arbela (Fig. 4 green and red). E.g., its COI barcode is 3.3% (22 bp) different. Moreover, we find that

Abaeis gratiosa (E. Doubleday, 1847), stat. rest. (type locality in Venezuela) and Abaeis angulata

(Wallengren, 1860), stat. rest. (type locality not given, likely in Ecuador) are prominently differentiated

genetically from A. arbela, A. boisduvaliana, and each other both in nuclear and mitochondrial genomes

(Fig. 4) and, therefore, are best treated as distinct species. Fst/Gmin/COI difference for the pairs of closest

(in nuclear genome) relatives are: A. gratiosa and A. arbela: 0.21/0.01/3.5% (23 bp) and A. angulata and

A. boisduvaliana: 0.64/0.001/3.6% (24 bp).

Abaeis boisduvaliana|10126|USA:TX,Cameron Co.|2017 b

Abaeis boisduvaliana|19012A04|Mexico:Tam|1970

Abaeis boisduvaliana|22085A07|USA:AZ,Pima Co.|2001

Abaeis boisduvaliana|22085B04|Mexico:Pue|1992

baeis boisduvaliana|19012A04|Mexico:Tam|1970

baeis boisduvaliana|22085B03|Mexico:Jal|1998

aeis boisduvaliana|22085B04|Mexico:Pue|1992

Abaeis boisduvaliana|22085A07|USA:AZ,Pima Co.|2001

Abaeis angulata|22085A05|Ecuador|1983

baeis angulata|22085A04|Ecuador|1998

Abaeis angulata|22085A06|Ecuador|1941

Abaeis angulata|19078E05|Peru:Piura|2000

Abaeis arbela arbela|22085C09|Peru:Cuzco|1980

nabae's arbela arbela|22085C08|Peru:MD|1981

seAbaeis arbela arbela]19078F04|Bolivia|2003

Abaeis arbela arbela|22085D01|Argentina|1986

Abaeis gratiosa|22085B08|Costa Rica|1987

baeis boisduvaliana|10126|USA:TX,Cameron Co.|2017

Abaeis boisduvaliana|22085B03|Mexico:Jal|1998

Abaeis angulata|22085A05|Ecuador|1983

Abaeis angulata|22085A04|Ecuador|1998

Abaeis angulata|22085A06|Ecuador|1941

Abaeis angulata|19078E05|Peru:Piura|2000

Abaeis gratiosa|22085B08|Costa Rica|1987

Abaeis gratiosa|19078E04|Panama|1976

Abaeis gratiosa|22085B12|Colombia|1977

Abaeis gratiosa|22085C01|Venezuela:Zulia|1982 4 100

Abaeis arbela arbela|]22085C08|Peru:MD|1981 g

Abaeis arbela arbela|22085C09|Peru:Cuzco|1980 “Abaeis gratiosa|19078E04|Panama|1976

Abaeis arbela arbela|19078F04|Bolivia|2003 Apaeis gratiosa|22085B12|Colombia|1977

Abaeis arbela arbela|22085D01|Argentina|1986 Abaeis gratiosa|22085C01|Venezuela:Zulia|1982

[a0 Abaeis adamsi|19078E01|Jamaica|1984 Abaeis adamsi|19078E01|Jamaica|1984

Abaeis adamsi|22084D07|Jamaica|1983 Abaeis adamsi|22084D07|Jamaica|1983

Fig. 4. Phylogenetic trees of Abaeis arbela species group (rooted with Abaeis adamsi comb. nov.) inferred from protein-

coding regions of a) the nuclear (autosomes) and b) the mitochondrial genomes. Different species are shown in different

colors: A. boisduvaliana (green), A. angulata (magenta), A. gratiosa (blue), and A. arbela (red).

Classification of the tribe Euremini Grote, 1898

The phylogenetic tree of the tribe Euremini Grote, 1898 (type genus Eurema Hiibner, [1819]) inferred

from protein-coding regions in the nuclear genome (autosomes only) reveals strong statistical support

(100% for most branches) and noticeable tree levels (resulting from coinciding diversifications in

different clades at about the same distance from the root) to aid its higher classification (Fig. 2). The level

closest to the origin of the tribe consists of three prominent clades that we treat as subtribes: Nathalina

Balint, 2022, stat. nov. (type genus Nathalis Boisduval, 1836), Kricogonina Balint, 2022, stat. nov. (type

genus Kricogonia Reakirt, 1864) and the nominotypical, Euremina. The former two were originally

proposed as tribes, but the early split of the subfamily Coliadinae Swainson, 1821 (type genus Colias

[Fabricius], 1807) into two prominent clades argues for treating these clades as tribes (Euremini and

Coliadini) rather than dividing them further. Therefore, further divisions would correspond to the

subtribal level. The monotypic genus Prestonia Schaus, 1920 (type species Prestonia clarki Schaus,

1920) placed in Euremini by Zhang et al. (2021) is sister to Kricogonia and diverged from it

approximately 27 million years ago (Mya), as estimated in Kawahara et al. (2023), which is close to the

split of the subtribe Euremina into two clades (25 Mya). Due to this similar level of genetic differentiation

between Kricogonia and Prestonia and between the two first clades of Euremina, Prestonia is placed in

the subtribe Kricogonina rather than in a subtribe of its own. Such classification emphasizes the sister

relationship of the two genera (Kricogonia and Prestonia) rather than the distinction between them.

While there is little doubt that the five known species in Nathalina and Kricogonina are best

classified into the three genera corresponding to the most prominent clades in the tree (Fig. 2), the

taxonomy of the subtribe Euremina is more complex. Traditionally, the entire subtribe has been treated as

a single genus Eurema Hibner, [1819] (type species Papilio delia Cramer, 1780, a junior homonym, valid

name for this species is Pieris daira Godart, 1819) (Klots 1933). However, early DNA work suggested

strong genetic differentiation within the subtribe (Pollock et al. 1998), formalized by Opler and Warren

(2002), who partitioned the US species into three genera: Eurema, Pyrisitia A. Butler, 1870 (type species

Papilio proterpia Fabricius, 1775), and Abaeis Hiibner, [1819] (type species Papilio nicippe Cramer,

1779). This split has been largely followed (Lamas 2004; Pelham 2008), although some species have been

reassigned between these genera (Zhang et al. 2019b). Our work (Zhang et al. 2019c; Zhang et al. 2019b)

and more recent publications (Kawahara et al. 2023) support the notion of strong genetic differentiation

within Euremina and date its diversification to approximately 25 Mya (Fig. 2). This level of

differentiation and age are too large for placing all Euremina in the single genus Eurema.

The subtribe Euremina splits into two prominent clades at approximately 25 Mya, as estimated by

Kawahara et al. (2023). These two clades can be taken to represent genera, and the subtribe can be

divided into two genera: Eurema and Abaeis. However, even this level of genetic differentiation and age

would be larger than for most genera of butterflies (Talavera et al. 2012; Li et al. 2019; Zhang et al.

2019a, c), and the ages between 15 and 20 Mya would be more consistent with the genus level. Even if

absolute values of age estimates are not particularly accurate due to various errors, their relative values

and the fact they are all estimated mainly with the same method and on similar datasets argue for the

validity of such comparisons of estimated ages between nodes. For these reasons, we regard the two

clades of Euremina as “sections”: the Eurema section and the Abaeis section, and take the next level in

the tree to define genera.

The next tree level, dating to approximately 20 Mya, consists of five clades, one of which is

entirely from the Old Word, the only Old Word group in the entire tribe Euremina (Fig. 2 marked with red

asterisk). We propose that these five clades represent genera in Euremina: Terias W. Swainson, 1821

(type species Papilio hecabe Linnaeus, 1758) and Eurema with its sister Pyrisitia A. Butler, 1870 (type

species Papilio proterpia Fabricius, 1775) belong to the Eurema section, and Abaeis with Teriocolias

Rober, 1909 (type species Terias atinas Hewitson, 1874, a junior subjective synonym of Terias zelia

Lucas, 1852) belong to the Abaeis section. This partitioning into genera is biogeographically significant

because it reflects the invasion of the only Euremini lineage from the New World, where the tribe likely

originated, into the Old World, giving rise to the genus Jerias, followed by its extensive diversification.

Genera of Euremina defined this way are analogous to Codatractus Lindsey, 1921 vs. Lobocla Moore,

1884, Heliopetes Billberg, 1820 vs. Pyrgus Htibner, [1819], and Oarisma Scudder, 1872 vs. Thymelicus

Hiibner, [1819] (in the latter two, pairs some species from the Old World genus returned to the New

World at a later time) and correspond to similar geological time-frame of the mid-Miocene climatic

optimum characterized by elevated biotic movement from America to Asia (Jiang et al. 2019).

The phylogenetic tree (Fig. 2) guides the assignment of species to genera, and we restore the

monophyly by proposing new genus-species combinations: Pyrisitia amelia (Poey, [1852]), comb. nov..,

Pyrisitia lirina (H. Bates, 1861), comb. nov., Abaeis paulina (H. Bates, 1861), comb. nov., Abaeis

xantochlora (Kollar, 1850), comb. nov., Abaeis fabiola (C. Felder & R. Felder, 1861), comb. nov.,

Abaeis tupuntenem (Lichy, 1976), comb. nov., Abaeis adamsi (Lathy, 1898), comb. nov., Abaeis brephos

(Hiibner, [1809]), comb. nov., and Abaeis elvina (Godart, 1819), comb. nov. The latter two combinations

reflect our treatment of Leucidia E. Doubleday, 1847, stat. nov. (type species Pieris elvina Godart, 1819)

as a subgenus of Abaeis despite its unique phenotype. Such treatment results in a more internally

consistent classification because an Abaeis that includes Leucidia corresponds to a more prominent clade

in the tree, and the Leucidia clade has split from the rest of Abaeis at the tree level corresponding to

subgenera (Fig. 2). This level allows us to define five subgenera in Euremina in addition to the five genera

(Fig. 2 and listed below). Finally, we note that Teriocolias doris (Rober, 1909), stat. rest. (type locality in

Bolivia), currently regarded as a subspecies of Teriocolias deva (E. Doubleday, 1847) (type locality in

French Guiana), is genetically very distant from it: e.g., COI barcodes differ by 7.6% (50 bp) and is a

distinct species.

Below is a proposed classification of the tribe Euremini. Only available genus-group names are

listed; subspecies names are not given and can be found on the Butterflies of America website (Warren et

al. 2023), and the Old Word species are not provided (all belong to the genus Terias, which consists only

of Old World species). Type genus (for family-group names) or type species (for genus-group names)

names are given in parenthesis; synonyms are preceded by = and all but subjective synonyms also by ¢

with a valid name of this species following the colon. New taxa and status changes are shown in red font.

Tribe Euremini Grote, 1898 (Eurema Hibner, [1819])

Subtribe Nathalina Balint, 2022, stat. nov. (Nathalis Boisduval, 1836)

Genus Nathalis Boisduval, 1836 (Nathalis iole Boisduval, 1836)

Nathalis iole Boisduval, 1836

Nathalis plauta E. Doubleday, 1847

Subtribe Kricogonina Balint, 2022, stat. nov. (Kricogonia Reakirt, 1864)

Genus Kricogonia Reakirt, 1863 (Colias lyside Godart, 1819)

Kricogonia lyside (Godart, 1819)

Kricogonia cabrerai Ramsden, 1920

Genus Prestonia Schaus, 1920 (Prestonia clarki Schaus, 1920)

Prestonia clarki Schaus, 1920

Subtribe Euremina Grote, 1898 (Eurema Hibner, [1819])

Eurema section

Genus Terias W. Swainson, 1821 (Papilio hecabe Linnaeus, 1758)

Consists of all Old World species of Euremini

Subgenus Maiva Grose-Smith & W.F. Kirby, 1893 (=M. sulphurea Gr-Sm. & Kirby: Papilio brigitta Stoll, 1780)

=Kibreeta F. Moore, 1906 (={Papilio libythea Fabricius, 1798: Terias brigitta rubella Wallace, 1867)

=Nirmula F. Moore, 1906 (=Terias venata F. Moore, 1858: Terias laeta Boisduval, 1836)

Subgenus Jerias W. Swainson, 1821 (Papilio hecabe Linnaeus, 1758)

Genus Eurema Hubner, [1819] (=tPapilio delia Cramer, 1780: Pieris daira Godart, 1819)

Eurema priddyi (Lathy, 1898)

Eurema lucina (Poey, [1852])

Eurema daira (Godart, 1819)

Eurema elathea (Cramer, 1777)

Eurema nigrocincta Dognin, 1889

Eurema agave (Cramer, 1775)

Eurema phiale (Cramer, 1775)

Genus Pyrisitia A. Butler, 1870 (Papilio proterpia Fabricius, 1775)

Subgenus Pyrisitia A. Butler, 1870 (Papilio proterpia Fabricius, 1775)

Pyrisitia proterpia (Fabricius, 1775)

Pyrisitia westwoodii (Boisduval, 1836)

Pyrisitia dina (Poey, 1832)

Pyrisitia mayobanex (M. Bates, 1939), stat. nov.

Pyrisitia parvumbra (Kaye, 1925)

Pyrisitia memulus (A. Butler, 1871), stat. rest.

Pyrisitia leuce (Boisduval, 1836)

Pyrisitia larae (Herrich-Schaffer, 1862)

Pyrisitia venusta (Boisduval, 1836)

Pyrisitia chamberlaini (A. Butler, 1898)

Pyrisitia nise (Cramer, 1775)

Pyrisitia lisa (Boisduval & Le Conte, [1830])

Pyrisitia euterpiformis (Munroe, 1947)

Pyrisitia amelia (Poey, [1852]), comb. nov.

Pyrisitia portoricensis (Dewitz, 1877)

Pyrisitia pyro (Godart, 1819)

Pyrisitia messalina (Fabricius, 1787)

Subgenus Lirinia Grishin, subgen. n.

Pyrisitia lirina (H. Bates, 1861), comb. nov.

Abaeis section

Genus Abaeis Hubner, [1819] (Papilio nicippe Cramer, 1779)

Subgenus Leucidia E. Doubleday, 1847 (Pieris elvina Godart, 1819), stat. nov.

Abaeis brephos (Hubner, [1809]), comb. nov.

Abaeis elvina (Godart, 1819), comb. nov.

Subgenus Lucidia Lacordaire, 1833 (Papilio albula Cramer, 1775)

Abaeis albula (Cramer, 1775)

Subgenus Sphaenogona Butler, 1870 (Terias bogotana C. & R. Felder, 1861: a ssp. of 7. mexicana Boisduval)

Abaeis paulina (H. Bates, 1861), comb. nov.

Abaeis xantochlora (Kollar, 1850), comb. nov.

Abaeis fabiola (C. Felder & R. Felder, 1861), comb. nov.

Abaeis tupuntenem (Lichy, 1976), comb. nov.

Abaeis salome (C. Felder & R. Felder, 1861)

Abaeis mexicana (Boisduval, 1836)

Abaeis boisduvaliana (C. Felder & R. Felder, 1865)

Abaeis angulata (Wallengren, 1860), stat. rest.

Abaeis gratiosa (E. Doubleday, 1847), stat. rest.

Abaeis arbela (Geyer, 1832)

Abaeis adamsi (Lathy, 1898), comb. nov.

Subgenus Abaeis Hubner, [1819] (Papilio nicippe Cramer, 1779)

Abaeis nicippe (Cramer, 1779)

Abaeis nicippiformis (Munroe, 1947)

Genus Teriocolias Rober, 1909 (=Terias atinas Hewitson, 1874: Terias zelia Lucas, 1852)

Teriocolias deva (E. Doubleday, 1847)

Teriocolias doris (Rober, 1909), stat. rest.

Teriocolias zelia (Lucas, 1852)

Teriocolias reticulata (A. Butler, 1871)

Subtribes in Coliadini Swainson, 1821

The genomic tree reveals four prominent clades in the tribe Coliadini Swainson, 1821 that are at

approximately the same distance from the root (Fig. 5). We propose treating these clades as subtribes.

Three of these subtribes have names: the nominotypical one, Callidryina Kirby, 1896, stat. nov., and

Gonepterygina Verity, 1920, stat. nov. The name Callidryina is formed from the genus Callidryas

Boisduval & Le Conte, 1830 (type species Papilio eubule Linnaeus, 1767), which is currently treated as a

junior subjective synonym of Phoebis Hiibner, [1819] (type species Phoebis cypris Hiibner, [1819], which

is an unjustified emendation of Papilio cipris Cramer, 1777, which is a junior subjective synonym of

Papilio argante Fabricius, 1775). Callidryina consists of two closely related genera, Phoebis (that

includes Rhabdodryas Godman & Salvin, 1889) and Aphrissa Butler, 1873. In addition to the type genus

Gonepteryx Leach, 1815, we place Dercas E. Doubleday, 1847 in Gonepterygina. The fourth subtribe

does not have a name. It is described below.

Gandacina Grishin, new subtribe

http://zoobank. org/EF448D21-E251-4ABA-9A22-22EBD93A8303

Type genus. Gandaca F. Moore, 1906.

Definition. Gandaca (type species Terias harina Horsfield, 1829) is sister to Gonepterygina Verity, 1920,

Ys Nathalis iole|3572|USA:TX,Cameron Co.|2015

100 Kricogonia lyside|3423|USA:TX,Cameron Co.|2015

3 Eurema daira|4872|USA:FL,Monroe Co.|2015

Gandacina 9 Gandaca harina|19067HO1|Myanmar|2003

Ab “a Gandaca butyrosa|19079A06|PT of cuneata|Indonesia:Seram|1919

5a Dercas verhuelli]19067F01|Malaysia|1991

RS F Gonepteryx rhamni|15112HO05|Finland|2003

100 Gonepterygina Anteos maerula|10234|USA:TX,Cameron Co.|2017

Coliadinal 746 Zerene cesonia|3980|USA:TX, Dallas Co.|2015

100 Colias hyale|19063E10|Croatia|1979

Catopsilia crocale|19067E07|Taiwan|1973

100 Aphrissa statira|16107D11|USA:TX,Nueces Co.|2013

a4 Phoebis argante|17116HO5|Mexico:QRoo|1979

=o 108 Phoebis trite]19063C12|Ecuador|1993

Callidryina Phoebis sennae eubule|3314|USA:TX,San Jacinto Co.|2015

Pieris brassicae|15112G01|Germany|1986

Ascia monuste|4148|USA:TX,Jefferson Co.|2015

Aporia crataegi|19068E09|Albania|1991

100

ly = Cepora nerissa|19068H06|Myanmar|2003

a 9) ©Belenois calypso|19068G08|Nigeria|1974

pt Too ~4Belenois raffrayi|19068H04|Ethiopia|1973

a oo— Belenois creona|19068G10|Zaire|1985

100 Belenois java|19068H02|Indonesia:_Lombok|1990

ae Pseudanaphaeis gidica [not Belenois]|19068G12|Zambia|1980

100 Dixeia charina|19069F05|South Africa|1965

a6 Aoa affinis|19068D07|Indonesia:Sulawesilold

52 Appias olferna|19068F08|Myanmar|2001

Elodina egnatia|21129C04|Indonesia:Wetar|1892

84 oe Leptosia nina] 19068C03|Indonesia: Balilold

—__—___________— _Calopieris eulimene|20033F04|Eritrea|1954

, Anthocharidina Anthocharis cardamines|17115H10|Spain|2005

aoe t Euchloe crameri|19068A01|Portugal|1978

Eroessa chiliensis|19067G10|Chile|1987

o Hesperocharis erota|19068A08|Brazil:RJ|1995

Hebomoiina ihe ue glaucippe|19068A05|Myanmar|2003

ebomoia leucippe|19083C05|Indonesia:Seram|2019

Nepheronia argia|19068D02|no data

Pareronia valeria|19068D05|Myanmar|2003

Colotis amata|19068H11|India:Assam|1971

Teracolus subfasciatus|19069E08|South Africa|1978

Leptidea sinapis|18017C07|Sweden|1971

ee Leptidea gigantea|19067G01|China|old

100 Pseudopierina 70 Pseudopieris viridula|22062G02|Peru:Cuzco|2017

Pseudopieris nehemia|7728|Peru:MD|2013

Moschoneura pinthous|19067G04|Peru:MD|2016

Dismorphia laja]19067H11|Guyana|1999

Enantia melite|19067H12|Guyana|1999

100

7 = 100

0.06 Dismorphiina 100

Fig. 5. The phylogenetic tree of selected Pieridae inferred from protein-coding regions of the nuclear genome (autosomes).

Family-group names are shown by corresponding branches, or an arrow points to the branch. Names, clades, and species of

new subtribes proposed in this work are shown in color, except that red indicates a reinstated genus Pseudanaphaeis (not a

synonym of Be/enois). Names of other subtribes are shown in black, and names of subfamilies and tribes are shown in shades

of gray. Note the extreme variation of base-pair substitution rate in Pieridae, where DNA of some taxa (e.g., Gonepteryx)

changes at least two times slower than others (e.g., Bel/enois), as evidenced by the distance from the root to these leaves.

Therefore, no vertical bars or lines can demarcate tribes and subtribes in this tree, where branch length corresponds to the

estimated number of base pair changes along the branch.

stat. nov. but is more distant from the members of this subtribe both genetically and phenotypically.

Furthermore, the statistical support for Gonepterygina to include Gandaca is lower than for most other

clades in the tree (88%) (Fig. 5). Therefore, the clade with Gandaca is defined as a subtribe. This new

subtribe is diagnosed by the following characters: in male genitalia, uncus pointed dorsad at the base, with

dorsal margin strongly arched and finely serrated, uncus shorter than in relatives and broader towards its

distal end in dorsal view; in female genitalia, corpus bursae nearly spherical with a ring-shaped signum at

its base and an appendix that is larger than the corpus itself; in facies, is more similar to Eurema Hiibner,

[1819] and relatives (tribe Euremini Grote, 1898) than to Gonepterygina: lemon-yellow wings without

central spots, hindwings plain or with dark margin by the apex and forewings with dark apex continuing

into thin marginal border. See Kaur et al. (2022) for illustrations. A combination of the following nuclear

genomic base pairs is diagnostic: pse19182.2.2:A3375G, pse1982.1.2:A51T, pse200.39.1:T1209C, pse1378.

26.1:G839A, pse200.29.1:C1534G.

Genera included. Only the type genus.

Parent Taxon. Tribe Coliadini Swainson, 1821.

Pseudanaphaeis Bernardi, 1953 is a genus distinct from Belenots Hiibner, [1819]

Currently considered a junior subjective synonym of Belenois Hitibner, [1819] (type species Papilio

calypso Drury, 1773, sequenced as NVG-19068G08), Pseudanaphaeis Bernardi, 1953 (type species

Pieris gidica Godart, 1819, sequenced as NVG-19068G12), is not monophyletic with it, and instead is

sister to Dixeia Talbot, 1932 (type species Pieris charina Boisduval, 1836, sequenced as NVG-19069F05)

(Fig. 5). Extensive genetic differentiation between Dixeia and Belenois precludes from considering them

congeneric. Therefore, we propose to treat Pseudanaphaeis Bernardi, 1953, stat. rest. as a distinct genus.

Hebomoiina Grishin, new subtribe

http://zoobank. org/71C79A DE-4BBF-4CC8-86B6-33 1BCD38863B

Type genus. Hebomoia Hiibner, [1819].

Definition. Hebomoia (type species Papilio glaucippe Linnaeus, 1758) belongs to the tribe

Anthocharidini Scudder, 1889, but is genetically differentiated from its other genera (Fig. 5). Phenoty-

pically, species in this lineage are characterized by a more robust appearance that the rest of the tribe.

Therefore, we propose that the clade with Hebomoia corresponds to a subtribe. This new subtribe is

diagnosed by a bifurcate uncus and bifurcate valva, forewing with five radial veins, two of which and M;

(not stalked with R) originate at the discal cell, larger size (forewing longer than 40 mm), and pointed

broadly orange apex of the forewing. See Klots (1933) for additional discussion and illustrations of these

characters given for Hebomoia. A combination of the following nuclear genomic base pairs is diagnostic:

pse123.37.1:A2228G, pse123.37.1:T1285A, pse9809.2.1:G1812A, pse657.5.2:A89G, pse5906.8.2:G3017A.

Genera included. Only the type genus.

Parent Taxon. Tribe Anthocharidini Scudder, 1889.

Tribes and subtribes in Dismorphiinae Schatz, 1886

The subfamily Dismorphiinae Schatz, 1886 splits into two prominent clades that we propose to treat as

tribes: the nominotypical and Leptidiini Grote,1897, stat. rev., which is monotypic (Fig. 5). The two

tribes are well-defined morphologically (Klots 1933) and biogeographically, with Leptidiini being the Old

World tribe and Dismorphiini restricted to the New World.

Pseudopierina Grishin, new subtribe

http://zoobank. org/253 17F65-DA92-4FD 1-88BB-ED275C6B46A 1

Type genus. Pseudopieris Godman & Salvin, 1890.

Definition. Pseudopieris (type species Pieris nehemia Boisduval, 1836) is sister to and is stronger

differentiated genetically from the rest of Dismorphiini Schatz, 1886 (Fig. 5). Therefore, combined with

phenotypic differences, we propose that the lineage with Pseudopieris corresponds to a subtribe. This new

subtribe is distinguished from the rest of Dismorphiini (and Dismorphiinae, for that matter) by much

broader wings that are more like in Pieris Schrank, 1801, rather than the elongated wings of

Dismorphiinae, the last abdominal segment with rounded lobes and a cleft, and Mi: stalked with R stem on

the forewing. See Klots (1933) for details and illustrations given for Pseudopieris. A combination of the

following base pairs in the nuclear genome is diagnostic: pse7986.9.2:A4048G, pse19182.2.2:T3830C,

pse165.20.1:A803T, pse578.3.2:C31A, pse578.3.2:A12G.

Genera included. Only the type genus.

Parent Taxon. Tribe Dismorphiini Schatz, 1886.

Family Nymphalidae Rafinesque, 1815

Libytheana Michener, 1943 is a genus distinct from Prolibythea Scudder, 1889

Considered synonyms in some publications (Kawahara 2009; Sohn et al. 2012), fossil Prolibythea

Scudder, 1889 (type species Prolibythea vagabunda Scudder, 1889) and contemporary Libytheana

Michener, 1943 (type species Libythea bachmanii Kirtland, 1851, which is regarded as a subspecies of

Papilio carinenta Cramer, 1777), both American, are separated by at least 30 million years according to

the age estimate of the fossil as late Priabonian (Sohn et al. 2012). The typical age of congeners is not

larger than 20 million years. Furthermore, the divergence between Libytheana and the Old World genus

Libythea [Fabricius], 1807 (type species Papilio celtis Laicharting, 1782) was dated to about 12 Mya

(Kawahara et al. 2023), which is more recent than 30 Mya. Thus, it is most likely that Prolibythea lived

before the divergence between Libytheana and Libythea. Therefore, if Libytheana and Libythea are

treated as separate genera, then Prolibythea is not congeneric with Libytheana to avoid paraphyly.

The tribe Vagrantini Pinratana & Eliot, 1996 as currently defined is paraphyletic

Currently, the tribe Vagrantini Pinratana & Eliot, 1996 consists of ten genera: Vagrans Hemming, 1934,

Cupha Billberg, 1820, Phalanta Horsfield, 1829, Smerina Hewitson, 1874, Terinos Boisduval, 1836,

Algia Herrich-Schaffer, 1864), Algiachroa Parsons, 1989, Cirrochroa E. Doubleday, 1847, Lachnoptera

E. Doubleday, 1847, and Vindula Hemming, 1934 (Wahlberg 2019). However, our genomic tree reveals

that Vagrantini, defined to include all ten genera, is paraphyletic with respect to Argynnini Swainson,

1833 with the highest support (Fig. 6). The first five genera listed above form a clade sister to Argynnini.

This clade includes Vagrans, which is the type genus of Vagrantini. Therefore, to restore monophyly, we

restrict Vagrantini to include only these five genera: Vagrans, Cupha, Phalanta, Smerina, and Terinos.

The remaining five genera previously included in Vagrantini form a clade sister to both Vagrantini and

Argynnini (Fig. 6) and, therefore, belong to other tribes. No published family-group names have been

formed from any of these five genera; hence, these other tribes are new. They are described below.

Vindulini Grishin, new tribe

http://zoobank. org/151AC163-E036-49BE-A49C-48D7B9F0108F

Type genus. Vindula Hemming, 1934.

Dryas iulia]|19094A02|Puerto Rico|1977

100 = Dione juno|17117B01|Mexico:SLP|1978

100 Cethosiina Heliconius charithonia|5097|USA:TX,Starr Co.|2015

Cethosia cydippe|19076HO7|Papua New Guinea|2011

Ar raci 100 Acraea horta|19077E10|South Africa

cea 100 Actinote thalia|19076H12|Surinamejold

Stephenia hypatia|19093H03|Mali|1982

Pardopsis punctatissima|19077D12|Madagascar|1983

ant ‘Ps Argynnis paphia|PAOE21|Germany|2017

98 ee Issoria lathonia|19077D05|France|2008

Euptoietina Yramea cytheris|19077D08|Chile|1998

Euptoieta claudia|3706|USA:TX,Dallas Co.|2015

Terinos clarissa|19076G09|Malaysia:Malaccalold

99 Vagrantina Cupha erymanthis|19076H0O1|Malaysia:Johor|1991

EA ee Vagrans egista sinha|19076H04|Indonesia:Sumatra|1991

100 *Sntetitina Phalanta phalantha|19076HO5|Myanmar|2001

Vindulini Smerina manoro|19076H02|Madagascar|old

Vindula arsinoe|19076G04|Papua New Guinea|1978

ne Alaiina a Algia satyrina|19076G07|Indonesia:Sulawesi|1891

Alaiini g TOO Algiachroa woodfordi|22029B04|PNG:Shortlands|old

700] Lachnopterina Cirrochroa aoris|19076G11|India|1972

Lachnoptera anticlia}19076G12|Cameroon|1987

Neptis sappho|19096G02|Myanmar|2001

100 Pantoporia hordonia|19096G09|Myanmar|2001

Limenitis populi|19077B06|China:Heilongjiang|1983

Athyma perius|19077F12|Myanmar|2001

Moduza procris|19077F02|Myanmar|2001

Neurosigma siva|19096F03|Myanmar|2003

Chalinga elwesi|19077B04|China:Yunnanlold

Lebadea martha|19096G01|Myanmar|2003

Pseudacraea eurytus|19096H03|Cameroon|1989

Abrota ganga|19096A01|no datalold

Hamanumida daedalus|19096B06|Rhodesia|1968

Cynandra opis|19096E08|Cameroon|1987

Bebearia brunhilda|19096A02|Uganda|1973

Euphaedra erasmus|19096B11|Cameroon|1987

Evena crithea|19096B05|Uganda|1973

Euthalia lubentina|19096A05|Myanmar|2000

Euthalia aconthea|19096A06|Singapore|1990

Pseudathyma neptidina|19096C02|PT of jacksoni|Kenya|1964

Pseudathyma plutonica|19096C03|Kenya|1964

: TT Cymothoe althea|19096C10|Cameroon|1973

Cymothoinar Harma theobene|19096D01|Cameroon|1987

rs Kumbtialina Bhagadatta austenia|SAMN18587126|LEP59475|Vietnam

Kumothales inexpectata|SAMN18673351|KA-18-123-ABRI|Congo

TT PSeudoneptis bugandensiS|SAMN18673582|FH-18-Z056| TOGO

Parthenos sylvia|19083C10|Malaysia:Pahang|2019

Nymphalis polychloros|19093E04|France|1976

100 Terinosina

100

100° Biblidinae C7. ———C(”*C“C-»rresttis thyornnieus|19095B06|Indonesia:Sulawesi|1978

Biblis hyperia|19094E05|British Virgin Islands|1984

14. _Apatura iris|19094C01|Slovakia|1966

100 aT Pseudergolis avesta|19094F03|Indonesia:Sulawesilold

Pseudergolis wedah|19094F04|Myanmar|2001

Dichorragia nesimachus|19094F05|Myanmar|2001

Stibochiona coresia|19094F06|Javalold

Amnosia decora|19094F02|Javalold 0.05

100

100 100

Amnosiini

Fig. 6. The phylogenetic tree of selected Nymphalidae inferred from protein-coding regions of the nuclear genome

(autosomes). Sequences of the three samples with numbers starting with “SAMN” were taken from the alignment provided in

Supplementary materials to Kawahara et al. (2023). Family-group names are shown above or below the corresponding

branches. Names, clades, and species of new tribes and subtribes proposed in this work are shown in color. Names of other

subtribes are shown in black, and names of subfamilies and tribes are shown in shades of gray. The translucent vertical lime

bar denotes a level in the tree approximately corresponding to subtribes; however, due to variation in base pair substitution

rates (1.e., not all tree leaves are at the same level), the correspondence may not be exact. E.g., DNA changes in Argynnini are

slower than in most other groups (many Argynnini leaves are closer to the left compared to most others); hence, the level is

shifted to the left, which also preserves the originally proposed (Simonsen 2006) division into two and not three subtribes.

Definition. Vindula (type species Papilio arsinoe Cramer, 1777) constitutes a lineage sister to four other

genera that were previously included in Vagrantini Pinratana & Eliot, 1996 but did not belong to this tribe

(see above). This lineage diverged from these other genera at about the same level as (if not earlier than)

Vagrantini from Argynnini Swainson, 1833, and therefore corresponds to a tribe (Fig. 6). This new tribe

is distinguished from its relatives by sclerotized subpapillary glands in females and forked humeral vein

(Penz and Peggie 2003). A combination of the following nuclear genomic base pairs is diagnostic:

hm2013347-RA.4:T162C, hm2013540-RA.5:G265A, hm2015146-RA.7:G80A, hm2015146-RA.7:G79A,

hm2013347-RA.4:A220C.

Genera included. Only the type genus.

Parent Taxon. Subfamily Heliconiinae Swainson, 1822.

Algiini Grishin, new tribe

http://zoobank.org/AE49C6E7-8E5 1-4E4E-9947-151B37A467E8

Type genus. A/gia Herrich-Schaffer, 1864.

Definition. This tribe corresponds to the second major subclade in the clade that is sister to both

Argynnini Swainson, 1833 and Vagrantini Pinratana & Eliot, 1996. This subclade is sister to Vindulini

trib. n., diverging from it at about the same level as (if not earlier than) Argynnini from Vagrantini (Fig.

6). Due to this prominent genetic differentiation, it is defined as a tribe. This new tribe is distinguished

from its relatives by unsclerotized subpapillary glands in females, forked humeral vein, and/or smooth

eyes and undifferentiated androconial scales, or by an oval patch of androconial scales in males in the

apical area of dorsal hindwing covering 1/7—1/6 of its surface (Penz and Peggie 2003). A combination of

the following nuclear genomic base pairs is diagnostic: hm2000037-RA.1:C698G, hm2008858-RA. 12:

T1021C, hm2008858-RA.12:C1022T, hm2016824-RA.4:C154A, hm2017493-RA.1:A2480G.

Genera included. The type genus (1.e., A/gia Herrich-Schaffer, 1864), Algiachroa Parsons, 1989,

Cirrochroa E. Doubleday, 1847, and Lachnoptera E. Doubleday, 1847.

Parent Taxon. Subfamily Heliconiinae Swainson, 1822.

Lachnopterina Grishin, new subtribe

http://zoobank.org/8 BBABF 1F-145B-4A67-94F5-F498130FB857

Type genus. Lachnoptera E. Doubleday, 1847.

Definition. Lachnoptera (type species Papilio iole Fabricius, 1781) forms a lineage that splits from all

other Algiini trib. n. at the tree level of subtribes (Fig. 6), therefore representing a subtribe. This new

subtribe is distinguished from its relatives by unsclerotized subpapillary glands in females (Penz and

Peggie 2003) and an oval patch of androconial scales in males in the apical area of dorsal hindwing

covering 1/7—1/6 of its surface. A combination of the following nuclear genomic base pairs is diagnostic:

hm2008958-RA.5:T118G, hm2008958-RA.5:G1I19T, hm2006642-RA.2:A2275C, hm2006706-RA.1:A709T,

hm2006706-RA.1:A748T, hm2015589-RA.1:A1852A (not C), hm2014529-RA.4:A139A (not G), hm2012118-

RA.6:A79A (not G), hm2016492-RA.5:A1813A (not G), hm2016492-RA.5:C1831C (not A).

Genera included. Only the type genus.

Parent Taxon. Tribe Algiini Grishin, trib. n.

Terinosina Grishin, new subtribe

http://zoobank. org/3 IDFAAA5-EA63-43 1B-AC9D-BF686549FEC8

Type genus. Zerinos Boisduval, 1836.

Definition. Terinos (type species Terinos clarissa Boisduval, 1836) forms a deep-diverging lineage in the

tribe Vagrantini Pinratana & Eliot, 1996 at about the tree level corresponding to subtribes (Fig. 6) and,

therefore, represents a subtribe. This new subtribe is distinguished from its relatives by a combination of

the following characters: larval head with scoli, hindwing cell closed, a fold across the forewing between

R and M veins, vein R2 arising from discal cell, vein R4 arising at about the end of R2, humeral vein

simple and straight, gnathos arms not ventrally fused, valva with a long (about 2/3 of valva length)

projection off its base inside (Penz and Peggie 2003). A combination of the following base pairs in the

nuclear genome is diagnostic: hm2007153-RA.3:A305G, hm2014625-RA.4:T887A, hm2012596-RA. 1:

C853G, hm2011273-RA.1:T484G, hm2011273-RA.1:G486A.

Genera included. Only the type genus.

Parent Taxon. Tribe Vagrantini Pinratana & Eliot, 1996.

Smerinina Grishin, new subtribe

http://zoobank.org/O6DF6620-9B17-4522-9E4B-BD5342AC8DF5

Type genus. Smerina Hewitson, 1874.

Definition. Smerina (type species Smerina vindonissa Hewitson, 1874) forms a deep-diverging lineage in

the tribe Vagrantini Pinratana & Eliot, 1996 at about the tree level corresponding to subtribes (Fig. 6) and

therefore represents a subtribe. This new subtribe is distinguished from its relatives by a combination of

the following characters: papilla anales moderately retracted (not deeply) inside the body, aedeagus not

broadened at the tip in ventral view, costa of valva with one spiny process (Penz and Peggie 2003),

forewing apex more produced and hindwing margin evenly curved (not wavy, no tails). A combination of

the following base pairs in the nuclear genome is diagnostic: hm2015462-RA.1:T360C, hm2015689-RA.

5:T57C, hm2009280-RA.3:T94G, hm2010526-RA.2:A67G, hm2017391-RA.1:A139C.

Genera included. Only the type genus.

Parent Taxon. Tribe Vagrantini Pinratana & Eliot, 1996.

Lebadeini Grishin, new tribe

http://zoobank. org/F26F93 LE-9141-4329-92B6-6E86A9F369E9

Type genus. Lebadea C. Felder, 1861.

Definition. Lebadea (type species Limenitis ismene E. Doubleday, 1848, which is a junior subjective

synonym of Papilio martha Fabricius, 1787), currently in Neptini Newman, 1870 (Dhungel and Wahlberg

2018; Wahlberg 2019) is not monophyletic with it and instead is placed as sister to the clade of Chalingini

Hemming, 1960 and Limenitidini Behr, 1864 but with weak support; therefore, it is distinct from them

(Fig. 6). Thus, this lineage, currently consisting only of Lebadea, represents a tribe that does not have a

name. This new tribe is diagnosed by a combination of the following characters: tegumen and uncus are

smaller than typical for Limenitidini, uncus is more gracile, thus more similar to Neptis [Fabricius], 1807,

and differs from Neptis in having a well-defined and projecting anteriad lobe (not just a hump) on the

dorsal side of the segment A2 in the pupa (Willmott 2003). A combination of the following nuclear

genomic base pairs is diagnostic: hm2005025-RA.3:C373A, hm2006832-RA.2:C97A, hm2004700-RA. 1:

CS590A, hm2004700-RA.1:G351T, hm2005025-RA.3:G319A.

Genera included. Only the type genus.

Parent Taxon. Subfamily Limenitidinae Behr, 1864.

Comment. Using morphological analysis, Willmott (2003) has placed Lebadea in the “Limenitis group”

of genera away from Neptis, which seems to agree more with our genomic results.

Subtribes in Adoliadini Doubleday, 1845

Currently, no subtribes are in use for Adoliadini (Wahlberg 2019). However, our genomic tree reveals

five prominent clades in this tribe (Fig. 6), confirming the results reported by Dhungel and Wahlberg

(2018). We propose to treat these clades as subtribes. This subtribal arrangement will bring additional

order to the species-rich tribe Adoliadini. Three of these subtribes have names: the nominotypical one,

Abrotina Hemming, 1960, stat. nov., and Bebeariina Hemming, 1960, stat. nov. (the last two were

originally proposed as tribes), and two do not. They are described below.

Evenaina Grishin, new subtribe

http://zoobank.org/AB51B17D-4CB5-4909-8C7C-C76C81E84C4B

Type genus. Evena Westwood, 1850.

Definition. Evena (type species Papilio crithea Drury, 1773) forms a prominent phylogenetic lineage

within Adoliadini Doubleday, 1845 on par with other subtribes (Fig. 6) and therefore represents a new

subtribe. The new subtribe is diagnosed by genitalia and venation as described in detail and illustrated by

Chermock (1950) for the genus Catuna W. F. Kirby, 1871 (a junior objective synonym of Evena). In

brief, uniquely long and narrow saccus nearly as long as valva and R: vein arising before the end of the

discal cell, then fusing with Sc for some distance and diverging to meet costal margin are diagnostic.

Furthermore, the subtribe is recognized by the unique appearance of its species, somewhat resembling

Heliconiinae Swainson, 1822: with elongated forewings and shorter, rounded hindwings, spider-web

forewing pattern, and a pale frequently triangular area across the hindwing toward the apex, hidden from

view when the butterfly is sitting. A combination of the following nuclear genomic base pairs is

diagnostic: hm2005164-RA.2:C119T, hm2017194-RA.1:C92T, hm2017194-RA.1:G298A, hm2005515-RA.6:

C97G, hm2016751-RA.4:C44T, hm2007706-RA.6:G759G (not T), hm2009397-RA.1:A367A (not T),

hm2020285-RA.1:C553C (not A), hm2020285-RA.1:A554A (not G), hm2004293-RA.6:A149A (not G).

Genera included. Only the type genus.

Parent Taxon. Tribe Adoliadini Doubleday, 1845.

Comment. The name for the subtribe is formed by taking the entire name of the type genus as a root to

avoid homonymy with Evenina Faynel & Grishin, 2022 (type genus Evenus Hiibner, [1819], in Eumaeini

E. Doubleday, 1847).

Pseudathymina Grishin, new subtribe

http://zoobank.org/55581E3A-18C6-492F-BD1A-3B3F205896AF

Type genus. Pseudathyma Staudinger, 1891.

Definition. Pseudathyma (type species Pseudacraea sibyllina Staudinger, 1890) forms a prominent

phylogenetic lineage within Adoliadini Doubleday, 1845 on par with other subtribes (Fig. 6) and,

therefore, represents a new subtribe. This new subtribe is diagnosed by open discal cells of both wings, Ro

that originates slightly beyond, instead of before, the end of the discal cell, and the absence of the anal

lobe on the hindwing, per Chermock (1950), who gave these characters for Pseudathyma. In wing

patterns, members of this subtribe are more similar to Neptis [Fabricius], 1807 in having four generally

pale areas on the forewing (by the middle of the inner margin, in the discal area distad of the discal cell,

by the apex, and in the discal cell) than to most Adoliadini. A combination of the following nuclear

genomic base pairs is diagnostic: hm2007185-RA.1:A1149G, hm2007185-RA.1:C1150T, hm2017262-RA.1:

A935G, hm2018054-RA.1:TIS55C, hm2017807-RA.2:A68T.

Genera included. Only the type genus.

Parent Taxon. Tribe Adoliadini Doubleday, 1845.

Kumothalina Grishin, new subtribe

http://zoobank. org/101F0041-F957-4CD5-92F7-079A780A043D

Type genus. Kumothales Overlaet, 1940.

Definition. Wahlberg et al. (2020) placed Kumothales (type species Kumothales inexpectata Overlaet,

1940) in the tribe Cymothoini Dhungel & Wahlberg, 2018. Our analysis confirms this conclusion and

previously published phylogenies (Wahlberg et al. 2020; Kawahara et al. 2023) and places the

Kumothales \ineage as sister to all other Cymothoini that diverged from them before the divergence of

Adoliadini Doubleday, 1845 into subtribes (Fig. 6). This substantial genetic differentiation of Kumothales

is also the reason for the difficulty in finding the place for this genus in taxonomic hierarchy without

DNA analysis. Therefore, this lineage represents a subtribe. This new subtribe is distinguished from its

relatives by the details of wing venation as described for Kumothales by Overlaet (1940) and a

combination of the following characters: wings less rounded, forewing apex lobed, hindwing margin

wavy, wings without bands, with a unique submarginal wavy pattern consisting of dark inverted deep U

with a sharp tooth (narrow V) inserted into it in every cell. A combination of the following nuclear

genomic base pairs is diagnostic: hm2008200-RA.1:A517C, hm2006358-RA.1:C1I1IS51A, hm2009464-

RA.1:C128T, hm2010867-RA.7:G38C, hm2012380-RA.2:A48G, hm2012713-RA.1:T428T (not C),

hm2012713-RA.1:G946G (not A), hm2007718-RA.2:C205C (not A), hm2006845-RA.2:T1311T (not A),

hm2006845-RA.2:A1314A (not G).

Genera included. Only the type genus.

Parent Taxon. Tribe Cymothoini Dhungel & Wahlberg, 2018.

Amnosiini Grishin, new tribe

http://zoobank.org/AD32BD0A-6755-4650-AB24-3FD7A43DFA06

Type genus. Amnosia E. Doubleday, 1849.

Definition. Amnosia (type species Amnosia decora E. Doubleday, 1849) belongs to the subfamily

Pseudergolinae Jordan, 1898, but is more distant from and sister to the rest of the subfamily (Fig. 6).

Genetic differentiation of the Amnosia lineage from other Pseudergolinae is at the level of a tribe.

Therefore, we propose that the Amnosia lineage corresponds to a tribe. This new tribe is diagnosed by a

combination of the following characters: wings mostly dark in males, forewing with a pale stripe from

mid-costa to tornus, and hindwing with two pairs of larger submarginal eyespots beneath that are better

defined than in other Pseudergolinae. A combination of the following nuclear genomic base pairs is

diagnostic: hm2002290-RA.3:A49G, hm2013678-RA.4:A234C, hm2013678-RA.4:G246A, hm2013678-RA.4:

T294C, hm2006306-RA.3:G107C, hm2013835-RA.2:G178G (not A), hm2014102-RA.2:C115C (not T), hm2014102-

RA.2:A117A (not T), hm2009568-RA.1:T184T (not A), hm2009568-RA.1:C185C (not A).

Genera included. Only the type genus.

Parent Taxon. Subfamily Pseudergolinae Jordan, 1898.

Ayperanartia Grishin, new subgenus

http://zoobank.org/D264019C-2 106-4F29-9F 1F-7830321FAD68

Type species. Vanessa dione Latreille, [1813].

Definition. The genus Hypanartia Htibner, [1821] (type species Hypanartia demonica Hiibner, [1821],

which is a junior subjective synonym of Papilio lethe Fabricius, 1793) has been divided into two species

groups: the paullus group (includes the type species of Hypanartia) and the dione group (Willmott et al.

2001; Llorente et al. 2023). Our genomic tree shows this split (Fig. 7) and is consistent with the

cladogram constructed using morphological characters (Willmott et al. 2001). Here, the division of

Hypanartia into two clades is formalized, and the new subgenus is proposed to encompass the dione

group. This new subgenus is distinguished from the nominotypical subgenus by male genitalia: nearly

triangular in lateral view valvae, separated at the base in ventral view; vinculum broader near the base of

succus in lateral view; saccus with narrower anterior part (at least in lateral view); and gnathos

continuously sclerotized, joined. See Willmott, Hall, and Lamas (2001) for additional information and

illustrations. A combination of the following nuclear genomic base pairs is diagnostic: hm2021257-RA.1:

A261G, hm2002154-RA.32:T1114A, hm2013826-RA.2:G702A, hm2006214-RA.3:T888C, hm2005917-RA.

1:C3222G.

Etymology. The Latin prefix hypo- means “below”, “beneath”, and sometimes “less than”. Species of the

new subgenus are clearly more than that, and this prefix is replaced with hyper- (1.e., “above”, “high”,

“beyond”, “excessive”) for an exaggerated look of some of these butterflies: typically with more angular

wings, longer tails, and bolder white spots. The name is a feminine noun in the nominative singular.

Species included. The type species (1.e., Vanessa dione Latreille, [1813]), Hypanartia celestia Lamas,

Willmott & J. Hall, 2001, Eurema charon Hewitson, 1878, Hypanartia christophori Jasinski, 1998,

Hypanartia cinderella Lamas, Willmott & J. Hall, 2001, Hypanartia fassli Willmott, J. Hall & Lamas,

2001, Eurema kefersteini Doubleday, [1847], Eurema lindigii C. Felder & R. Felder, 1862, Hypanartia

splendida Rothschild, 1903, and Hypanartia trimaculata Willmott, J. Hall & Lamas, 2001 (including their

subspecies and synonyms).

Parent taxon. Genus Hypanartia Hubner, [1821].

Comments. In their genetic differentiation (Fig. 7), the two subgenera of Hypanartia are approximately

the same as some subgenera in Nymphalis Kluk, 1780 (type species Papilio polychlioros Linnaeus, 1758).

Therefore, they are phylogenetically equivalent to the two subgenera Nymphalis and Aglais Dalman, 1816

(type species Papilio urticae Linnaeus, 1758) (i.e., the same level in the tree), and are stronger

differentiated genetically than Nymphalis from Polygonia Hubner, [1819] (type species Papilio c-aureum

Linnaeus, 1758).

Genera Subgenera

Hypanartia lethe|17118C08|Mexico:Oax|1987

anartia godmanii|19123E07|Mexico:Oax|1988

Hypanartia bellaj[19122E06|Brazil:PR|1995

Hypanartia paullus|19122E07|Dominican Republic|1981

Hypanartia kefersteini[19122E08|Peru|2015

Hypanartia cinderella|19122E09|Peru|2015

Hypanartia trimaculata|19123E08|Mexico:Ver|1981

Hypanartia christophori|19122E11|Colombia|1982

Hypanartia lindigii|19122E12|Ecuador|2004

Hypanartia dione|22061F03|Peru:Cuzco|2019

Vanessa carye|19093E12|Bolivia|2009

Vanessa annabella|9614|USA:UT,Davis Co.|2017

Vanessa itea|19122A11|Australia|1972

Vanessa gonerilla|19122A12|New Zealand|1968

Vanessa terpsichore|19121H06|Chile|1979

1° Vanessa braziliensis|19121H11|Peru:Cuzco|2016

it Vanessa myrinna|19121H10|Brazil:PR|1995

se Vanessa altissima|22063B02|Peru:Cuzco|2019

Vanessa virginiensis|3866|USA:TX,Dallas Co.|2015

Vanessa cardui|8641|USA:TX,Dallas Co.|2017

Vanessa kershawi|19121HO9|New Zealand|1968

Vanessa tameamea|17115B02|USA:HI,Hawaii]1974

Vanessa atalanta|9826|USA:TX,Dallas Co.|2017

100 Vanessa indica|19121G11|Myanmar|2002

94 2 Vanessa dejeanii|19122A05|Java|old

46 Vanessa vulcania|19122A08|no data|old

Vanessa abyssinica|19122A09|Ethiopia|1963

Vanessa dimorphica|19122B09|Tanzania|1972

Vanessa hippomene|19122B10|South Africa|1978

Vanessa madegassorum [not hippomene]|19122B12|Madagascar|old

Antanartia delius|19093E01|Congo|1977

Antanartia schaeneia|19122B11|South Africa|1978

Nymphalis caschmirensis|19122B03|Pakistan,Murree|1961

Nymphalis ichnusa|22029A12|Italy|1965

i. 100

Hypanartia Hyp

100

Hypanartia

100 100

100

Hyperanartia

100 100

Neofieldia

100

Bassaris

Vanessa

100

Vanessa

100

Paranartia

100

Antanartia

100

Aglais

106

100

108

Nymphalis urticae|PAOE19|Germany|2017

Nymphalis ladakensis|19122B04|Tibet|1980

Nymphalis milberti/9460|USA:WY,Park Co.|2017

Nymphalis io|JPAOE20|Germany|2017

Inachis Nymphalis progne|17115B04|USA:SD,Roberts Co.|1981

Nymphalis oreas|17115B05|USA:OR, Yamhill Co.|1983

Nymphalis haroldii|17115B06|Mexico:Hid|1981

Nymphalis gracilis|]PAO246|USA:CO,Larimer Co.|2016

Nymphalis comma|17117D09|USA:TX,Polk Co.|1971

Nymphalis g-argenteum|19122B08|Mexico, Ver|1910

Nymphalis satyrus|PAO42|USA:CA,Monterey Co.|2016

Nymphalis interrogationis|6030|USA:TX,Dallas Co.|2016

Nymphalis egea|19122B05|Greece|1983

Nymphalis interposita|19122B06|Bhutan|1968

: Nymphalis undina|19122B07|China|1909

v4 Nymphalis c-album|PAOE08|Switzerland|2017

Ue Nymphalis faunus|PAO270|USA:CO,Larimer Co.|2016

Kaniska Nymphalis c-aureum|19093E05|Korea or Japan|1988

Roddia Nymphalis canace|19093E08|Myanmar|2001

Nymphalis l-album|17115B03|USA:MT,Lake Co.|1976

100 Nymphalis polychloros|19093E04|France|1976

Nymphalis californica|9635|USA:UT,Davis Co.|2017

a Nymphalis xanthomelas|19122B01|China|1983

re; Nymphalis cyanomelas|15101E02|Mexico:Ver|old

Nymphalis antiopa|8980|USA:NM, Otero Co.|2017

100

Nymphalis too”

100

Polygonia 52

100

O02 Nymphalis ak

Fig. 7. The phylogenetic tree of Nymphalis relatives inferred from protein-coding regions of the nuclear genome (autosomes).

Genus-group names are shown above or below corresponding branches. Names of genera are shown on the left and in a larger

font than names of subgenera. Names, clades, and species of new subgenera proposed in this work are shown in color, except

that magenta indicates a new status of Vanessa madegassorum (species, not a subspecies of Vanessa hippomene).

Vanessa madegassorum (Aurivillius, 1899) is a species distinct

from Vanessa hippomene (Hiibner, 1823)

Genomic sequencing reveals notable genetic differentiation between the nominotypical Vanessa

hippomene (Hiibner, 1823) (type locality not given, deduced by wing shape and patterns of a specimen

shown in the original illustration to be in South Africa) and Vanessa hippomene madegassorum

(Aurivillius, 1899) (type locality in Madagascar) (Fig. 7). The COI barcodes of the two taxa differ by

2.9% (19 bp). Phenotypically, V. h. madegassorum is characterized by more prominently scalloped (even

toothed at veins) wing margins, a longer and thinner major hindwing tail at the end of vein M3, a second,

shorter tail at the end of vein CuA2 (absent in the nominotypical V. hippomene), orange (rather than

yellower) forewing band, green scaling by the forewing apex beneath, and reduced pale scaling and spot

by mid-costa on the ventral hindwing (Fig. 8). Taken together, these observations suggest that Vanessa

madegassorum (Aurivillius, 1899), stat. nov. is a species distinct from Vanessa hippomene (Hiibner,

1823). Vanessa madegassorum stat. nov. is known only from Madagascar, with the last reported record

from 1976 (Lees et al. 2003), and may be of conservation concern, if not already extinct. The COI

barcode sequence of V. madegassorum stat. nov., sample NVG-19122B12, GenBank accession

OR578710, 658 base pairs, is:

TACTTTATATTTTATTTT Gece Teel ih cee an TAGTTGGAACTTCACTTAGTTTATTAATTCGAACTGAATTAGGAAAT CCAGGATCTTTAATTGGAGATGATCAAATTTATAATACA

ATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGTTTTGGTAATTGATTAATTCCACTTATATTAGGAGCCCCTGATATAGCTTTTCCACGTA

TAAATAATATAAGATTTTGACTTTTACCCCCTTCATTAATATTATTAATT TCTAGTAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGC

TCATAGAGGATCTTCTGTAGATCTAGCAATTTTTTCATTACATTTAGCTGGAATTTCCTCTATTTTAGGAGCAATTAATTTTATTACTACTATTATTAATATACGAATTAATAGAATATCT

TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGTATTACAGCTTTACTTTTATTAATCTCTCTTCCTGTTTTAGCTGGAGCTATTACTATACTTCTAACAGAT CGAAATATTAATACAT

CATTTTTTGATCCTGCGGGAGGAGGAGACCCAATTCTTTATCAACATTTATTT

Ex ET ARR RSS SE

.A ft ¢ genitalia . DNA sample ID: bebidas

Lita Pe Sk D.P. NVG-19122B12

EdwTOwen 35__} c/o Nick V. Grishin 01602802

colléction

Fig. 8. Vanessa madegassorum stat. nov. male (dorsal: left, ventral: right) in USNM collection sequenced as NVG-19122B12

with its labels. All images are to scale.

Subgenera in Vanessa [Fabricius], 1807

The genus Vanessa |Fabricius], 1807 (type species Papilio atalanta Linnaeus, 1758) has been divided

into five species groups: the atalanta group (includes the type species of Vanessa), the cardui group

(Papilio cardui Linnaeus, 1758 is the type species of Cynthia [Fabricius], 1807), the carye group

(Hamadryas carye Hiibner, 1812 is the type species of Neofieldia Ozdikmen, 2008), the itea group

(Papilio itea Fabricius, 1775 is the type species of Bassaris Hiibner, [1821]), and the hippomene group

(Wahlberg and Rubinoff 2011). Because four of these groups are characterized by notable genetic

differentiation (Fig. 7), we propose to treat the two names as subgenera: Neofieldia Ozdikmen, 2008, stat.

rest. and Bassaris Hitbner, [1821], stat. rev. and leave Cynthia as a junior subjective synonym of

Vanessa. The hippomene species group does not have a name. It is described below.

Paranartia Grishin, new subgenus

http://zoobank. org/5760367D-44F8-48A F-B592-2B LAEE4CC755

Type species. Hypanartia hippomene Hibner, [1823].

Definition. Comprises the hippomene species group in Vanessa [Fabricius], 1807, as proposed by

Wahlberg and Rubinoff (2011), who inferred a comprehensive phylogeny of Vanessa and its relatives and

discovered the phylogenetic position of the hippomene group within Vanessa. This group is unusual

because its constituent species have been previously placed in Antanartia Rothschild & Jordan, 1903

(type species Papilio delius Drury, 1782) due to phenotypic similarities. We treat the hippomene group as

a new subgenus (Fig. 7). This subgenus is distinguished from Antanartia by genitalia: in males, aedeagus

without spines and projections (does not end in a “barb” like a fish hook end structure) and valva without

projections off costa, which is nearly straight; and in females, with developed signa in corpus bursae

(Howarth 1966), and from Vanessa by a sharp tooth-like tail at the vein M3 on hindwing. A combination

of the following nuclear genomic base pairs is diagnostic: hm2005743-RA.6:T48C, hm2002542-RA.3:

A237G, hm2017019-RA.1:T160C, hm2002154-RA.32:A1116G, hm2021745-RA.5: C862A.

Etymology. The prefix para- means “beside”, “beyond”, or “similar to”. Species of the new subgenus are

similar to and were previously placed in Antanartia, and the prefix para- is fused with the latter genus

name to form the new name. The name is a feminine noun in the nominative singular.

Species included. The type species (1.e., Hypanartia hippomene Hiibner, [1823]), Antanartia dimorphica

Howarth, 1966, and Hypanartia hippomene var. madegassorum Aurivillius, 1899, stat. nov. (including

their subspecies and synonyms).

Parent taxon. Genus Vanessa [Fabricius], 1807.

Comments. The four subgenera of Vanessa are more genetically distinct from each other than some

subgenera within Nymphalis Kluk, 1780 (type species Papilio polychloros Linnaeus, 1758) (Fig. 7), and

several of such Nymphalis subgenera are commonly treated as genera, e.g., Polygonia Hiibner, [1819]

(type species Papilio c-aureum Linnaeus, 1758).

Erestia (Anthanassa) seminole Skinner, 1911 is a species distinct

from Eresia (Anthanassa) texana (W. H. Edwards, 1863)

Currently in the subgenus Anthanassa

Eresia texana|21011G12|HT|USA:TX,Comal Co.|old

Scudder, 1875 (of Eresia Boisduval, 1836) Eresia texana|4378|F|USA:TX, Dallas Co.|2015

. . - Eresia texana|12316|USA:TX,Jeff Davis Co.|2019

and treated as a subspecies of its type species Eresia texana|3608|USA:TX, Starr Co.|2015

: o>, Eresia texana|5999|USA:AZ,Santa Cruz Co.|2016

Melitaea texana W. H. Edwards, 1863 (type Eresia tenana[8327|USA-AZ, Pinal Co|2017

: . Eresia texana|5819|USA:TX, Travis Co.|2016

locality USA: Texas, probably Comal Co., Eresia seminole|20125G05|ST|USA:GA, Decatur Co.|1910

New Braunfels), Eresia texana seminole ||» Ser rt eee oa

‘ 1 . 7 Eresia seminole|21026D02|USA:FL,Levy Co.|1980

Skinner, 1911 (type locality USA: Georgia, Eresia ptolyca|10631|Mexico:Tam|1986

Decatur Co Bainbridge) iS genetically Eresia ardys|10633|Mexico:San Luis Potosi|1980

3 9

differentiated from it (Fig. 9 blue vs. red) Fig. 9. Nuclear genome tree (autosomes) of Eresia texana (blue) and

; ; : Eresia seminole stat. rest. (red). Primary types are in magenta.

showing Fsi/Gmin in the Z chromosome of

0.39/0.01 and COI barcode difference of 3.6% (24 bp). Therefore, in agreement with Calhoun (1997), we

regard Eresia (Anthanassa) seminole Skinner, 1911, stat. rev. as a species-level taxon.

Microtia elvira Grishin, new species

http://zoobank.org/1 7FC3D08-DF04-487B-A IF 1-F536C01E624F

(Figs. 10 part, 11, 12a, b)

Definition and diagnosis. Genomic sequencing of Microtia H. Bates, 1864 (type species Microtia elva

H. Bates, 1864) specimens reveals a deep split within its type species (Fig. 10). The western clade (Fig.

10 red) is profoundly differentiated from the eastern clade (Fig. 10 blue) with the Z chromosome Fst/Gmin

of 0.60/0.006 and COI barcode difference of 4.7% (31 bp), which is more than expected from phenotypic

similarity. This scenario parallels that of Microtia perse (W. H. Edwards, 1882) (type locality in USA:

AZ, Graham Co.) vs. Microtia elada (Hewitson, 1868) (type locality in Mexico) (Fig. 10 green vs. violet).

Therefore, the two clades represent distinct species. Specimens from around the type locality (Guatemala)

belong to the eastern clade. Curiously, Microtia elva horni Rebel, 1906 (type locality in Mexico: Oaxaca)

and its junior subjective synonym Microtia elva form draudti Rober, [1914] (type locality in Mexico,

“Coatepec” on the label of a syntype) (Fig. 10 teal colored), which are also in the eastern clade but are

visually rather distinct in their much broader orange-yellow markings and nearly half of dorsal hindwing

orange-yellow, are not particularly different genetically from the nominotypical M. e/va. Thus, the

western clade does not have available names associated with it and represents a new species. This new

Species is most similar to M. elva, with which it was previously combined. Distinguished from M. e/va by

largely yellow or orange-yellow tibiae and frequently other leg parts (legs in M. elva are back).

Additionally, characterized by narrower orange-yellow bands and thinner, bar-like (particularly in males)

orange-yellow mark by the middle of the inner forewing margin (Figs. 11, 12a). In M. elva, this bar is

more rounded, larger, and can be nearly triangular and much broader at the base, widening both distad and

basad (Fig. 12c). The outer edge of the hindwing discal band (on both dorsal and ventral sides) is more

angled in the middle (Figs. 11, 12b), instead of straighter and more rounded edge in M. elva (Fig. 11d).

Due to variation in colors and patterns, most confident identification is provided by DNA. The following

combination of characters is diagnostic in the nuclear genome: hm2014195-RA.2:C190T, hm2014195-

RA.2:T201A, hm2016592-RA.17:G261A, hm2017493-RA.1:G240A, hm2008057-RA.6:TI71C and COI

barcode: G38A, C238C, 421C, A583T, T637C.

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACATCTTTAAGACTTTTAAT TCGAACTGAATTAGGAAACCCAGGATCAT TAATTGGAGATGATCAAATTTATAATACT

ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAATTCCAT TAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAA

TAAATAATATAAGATTTTGACTACTACCCCCATCACTTATATTATTAATT TCTAGAAGAATT GTAGAAAATGGAGCAGGAACAGGAT GAACAGTGTACCCCCCACTTTCTTCTAATATTGC

TCATAGAGGATCATCTGTTGATT TAGCAATTTTTTCACTACATCTAGCAGGAATTTCCTCAATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATCA

TTTGATCAAATACCTTTATTTGTTTGAGCAGTTGGTATTACAGCTCTTTTATTATTATTATCTTTACCAGTATTAGCAGGAGCTATTACTATACTCCTTACTGATCGAAATATTAATACAT

CATTTTTTGACCCAGCTGGAGGAGGGGATCCCATTTTATATCAACATCTATTT

a Microtia elvira|22096HO8|PT|Mexico:Son|1953 b ay tenor elvira|22096H10|HT|USA:AZ,Madera Cyn

Microtia elvira|22096G08|PT|Mexico:Son|1976 icrotia elvira]J22096G07|PT|Mexico:Son|1976

Microtia elvira]22097A04|PT|Mexico:Sin|1976 Merona elvira|21091A03|PT|USA:AZ,Santa Cruz Co.

Microtia elvira]J22096H10|HT|USA:AZ,Madera Cyn|1954 icrotia elvira|22096G08|PT|Mexico:Son|1976

Microtia elvira|21091A03|PT|USA:AZ,Santa Cruz Co.|2015 sMicrotia elvira|22097A04|PT|Mexico:Sin|1976

0.008 Microtia elvira|22096G07|PT|Mexico:Son|1976 ooMicrotia elvira]22096HO08|PT|Mexico:Son|1953

Microtia elvira]J22097A01|PT|Mexico:Nay|1946

Microtia elvira|22097A03|PT|Mexico:Nay|1946

Microtia elva elva|22096H09|Mexico:Yuc|1972

Microtia elva elva|22096G12|Mexico:Mor|1978

Microtia elva elva|22096H03|Mexico:Jal|1974

Microtia elva elva]22104A09|Mexico:Pue|1955

Microtia elva elva|22096G10|Costa Rica|1989

Microtia elva elva|22096H05|Panama|1969

Microtia elva elva|22104A08|Guatemala|1950

Microtia elva elva|10626|USA:TX,Cameron Co.|1973

Microtia elva elva|22096H02|Mexico:Ver|1980

Microtia elva elva|22096H04|Mexico:Tam|1981

Microtia elva elva|22096H11|Mexico:Tam|1985

Microtia elva elva|22097A08|Mexico:SLP|1982

Microtia elva horni]22097A07|Mexico:Oax|1980

Microtia elva horni|22096HO7|Mexico:Oax|1980

Microtia elva horni|22096H01|Mexico:Chia|1980

Microtia dymas dymas|21068C03|USA:TX,Starr Co.|2008

> Microtia perse|5947|M|USA:AZ,Pima Co.|2016

Microtia perse|21056B10|Mexico:Son|1998

Microtia elada ulrica|5155|USA:TX,Hidalgo Co.|2015

Microtia elada ulrica|7682|Mexico:Que|1980

Microtia coracara|18014G05|Mexico|1942

icrotia elvira|22097A01|PT|Mexico:Nay|1946

Microtia elvira]22097A03|PT|Mexico:Nay|1946

Microtia elva elva]22096H03|Mexico:Jal|1974

Microtia elva elva]22096HO9|Mexico:Yuc|1972

°Microtia elva elva|22096G12|Mexico:Mor|1978

1 Microtia elva elva|22096G10|Costa Rica|1989

Hicrotia elva elva|22096H05|Panama|1969

icrotia elva elva|22104A08|Guatemala|1950

Microtia elva elva]22104A09|Mexico:Pue|1955

icrotia elva elva]22096H11|Mexico:Tam|1985

Hicrotia elva elva|22096HO2|Mexico:Ver|1980

ae elva elva|22097A08|Mexico:SLP|1982

icrotia elva elva|22096H04|Mexico:Tam|1981

1Microtia elva elva|10626|USA:TX,Cameron Co.

8Microtia elva horni]22096HO1|Mexico:Chia|1980

%Microtia elva horni|22097A07|Mexico:Oax|1980

Microtia elva horni|22096HO7|Mexico:Oax|1980

Microtia coracara|18014G05|Mexico|1942

Aherote perse|5947|M|USA:AZ,Pima Co.|2016

Icrotia perse|21056B10|Mexico:Son|1998

Microtia elada ulrica|5155|USA:TX,Hidalgo Co.|2015

Microtia elada ulrica|7682|Mexico:Que|1980

Microtia dymas dymas|21068C03|USA:TX,Starr Co.|2008

Fig. 10. Phylogenetic trees of Microtia inferred from protein-coding regions of a) nuclear (autosomes) and b) mitochondrial

genomes: Microtia elvira sp. n. (red), M. e/va (blue with M. e. horni labeled in teal), M. perse (green), and M. elada (violet).

Fig. 11. Holotype of Microtia elvira sp. n. in dorsal (left) and ventral (right) views, data in text.

‘Microtia elva

Microtia elvira’sp. n.

a ie) . C

)

Ls ’

nf if i 3 = >

~ am 5 Pp

‘ nif

te i

Fig. 12. Microtia elvira sp. n. (a, b) and Microtia elva (c, d) iNaturalist observations: USA: AZ, Santa Cruz Co.: a) 144668453

Montosa Canyon, GPS 31.6727, —110.9406, 19-Aug-2016 © jmbearce; b) 141491956 Atascosa Mts., California Gulch, GPS 31.4220, —111.2404, 3-

Oct-2014 © Ken Kertell; and Mexico: Nuevo Leon, Monterrey: ¢) 4292755 Parque la Estanzuela, GPS 25.5507, —100.2707, 7-Oct-2016 © Roberto

Gonzalez; d) 171257635 Guadalupe, Contry Sol, GPS 25.6505, —100.2648, 5-Jul-2023 © Rodolfo Salinas Villarreal. Arrows in b) and d) point at the

legs to draw attention to their color difference. Images are color-corrected and rotated. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/

Type material. Holotype: & deposited in the Los Angeles County Museum of Natural History, Los

Angeles, CA, USA [LACM], illustrated in Fig. 11, bears three printed (number “12” handwritten) labels:

two white [ October 12, 1954 | Madera Canyon, Santa Rita Mt’s. | Southern Arizona. | W. Rees & H.

Reid |], [ DNA sample ID: | NVG-22096H10 | c/o Nick V. Grishin ], and one red [HOLOTYPE @ |

Microtia elvira | Grishin ]. Paratypes: 5¢0ch 299: 1h USA, Arizona, Santa Cruz Co., Sycamore canyon,

GPS 31.4213, —111.1942, 25-Sep-2015, Brian Banker leg. (NVG-21091A03); others at LACM, Mexico:

Sonora: 2¢'o% Rio Cuchujaqui, 8 rd. mi E of Alamos, el. 1000', 30-Aug-1976, J. P. & K. E. Donahue leg.

(NVG-22096G07 & G08); 12 Alamos, 25-Jul-7-Aug-1953, Fred S. Truxal leg. (NVG-22096H08); 1c

Sinaloa, 27.8 km S Culiacan, 30-Aug-1976, C. D. George & R. K. Snelling leg. (NVG-22097A04); 1c 1°

Nayarit, 5-10 mi N of Tepic, 2500'-3000', 13-Dec-1946 (NVG-22097A03 & A0O1).

Type locality. USA: Arizona, Pima/Santa Cruz Cos., Santa Rita Mountains, Madera Canyon.

Etymology. The meaning of the name Elvira is typically associated with traits such as truthful,

trustworthy, or pure, and also noble or elf-like. Formed from the name of its sister species, e/va, it

signifies our high confidence that this is a “trustworthy” species, i.e., strongly differentiated from M. elva

but is e/va- or elf-like. The name of this western counterpart of M. e/va is longer to mean that it takes a

long day from sunrise in the east to sunset in the west. The name is a feminine noun in apposition.

English name. Elfoid.

Distribution. Southeastern Arizona and western Mexico (confirmed from Sonora, Sinaloa, and Nayarit).

Comment. Both ™. elvira sp. n. and M. elva occur in the USA. Microtia elva strays into the lower Rio

Grande Valley of Texas, e.g., a male from Brownsville in Cameron County collected by William W. &

Nadine McGuire on 20-Jul-1971 [TAMU] that we sequenced as NVG-10626 (Fig. 10).

Cyllopsis brocki Grishin, new species

http://zoobank. org/3 EE47FD0-3 1 EF-4CE0-BE2 1-5 DC240F1FFEC

(Figs. 13 part, 14-16)

Definition and diagnosis. Inspection of nuclear genomic trees reveals that a single specimen from

Mexico, Sonora, initially identified as “Cyllopsis pertepida’, is confidently placed as sister to the clade

Cyllopsis pertepida|9714|USA:TX

Cyllopsis pyracmon|17115C10|AZ

Cyllopsis gemma|9181|USA:AR

Cyllopsis brocki|20112B02|HT

Cyllopsis hedemanni|19117F04

» Cyllopsis nayarit|22043A06|HT

Cyllopsis pephredo|22098C04

Cyllopsis clinas|21071B12|Mexico

Cyllopsis nelsoni|21071E05|ST

Cyllopsis argentella]22098B09|Pan

Cyllopsis gemma|9181|USA:AR, Scott Co.|2017 b

Cyllopsis pyracmon|17115C10|AZ,Santa Cruz Co.|1968

Cyllopsis pertepida|9714|USA:TX, Jeff Davis Co.|2017 ~ Ga

Cyllopsis brocki]20112B02|HT|Mexico:Son|1984

Cyllopsis hedemanni|19117F04|Honduras|1980

Cyllopsis nayarit|22043A06|HT|Mexico:Nay|1932

Cyllopsis pephredo|22098C04|Costa Rica|1983

Cyllopsis clinas|21071B12|Mexico:Gue|1981

Cyllopsis nelsoni|21071E05|ST|Guatemalalold

Cyllopsis argentella|22098B09|Panama|1982

Cyllopsis gemma|9181|USA Cc

Cyllopsis pyracmon|17115C10

Cyllopsis pertepida|9714|USA:TX

Cyllopsis brocki|20112BO02|HT

Cyllopsis hedemanni|19117F04

Cyllopsis nayarit|22043A06|HT

Cyllopsis pephredo|22098C04

Cyllopsis clinas|21071B12|Mexico

Cyllopsis nelsoni|21071E05|ST

Cyllopsis argentella|22098B09|Pan —>5,—

Fig. 13. Phylogenetic trees of selected Cyl/opsis species inferred from protein-coding regions of a) the nuclear genome

(autosomes), b) the Z chromosome, and c) the mitochondrial genome: C. brocki sp. n. (red) and its sister group (blue).

of three species: Cyllopsis gemma (Hiibner, 1808), Cyllopsis

pertepida (Dyar, 1912), and Cyllopsis pyracmon (A. Butler, 1867)

(Fig. 13a, b, red and blue), and therefore represents a species distinct

from them. In the mitochondrial genome tree, which has lower

Statistical support, this species is also in the same clade with the

three others but is sister to C. gemma (Fig. 13c). Because all other

described species of Cyllopsis R. Felder, 1869 (type species

Cyllopsis hedemanni R. Felder, 1869) belong to other clades (Fig.

13) and are phenotypically different (Miller 1974), this species is

new. It differs from its relatives by a combination of larger size |> —~ =. ae

(forewing length about 20 mm, while typically less than 18 mm in |. 2424 BNE oe OS

C. gemma), a large androconial patch (cut by veins) in the discal ae haste “s ite: pts Sy

area of the dorsal forewing (absent in C. gemma), postdiscal brown oe ane taaas ~108.8370, see oiee

line strongly toothed towards the margin at vein My and not |jmbearce. Brightened and color-corrected. CC BY-NC

reaching the costal margin (as in C. gemma and some C. pertepida, [4° Bps:(/creativecommons.org/licenses/by-nel4.0/

but not in C. pyracmon), more extensive and coarse mottling on the ventral side of wings, especially in

the basal part of the hindwing (as in some C. pyracmon but not in other species), and reduced rusty

overscaling dorsally: wings appear more brown than reddish (Figs. 14, 15). In male genitalia (Fig. 16),

diagnosed by broader valva with more convex costa-ampulla, valva more distinctively narrowing into

harpe in lateral view, harpe with broader and more angular distal end in dorsal view shaped like a

triangular plate rather than ending in a point. In DNA, a combination of the following characters is

diagnostic in the nuclear genome: hm2006469-RA.2:C61T, hm2003322-RA.2:G69A, hm2003322-RA.2:T106C,

hm2009012-RA.1:T408C, hm2009012-RA.1:G885T, hm2009732-RA.2:G72G (not A), hm2009355-RA.1:A261A (not G),

hm2009355-RA.1:G270G (not A), hm2013443-RA.4:T606T (not C), hm2013443-RA.4:T702T (not A) and COI barcode:

T235C, T283C, T379A, T451A, T544C, A631G. Due

to pronounced and frequently seasonal wing

pattern variation in Cy//opsis that is unexplored in

the new species, definitive identification is

possible by genitalia or DNA.

Barcode sequence of the holotype: Sample NVG-

20112B02, GenBank OR578712, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGAACCTCCCTTAGTC

TATTATTCGAATAGAATTAGGTAATCCAGGATTTTTAATTGGAGATGATCAAATTT

TAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTAT

TATAATTGGTGGATT TGGGAACTGATTAGTTCCCCTTATATTAGGGGCCCCCGATAT

AGCTTTCCCCCGAATAAATAATATAAGATTTTGACTACTTCCCCCCTCATTAGTCCT

TTTAATTTCAAGAAGTATTGTAGAAAATGGAGCTGGRACAGGATGAACAGTTTACCC

CCCTCTTTCTTCTAATATTGCCCACAGAGGATCTTCAGTCGATTTAGCAATTTTTTC

TTTACATTTAGCTGGGATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAAT

TATTAACATACGAATTAATAATATAACGTATGATCAAATACCTCTATTTGTTTGAGC

AGT TGGAATTACAGCATTATTATTATTACTCTCTTTACCAGTATTAGCTGGAGCTAT

TACTATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCTGGAGG

AGGGGACCCTATTTTATACCAACATTTATTT

Type material. Holotype: co deposited in the

McGuire Center for Lepidoptera and Biodiver- | Fig. 16. Genitalia of Cyllopsis brocki sp. n. holotype (data in

sity, Gainesville, FL, USA [MGCL], illustrated in text) in left lateral (top left), dorsal (right) and left ventrolateral

: y: : 2d ; ; (bottom left) views.

Fig. 14, bears four printed labels: three white [ 31

sample ID: | NVG-20112B02] c/o Nick V. Grishin ], [ genitalia vial | NVG230917-02 | Nick V. Grishin ],

and one red [| HOLOTYPE ¢& | Cyllopsis brocki | Grishin ].

Type locality. Mexico: Sonora, Yécora, E of Santa Rosa, Trinidad-Yecora Rd., 3—5mi E of Trinidad mine.

Etymology. The name honors Jim P. Brock, the collector of the holotype and one of the finest and most

knowledgeable Lepidopterists with a sixth sense for butterflies and caterpillars, finding them effortlessly

(or so it seems) where others fail. Jim’s significant contributions to butterfly knowledge delivered through

his many books, presentations, and nature tours can only be matched by his contagious excitement,

passion for sharing his expertise, and unsurpassed kindness. We deeply appreciate Jim's extensive support

of our projects throughout the years. The name is a singular noun in the genitive case.

Distribution. Known only from the holotype collected in Mexico: Sonora.

Comment. The type locality of this new species is near the type locality of Amblyscirtes brocki H

Freeman, 1992 (Hesperiidae), with its two paratypes collected on the same date and at approximately the

same place as the holotype of Cyllopsis brocki sp. n.

Family Riodinidae Grote, 1895 (1827)

Teratophthalmina Grishin, new subtribe

http://zoobank.org/8C3 50BD8-8094-472C-9C17-70A9C2023D20

Type genus. 7eratophthalma Stichel, 1909.

Definition. Currently placed in the subtribe Eunogyrina Grishin, 2021, Teratophthalma (type species

Mesosemia phelina C. Felder & R. Felder, 1862) is indeed sister to its type genus Eunogyra Westwood,

1851, but is rather distant from it both genetically (Fig. 17) and phenotypically, and therefore represents a

subtribe of its own. The description and diagnostic characters of this new subtribe are as those given for

Teratophthalma on pages 76—77 (illustrated in Fig. 11) by Stichel (1910). In brief, the subtribe belongs to

Mesosemiini (see Hall (2003) for Teratophthalma) and is diagnosed by the following combination of

characters: wings without multiple narrow bands, eyespots at the end of the forewing discal cell but not

along wing margins; genitalic valvae short (as long as tegumen) and triangular, simple with pointed apex,

pedicel unsclerotized in the middle or ventrally split (or both). A combination of the following nuclear

genomic base pairs is diagnostic: cnel792.4.2:T805C, cnel11317.11.9:A512G, cne12569.1.1:T2145C,

cne599.10.1:A4814T, cne1398.1.1:C838G.

Genera included. Only the type genus.

Parent Taxon. Tribe Mesosemiini Bates, 1859.

300 Hamearis lucina|7282|Austria|1981

Euselasia gelon|19035G06|French Guiana|1988

Eurybia halimede|18122H07|Peru|1989|USNM

Eunogyra satyrus|18121G02|Peru|1991

Eunogyra curupira|18121G03|French Guiana|1993|USNM

Hetatopithaline axilla|18121G04|Peru|2015|USNM

ool eratophthalma maenades|18121G05|Ecuador|1988|USNM

Teratophthalma phelina|18121G06|Ecuador|1969|USNM

Teratophthalma monochroma|21125A03|T|Ecuador|old

Endosemia ulrica|19037H05|Peru:MD|2014

Ectosemia eumene|19037H07|Guyana|2000

Mesosemia philocles|19037D02|Guyana|2001

Eucorna sanarita|18122C01|Brazil:RJ|1996

Cremna actoris|19038B01|Brazil:RO|1991

100 Napaea eucharila|18072F01|13-SRNP-1135|Costa Rica|2013

Dianesia carteri|18048D12|Bahamas|1978|USNM

Esthemopsis clonia|18072D08|07-SRNP-100096|Costa Rica|2007

Mesene phareus|18072E07|06-SRNP-103370|Costa Rica|2006

Symmachia probetor|19028B05|Ecuador|2008

7 10 Tigria xypete|19028E03|12-SRNP-70540|Costa Rica|2012

Symmachiina pa ers Pterographium sicora|19028F12|Brazil:ES|1972

yab Z fe vrgensals 5094011) BrazisRO Rrenen Guiana|1989

: 7 symma virgatula|1 1 razil: 1

a 5 Argyrogrammana stilbe|19029F02|Peru:MD|1990

iP Sarota chrysus|19028H08|Peru:Cusco|2012

100 Helicopis cupido|19028H05|Brazil:AM|1995

Helicopinal—} as Ourocnemis axiochus|21123F04|Brazil:SC|1896

: Anteros micon|18072D02|13-SRNP-65547|Costa Rica|2013

Echydnina Echydna chaseba|19029D02|Brazil:SC|1991

Echydna punctata|19029D03|Peru:MD|2016

Calydna calamisa|19029D04|French Guiana|1992

Calydna hiria|19029E11|Ecuador|2008

Fale*® sau wo ~Calydna cea|19029E03|Brazil:MG|1990

14 70 Calydna sturnula|19029E05|11-SRNP-55679|Costa Rica

100 Calydna carneia|19029E09|French Guiana|1988

7o0Calydna catana|19029E12|Ecuador:Sucumbios|2005

Calydna cabira|19029F01|Peru:Loreto|1993

; Calydna venusta|19029D08|Trinidad|1999

bcalydnina an i Calydna stolata|19029D09|French Guiana|1988

a 100 Calydna thersander|19029D12|Brazil:RO|1993

Calydna fissilisima|19029D11|Brazil:RJ|1971

Calydna caieta|19029D05|French Guiana|1988

Calydna charila|19029D07|French Guiana|1989

26 Echenaidina Echenais (Echenais) thelephus|19029H04|Peru:Loreto|1993

Too Echenais (Imelda) mycea|19029H01|Ecuador:Zamora|2003

Echenais (Imelda) aenetus|19029H02|Peru:Cusco|2013

Befrostia elegia|18052H02|ST|Brazil:RJ|old

_ Xanthosa xanthosa|18054D09|ST|no data|old

Sertania guttata|18053H05|ST|Argentinalold

72 Baeotis hisbon|19026H10|Guyana|2000

Astraeodes areuta|19029H03|Bolivia|2003

100 Pheles heliconides|18072G07|Guyana|1991|USNM

Inkana incoides|19023A09|ST|S Brazillold

he, 700 Chalodeta theodora|18048H05|Peru:Cusco|2015|USNM

34 Riodina lysippus]19026H04|Ecuador:Napo|1988

Calephelis virginiensis|4171|USA:TX,Hardin Co.|2015

Chamaelimnas tircis[18048G02|Brazil:RO|1991

Eunogyrina

100

Teratophthalmina

100

100 pe

Mesosemiina

100

ay Riodinina é

100 —— Barbicornis basilis]19026E11|Brazil:RGS|1956

0.04 Carii 100 Seco calagutis|19044G07|Ecuador|1914

ariina Caria plutargus|19026G11|Argentina:Misiones|2012

Callistium cleadas|19031A06|French Guiana|1991

24 a er 700 : Apodemia mormo|17107E02|USA:WA, Kittitas Co.|1990

Emesis cereus|18045C06|Brazil:RO|1993

Fig. 17. The phylogenetic tree of selected Riodinidae inferred from protein-coding regions of the nuclear genome (autosomes).

Family-group names are shown above or below the corresponding branches. Names, clades, and species of new subtribes

proposed in this work are shown in color. Names of other subtribes are shown in black, and names of subfamilies and tribes are

shown in shades of gray. Note the relatively constant rate of DNA change in Riodininae (1.e., molecular clock), as evidenced

by approximately the same distance from the root to each leaf. The translucent vertical lime bar denotes a level in the tree

approximately corresponding to subtribes.

Argyrogrammanina Grishin, new subtribe

http://zoobank.org/FA788 LEE-0382-4796-9C6B-A 1lOB4C08BOA 1

Type genus. Argyrogrammana Strand, 1932.

Definition. Argyrogrammana (type species Erycina stilbe Godart, 1824) is prominently differentiated

genetically from the rest of Symmachiini Reuter, 1896 (Fig. 17), and we propose that the lineage

containing Argyrogrammana is a subtribe. This new subtribe differs from other Symmachiini by a thin

submarginal line of (sometimes fused) metallic (golden or silvery-blue) spots on both wings above and

beneath and a dark medial stripe across the eyes (Hall and Willmott 1996). A combination of the

Zi)

following nuclear genomic base pairs is diagnostic: cne3461.2.10:G397A, cne2040.8.2:A100G, cne3461.

2.10:G382A, cne2478.7.10:C607A, cne6674.8.2:G397C.

Genera included. Only the type genus.

Parent Taxon. Tribe Symmachiini Reuter, 1896.

Argyrogrammana astuta Grishin, new species

http://zoobank.org/C3 B104C6-18F0-4FAE-8506-DD345ED63531

(Figs. 18, 19)

Definition and diagnosis. Genomic sequencing of the holotype of Argyrogrammana praestigiosa

(Stichel, 1929) (type locality not specified, likely the Guianas) (in MFNB, NVG-18077D12) reveals that a

sequenced specimen identified as A. praestigiosa from southeastern Peru (illustrated in Fig. 11 in Hall et

al. (2023)) is genetically distant from it with COI barcodes differing by 2.6% (17 bp). In the presence of

phenotypic differences, such as those in wing patterns discussed in detail by Hall et al. (2023), the

observed genetic differentiation suggests that the specimen from Peru is not A. praestigiosa but a distinct

species. This species is new, and its males (female is unknown) differ from superficially most similar A.

praestigiosa by the characters described for “west Amazonian males” in Hall et al. (2023), such as more

extensive orange coloration of dorsal wings, 1.e., basal area of forewing with three orange bands and in

some specimens an orange marginal streak near tornus, hindwing with more orange scaling by its apex,

ry Cc

: Ne eee Muntee eehd

Fig. 19. Argyrogrammana astuta sp. n. iNaturalist observations from Peru: Madre de Dios, Tambopata: a) 175878841 GPS —12.6060,

—69.0324, 27-Jul-2023 © danielblanco521; b) 67719625 Tambopata, GPS —12.0467, —69.6766, 29-Sep-2017, © Ken Kertell; c) 94229584 ventral of

b) © David Geale. Images are color-corrected and rotated. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/

e.g., an orange band may cut through the brown patch to reach the costa (the apical area is mostly brown

in A. praestigiosa). Beneath, brown scaling is less extensive, pale bands are wider, with more orange

scales in them (particularly toward wing margins), and with sharper edges, especially towards the outer

margin; submarginal dark spots are more even, e.g., on hindwing spots in cells Mi-M2 and M2-M3 are not

particularly larger than others (they are larger and more pointed in A. praestigiosa). The dorsal side of the

abdomen with a brown central spot at the base of each segment (entirely orange in A. praestigiosa). Other

species of Argyrogrammana are more distant and different, e.g., the next closest species is A. glaucopis

(H. Bates, 1868), which is characterized by much less extensive orange coloration and additional blue

spots on the forewing, and A. caerulea J. Hall, 2023 has even more extensive blue forewing patches.

Barcode sequence of the holotype: Sample NVG-19029F 11, GenBank OR578713, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCT eee TAATTGGAACTTCTTTAAGTTTATTAATTCGTATAGAATTAGGTAATCCAAACTCATTAATTGGTAATGACCAAATTTATAATACA

ATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGGTTTGGAAATTGATTAATTCCTTTAATATTAGGGGCTCCTGATATAGCATTTCCACGAA

TAAATAACATAAGTTTTTGATTATTACCCCCCTCCTTAATTCTTTTAATT TCAAGAAGTATT GT TGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCTCTTTCTTCTAATATTGC

TCATAGAGGCTCATCCGTTGATTTAGCCATTTTTTCTCTTCATTTAGCTGGGATTTCTTCCATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGTATTAATAATATAGCT

TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTCTTCTTTTATTATTATCATTACCAGTTTTAGCTGGAGCTATTACCATATTATTAACAGAT CGTAATTTAAATACAT

CATTTTTTGATCCTGCTGGAGGT GGAGATCCTATTTTATACCAACATTTATTT

Type material. Holotype: & deposited in the National Museum of Natural History, Washington, DC,

USA [USNM], illustrated in Fig. 18 (and Fig. 11 in Hall et al. (2023) left-right inverted—i.e., mirror

image of the specimen—and with imperfections edited out), bears four printed labels: three white

Robbins ], [ DNA sample ID: | NVG-19029F11 | c/o Nick V. Grishin |], [USNMENT | {QR Code} |

01544363 |, and one red [ HOLOTYPE oc | Argyrogrammana | astuta Grishin ].

Type locality. Peru: Madre de Dios, Tambopata National Reserve, elevation 300 m, GPS —12.83, —69.28.

Etymology. In Latin, astutus is astute, cunning, clever, sly, and artful, and praestigiosus is deceptive and

misleading. This new species was skillfully hiding among the deceitful A. praestigiosa until genomic

sequencing revealed its distinction. The name is a feminine adjective.

Distribution. This species is genetically confirmed only from the holotype collected in southeastern Peru;

however, it is expected at least in the southwestern Amazonian Basin (Fig. 19).

Comments. Hall et al. (2023) described in detail wing pattern differences between populations of A.

praestigiosa, concluding that they represent intraspecific variation due to the lack of apparent differences

in genitalia and citing phenotypic intermediates. Argyrogrammana astuta sp. n. corresponds to the “west

Amazonian” A. praestigiosa of Hall et al. (2023). It is possible that A. praestigiosa is even more deceitful,

and additional variation described by Hall et al. (2023) may refer to additional species in this complex.

Subtribes in Helicopini Stichel, 1928

Inspection of the genomic tree reveals that Sarota Westwood, 1851 (type species Papilio chrysus Stoll,

1782), which is confidently placed in the tribe Helicopini Stichel, 1928 (Fig. 17), diverges from other

members of the tribe at the tree level corresponding to subtribes (left of the lime bar in Fig. 17).

Therefore, this lineage represents a valid subtribe. As a result, we propose to split Helicopini into two

subtribes: the nominotypical and Sarotina Bridges, 1988, stat. rest.

Echenaidina Grishin, new subtribe

http://zoobank.org/3 BAD20C2-92C3-4F44-A 713-583D7B3932E2

Type genus. Echenais Hiibner, [1819].

Definition. Two subgenera, Echenais (type species Lemonias alphaea Hubner, 1808, which is a junior

subjective synonym of Papilio thelephus Cramer, 1775) and Imelda Hewitson, 1870 (type species /melda

glaucosmia Hewitson, 1870), show prominent genetic differentiation from other taxa in the tribe

Calydnini Seraphim, Freitas & Kaminski, 2018 and, therefore, constitute a subtribe (Fig. 17). This new

subtribe differs from other Calydnini by a submarginal (not marginal) continuous yellow, blue, or metallic

line or band on dorsal sides of both wings and/or largely white, yellow, orange, or blue (but not mostly

black or dark brown) hindwing above, or orange patch in the middle of the hindwing. A combination of

the following nuclear genomic base pairs is diagnostic: cne2872.1.1:A361C, cne12666.5.7:A497G,

cne2222.10.1:A431T, cne2483.2.1:A1667G, cne254274.1.1:T198C.

Genera included. Only the type genus (including subgenus /melda Hewitson, 1870).

Parent Taxon. Tribe Calydnini Seraphim, Freitas & Kaminski, 2018.

Echydnina Grishin, new subtribe

http://zoobank.org/7E98DF54-98E3-41D7-BC19-3528A548CD96

Type genus. Echydna J. Hall, 2002.

Definition. Echydna (type species Calydna chaseba Hewitson, 1854) is genetically differentiated from

other Calydnini genera at the tree level similar to that of Echenaidina subtrib. n. and therefore represents

a distinct subtribe (Fig. 17). Diagnostic characters for this subtribe are as those given in detail and

illustrated by Hall (2002) for Echydna. In brief, it is diagnosed by a combination of setose eyes and black

frons; in male genitalia, unique cornuti of three elements: a narrow unspined plate anteriad of an

unsclerotized sack with small spines and sclerotized ovoid with larger spines; and in female genitalia,

small signa without surface sculpturing. A combination of the following nuclear genomic base pairs is

diagnostic: cne2156.9.5:A3355G, cne5645.4.3:G360A, cne16213.4.1:A205G, cne16034.2.1:T643G, cne5785.

9.3:G454A.

Genera included. Only the type genus.

Parent Taxon. Tribe Calydnini Seraphim, Freitas & Kaminski, 2018.

Cariina Grishin, new subtribe

http://zoobank. org/6D9F6CE6-E393-4484-8 124-963 E2C60DE55

Type genus. Caria Hubner, 1823.

Definition. The tribe Riodinini Grote, 1895 (1827) splits into two prominent clades: the larger includes

the type genus, and the smaller consists of genera not previously used for family-group names (Fig. 17).

We propose that these two clades represent two subtribes, one of which is new. This new subtribe is

diagnosed by a combination of the following characters: eyes bare, palpi short, not visible above, both

sides of all wings either with submarginal row of metallic (silver, green) spots usually connected into a

band, or dark and with yellow bands or spots, or pale veins. In Barbicornis, hindwings unique, shovel-

shaped with a tail in the middle nearly equal to the hindwing length; in Chamaelimnas, forewings

elongated and with a yellow band, either diagonal (from mid-costa to tornus) or longitudinal (from base

towards outer margin); in Caria and Seco, forewing costal margin typically at least slightly convex. Male

genitalia with terminally bilobed valvae; in Chamaelimnas, boomerang-shaped, ventral lobe vestigial.

Best identified by DNA, and a combination of the following nuclear genomic base pairs is diagnostic:

cne1302.2.1:A1473G, cne1302.2.1:A2614C, cne1143.5.1:A883G, cnel143.5.1:A884C, cne8241.4.4:A67C.

Genera included. The type genus (Caria Hiibner, 1823), Barbicornis Godart, 1824, Chamaelimnas C.

Felder & R. Felder, 1865, and Seco J. Hall & Harvey, 2002.

Parent Taxon. Tribe Riodinini Grote, 1895 (1827).

Family Lycaenidae [Leach], [1815]

Liphyrinae Doherty, 1889 is a subfamily

Currently treated as a tribe within subfamily Miletinae Reuter, 1896, Liphyrinit Doherty, 1889 show

prominent genetic differentiation from the rest of Miletinae and are at the level in the genomic tree that

corresponds to subfamilies (Fig. 20). Therefore, we return this morphologically unique group to the status

of a subfamily as originally proposed: Liphyrinae Doherty, 1889, stat. rest.

Megalopalpina Grishin, new subtribe

http://zoobank.org/2A22A FFB-346D-4DCF-B256-C59DA7FCEFB1

Type genus. Megalopalpus Rober, 1886.

Definition. Megalopalpus Rober, 1886 (type species Megalopalpus simplex R6ber, 1886) forms a lineage

sister to all other Miletini Reuter, 1896 and is more prominently separated from them than they are from

each other (Figs. 20, 21). Therefore, we propose that this lineage represents a subtribe. This new subtribe

is diagnosed by a combination of the following characters, as given for the Megalopalpus section by Eliot

(1973): uncus with tegumen plates triangular, with a unique for this group broad lobe-like triangular

ventrally-pointed process, falces strongly curved, males lack secondary sexual characters, hindwing with

precostal vein. A combination of the following nuclear genomic base pairs is diagnostic: cce64.1.4:G152C,

cce5960.3.7:A41T, cce7884.1.3:A388A (not C), cce28693.2.4:G109G (not A), cce9880.2.2:A83A (not C),

cce49.4.1:C595C (not T), ccel16970.13.7:T187T (not G).

Genera included. Only the type genus.

Parent Taxon. Tribe Miletini Reuter, 1896.

Tarakina Eliot, 1973 is a subtribe

Currently treated as a tribe in the subfamily Miletinae Reuter, 1896, Tarakini Eliot, 1973 is sister to

Spalgini Toxopeus, 1929 and shows less extensive genetic differentiation from them than typical for the

tribal level (Fig. 21). The Taraka Doherty, 1889 lineage has split from Spalgini at the same tree level as

Megalopalpina subtrib. n. has split from Miletina Reuter, 1896. Therefore, we place Tarakina Eliot,

1973, stat. rev. as a subtribe in the tribe Spalgini, 1929.

Cesa Seven, 1997 is a subgenus of Crudaria Wallengren, 1875

The monotypic genus Cesa Seven, 1997 (type species Spindasis waggae Sharpe, 1898) is closely related

to Crudaria Wallengren, 1875 (type species Arhopala ? leroma Wallengren, 1857): the COI barcodes of

the type and the only species of Cesa (GenBank JN286116) and the type species of Crudaria (NVG-

22012H12) differ by 5.5% (36 bp). For comparison, the COI barcode difference between the type species

of sister genera (according to Boyle et al. (2015)) Crudaria and Cigaritis Donzel, 1848 (type species

Cigaritis zohra Donzel, 1848, NVG-22012H05) is 9.6% (63 bp), which is nearly twice as large and does

not preclude genus-level genetic differentiation between Crudaria and Cigaritis. Therefore, Cesa does not

represent a significant deviation from Crudaria to warrant its monotypic status as a genus and may be

placed in this genus with its close relatives. Acknowledging some morphological distinction of Spindasis

waggae, we propose to treat Cesa Seven, 1997, stat. nov. as a subgenus of Crudaria Wallengren, 1875.

Vansomerenia Heath, 1997 is a junior subjective synonym of Chloroselas Butler, 1886

The monotypic genus Vansomerenia Heath, 1997 (type species Desmolycaena rogersi Riley, 1932)

originates within the genus Chloroselas Butler, 1886 (type species Chloroselas esmeralda Butler, 1886),

rendering it paraphyletic (Fig. 21). The difference between their COI barcodes is 6.2% (41 bp), which is

typical for congeners. To restore monophyly and place close relatives in a single genus, we propose that

Vansomerenia Heath, 1997, syn. nov. is a junior subjective synonym of Chloroselas Butler, 1886.

ae Ps

a8 Miletina 105

100

‘ids Megalopalpina

100

Liptenina

its 7ooLPentilina

Axiocersini

bes 100

Pseudaletidina

Cigaritini

100 100

Cigaritina

Aloeidina

100

Liphyra brassolis|18017C11|Australia|old

Lachnocnema bibulus|19114D07|Natal|1945

Allotinus fallax]19114E05|Philippines:Luzon|1987

Logania malayica|19114E07|Thailand|old

Miletus symethus|19114E09|Singapore|1989

Megalopalpus simplex|19114E08|Uganda|1960

Spalgis epeus|19114E11|Pahang]1990

Feniseca tarquinius|4334|USA:IN,Newton Co.|2015

Liptena undularis|19118G12|Congo|1962

Pentila tropicalis|19118H09|South Africa|1948

Poritia hewitsoni|19119A01|Myanmar|2001

Axiocerses harpax|20127CO6|HT of efulena|Cameroon|1926

Zeritis pulcherrima|22012H09|Sudan|1916

Pseudaletis nigra|20128C03|HT|Cameroonjold

Pseudaletis agrippina|21015H01|Cameroon|1924

Cigaritis epargyros|20039C10|Central Asia|2004

Chloroselas mazoensis|22037C07|Africa|1943

Chrysoritis dicksoni|21015G03|South Africa|1948

Chrysoritis thysbe|21016A09|South Africa|1951

100

80 A

ae Phasisina

Aphnaeina

Aloeides thyra|20062B01|South Africa|1933

Trimenia wallengrenii|22037C09|South Africa|1941

Phasis thero|21015G01|South Africalold

Aphnaeus asterius|20127C01|HT of ilogo|Gabon|old

Aphnaeus orcas|22012G12|Cameroonlold

Boldenaria boldenarum|19079D11|New Zealand|1979

Lycaena phlaeas|PAOE01|France|2017

Hypaurotis crysalus|17117A05|USA:CO,Douglas Co.|1993

100 Thecla betulae|21018A01|Manchuria|old

100

Surendra quercetorum|21018F07|India:Sikkim|old

Semanga superba|22012G06|Malaysia:Borneolold

ay Arhopala thamyras|21018F09|Papua|1932

100 Mahathala ameria|22012G03|Nepal|1967

————— Neomyrina nivea hiemalis|21019A10|Vietnam|old

Drina donina|21019A04|Myanmar|1889

Candalides xanthospilos|19114F01|Austalia|1966

“ Erina erinus|19114F02|Solomons|1921

we Hypochrysops polycletus|21019D11|Indonesia:Seram|1990

Hypochrysopini — {6 Titea sublutea|22037F03|New Guinea:Wau|1972

a Philiris ilias|22012C03|Arulold

100

Jalmenini

68 oF

16 Pseudalmenini

100

100 48 Cheritrina

3 100

Horagina

100 100-

Loxurina

100

72 100

Rapalina

Rapalini

Pilodeudorigina

100

0.05

100

Paralucia pyrodiscus|21018E01|Australia|1944

Ogyris abrota|21018F06|Australia:Victoria|1952

Jalmenus evagoras|21019C06|Australia|1947

Jalmenus ictinus|21019C08|Australia|1948

Pseudalmenus chlorinda|21019C09|Australia|1945

Amblypodia narada|19119A05|Philippines:Luzon|1987

Iraota timoleon|19119A06|Bhutan|1891

Myrina silenus|19119A07|Nairobi]1968

Drupadia ravindra|21016D08|Indonesia:Belitung|1999

Cheritra frejaJ21019B07|Javajold

Thamala marciana|21019A03|Myanmar:Mergui|1889

Horaga onyx|22012G07|India:Assaml|old

Eooxylides tharis|21019B05|Malaysia:Borneo|1916

lolaus eurisus|21019F02|Liberia|1956

Britomartis cleoboides|22025C10|Sumatra|1894

Catapaecilma elegans|21018H11|India:Sikkim|old

Zesius chrysomallus|21019C04|Travancore|1891

Dapidodigma hymen|22012G10|Sierra Leone|old

Tomares ballus|18106H09|Tunis|1981

Tomares fedtschenkoi|20039A12|USSR|1972

Rapala arata|20062A12|Japan|1956

a Rapala varuna|21019D10|Australia|1946

Rapala iarbus|22025E04|India:Sikkim|1895

Pilodeudorix camerona|20127G12|T of barbatus|Sierra Leonelold

Paradeudorix ituri|22037C01|Congo|1962

Hypomyrina nomenia|22025D09|Congolold

Artipe eryx|21016E08|Malaysia:Pahang|2004

Capys alpheus|22037C03|South Africa|1945

Deudorix epijarbas|21019C11|Indialold

Bindahara phocides|21019B11|Indialold

Sinthusa nasaka|21018H03|Malaysia:Borneo|1916

Araotes lapithis|21018H0O5|Myanmar|1889

Eumaeus minyas|17074H03|Ecuador|USNM

Calycopis cecrops|3306|USA:LA,Natchitoches Pa.|2015

Callophrys rubi]20037H06|Spain|1974

Satyrium fuliginosa|20068G06|USA:CA,Plumas Co.|2012

Fig. 20. The phylogenetic tree of selected Lycaenidae (Polyommatinae are shown in Fig. 22 below) inferred from protein-

coding regions of the nuclear genome (autosomes). Family-group names are shown above or below the corresponding

branches. Not all subtribes are shown and/or labeled (see the subtribal classification list of Lycaenidae below). Names, clades,

and species of new tribes and subtribes proposed in this work are shown in color. Names of other subtribes are shown in black,

and names of subfamilies and tribes are shown in shades of gray.

Lachnocnema bibulus|19114D07|Natal|1945

Allotinus fallax|19114E05|Philippines:Luzon|1987

Allotinus taras|20128F01|ST|Myanmar|1889

100

Miletina Tao Logania malayica|19114E07|Thailand|old

nee 100 Logania obscurus|20128F06|Celebes|1887

=e a0b Miletus symethus|19114E09|Singapore|1989

Megalopalpina * Miletus croton|19114E10|Myanmar|2003

es ; Megalopalpus simplex|19114E08|Uganda|1960

Spalgina mA Spalgis epius|7272|Myanmar|2002

100 Feniseca tarquinius|4334|USA:IN,Newton Co.|2015

Tarakina Ve Taraka hamada|20061HO07|Japan|1955

bs Taraka shiloi]23021A01|China:Shaanxi

96 700 Axiocerses harpax|20127CO6|HT of efulena|Cameroon|1926

or Zeritis pulcherrima|22012H10|Angola|old

Pseudaletidina * Pseudaletis nigra|20128C03|HT|Cameroon|old

Pseudaletis agrippina|21015H0O1|Cameroon|1924

Cigaritis epargyros|20039C10|Central Asia|2004

Cigaritis 100 Cigaritis myrmecophila|21016D04|PT|Tunisia|old

100 Cigaritis zohra|22012H05|Algeria|1930

100 Cigaritis takanonis|21016D03|PT of morinis|Japan|1952

100 a Cigaritis crustaria|20127C04|HT of mysteriosa|Fr. Guinea|1952

i Spindasis Cigaritis natalensis|22012H07|South Africalold

7 Chloroselas pseudozeritis|20127C05|South Africalold

100 Chloroselas rogersi [=Vansomerenia]|22037C08|Kenya|1960

76 Chloroselas mazoensis|22037C07|Africa|1943

100 Crudaria leroma|22012H12|Zimbabwe|1966

Cigaritina Chrysoritis —— Chrysoritis dicksoni|21015G03|South Africa|1948

Chrysoritis chrysaor|21016A01|South Africajold

Chrysoritis felthami|21015H12|South Africa|1948

66 100 Chrysoritis pyroeis|21016A04|South Africa|1962

100 3 Chrysoritis palmus|21016A07|South Africa|1948

too Chrysoritis thysbe|]21016A09|South Africa|1951

Auricirrus * Re Chrysoritis nigricans|21016A11|South Africa|1948

Chrysoritis zeuxo|21016A05|South Africa|1947

Chrysoritis zonarius|21016A06|South Africa|1948

Aloeides thyra|20062B01|South Africa|1933

100

sage

EHOPIGINAT Tic — Aloeides pierus|21015G02|South Africalold

mae **! Phasisina * Trimenia wallengrenii|22037C09|South Africa|1941

100 : Phasis thero|21015G01|South Africa|old

Aphnaeina Aphnaeus asterius|20127C01|HT of ilogo|Gabon|old

100

Aphnaeus orcas|22012H01|Cameroon|1971

Fig. 21. The phylogenetic tree of Miletinae and Aphnaeinae inferred from protein-coding regions of the nuclear genome

(autosomes). Names are shown by corresponding branches: family-group in roman font and subgenera in italics. Names

proposed in this work are marked with red asterisks. Names, clades, and species of taxa referring to this figure from the text are

colored: Tarakina stat. nov. (green), Spindasis stat. rest. (magenta), Vansomerenia syn. nov. (orange), and Auricirrus subgen.

n. (blue). Other names of subtribes are shown in black, and names of subfamilies and tribes are shown in shades of gray.

Auricirrus Grishin, new subgenus

http://zoobank.org/B527E473-8675-489E-B979-EAFF56996F4B

Type species. Papilio thysbe Linnaeus, 1764.

Definition. African genus Chrysoritis Butler, 1898 (type species Zeritis oreas Trimen, 1891) has been

divided into two clades: the eastern (chrysaor clade) and the western (includes the thysbe clade) (Talavera

et al. 2020) (Fig. 21). Strong genetic differentiation between these clades warrants their recognition at

least as subgenera: estimated divergence time between them is about 17 Mya (Talavera et al. 2020),

comparable to that of some genera. Among all Chrysoritis species, the type species of available genus-

group names belong to the eastern clade (Talavera et al. 2020): Zeritis oreas Trimen, 1891 (of

Chrysoritis), Zeritis lycegenes Trimen, 1874, which is a subspecies of Zeritis lyncurium Trimen, 1868 (of

Poecilmitis Butler, 1899), Zeritis phosphor Trimen, 1864 (of Bowkeria Quickelberge, 1972), and Phasis

dicksoni Gabriel, 1947 (of Oxychaeta Tite & Dickson, 1973). This eastern clade represents the

nominotypical subgenus. However, the western clade remains without a name and represents a new

subgenus. This subgenus differs from the nominal by the absence of tibial spicules (Heath 1997),

produced (but not tailed) hindwing tornus and/or blue or violet scaling on dorsal surface of wings in some

species (lacking in the nominotypical subgenus), and in species with more rounded tornus, spots on

ventral forewing—especially at the end of discal cell—are with more extensive silvery scaling. A

combination of the following nuclear genomic base pairs is diagnostic: cce3229.3.2:A633G, cce2784.3.3:

C85G, cce2423.1.2:A2767T, cce7537.1.5:C57T, cce5689.1.7:A744G.

Etymology. The name Chrysoritis may have been derived from the Greek "chryso" (gold) and "ritis" (hair

or curl). Their Latin equivalents are "aurum" (gold) and “cirrus” (lock or curl of hair), connected with a

vowel 7 to form the name of the subgenus. The name is a masculine noun in the nominative singular.

Species included. The type species (i.e., Papilio thysbe Linnaeus, 1764) and 41 others, names given in

their original combinations: Poecilmitis adonis Pennington, 1962, Poecilmitis turneri amatola Dickson &

McMaster, 1967, Chrysoritis adonis aridimontis Heath & Pringle, 2007, Poecilmitis aridus Pennington,

1953, Poecilmitis azurius Swanepoel, 1975, Poecilmitis beaufortia Dickson, 1966, Poecilmitis beulah

Quickelberge, 1966, Poecilmitis blencathrae Heath & Ball, 1992, Poecilmitis braueri Pennington, 1967,

Poecilmitis thysbe brooksi Riley, 1938, Zeritis chrysantas Trimen, 1868, Poecilmitis (Poecilmitis) daphne

Dickson, 1975, Poecilmitis endymion Pennington, 1962, Zeritis felthami Trimen, 1904, Poecilmitis irene

Pennington, 1968, Poecilmitis lyndseyae Henning, 1979, Poecilmitis lysander Pennington, 1962,

Poecilmitis mithras Pringle, 1994, Phasis thysbe var. nigricans Aurivillius, 1924, Poecilmitis orientalis

Swanepoel, 1976, Papilio palmus Stoll, 1781, Poecilmitis pan Pennington, 1962, Poecilmitis pelion

Pennington, 1953, Poecilmitis penningtoni Riley, 1938, Poecilmitis perseus Henning, 1977, Poecilmitis

plutus Pennington, 1967, Poecilmitis pyramus Pennington, 1953, Zeritis pyroeis Trimen, 1864,

Poecilmitis rileyi Dickson, 1966, Poecilmitis stepheni Dickson, 1978, Poecilmitis swanepoeli Dickson,

1965, Poecilmitis thysbe trimeni Riley, 1938, Poecilmitis turneri Riley, 1938, Poecilmitis uranus

Pennington, 1962, Poecilmitis violescens Dickson, 1971, Poecilmitis whitei Dickson, 1994, Poecilmitis

williami Heath, 1997, Poecilmitis wykehami Dickson, 1980, Papilio zeuxo Linnaeus, 1764, Phasis zeuxo

zonarius Riley, 1938, Poecilmitis nigricans zwartbergae Dickson, 1982 (including their subspecies and

synonyms). Species taxonomy follows Heath (2023) and Williams (2023c).

Parent taxon. Genus Chrysoritis Butler, 1898.

Spindasis Wallengren, 1857 is a subgenus of Cigaritis Donzel, 1848

Phylogenetic analysis of Aphnaeinae Distant, 1884 revealed that the genus Cigaritis Donzel, 1848 (type

Species Cigaritis zohra Donzel, 1848) splits into two prominent clades: mostly Oriental (hindwing tornal

lobe not well developed or lacking, at least one hindwing tail short, < 2 mm) and African (hindwing tornal

lobe well developed, both hindwing tails long) (Riley 1925) with genetic differentiation between them

similar to that of the two subgenera in Chrysoritis Butler, 1898 (type species Zeritis oreas Trimen, 1891)

(Boyle et al. 2015) (Fig. 21). Therefore, the two clades of Cigaritis correspond to subgenera. The (mostly)

Oriental clade is the nominal subgenus because the type species of Cigaritis (from NW Africa) belongs to

this clade. Two additional genus-group names have type species currently placed in Cigaritis: Spindasis

Wallengren, 1857 (type species Spindasis masilikazi Wallengren, 1857, which is a junior subjective

synonym of Aphnaeus natalensis Westwood, [1851]) and Apharitis Riley, 1925 (type species

Polyommatus epargyros Eversmann, 1855). The latter is in the Asian clade and, therefore, remains a

junior subjective synonym of Cigaritis. The former belongs to the African clade and, therefore, this clade

corresponds to the subgenus Spindasis Wallengren, 1857, stat. rest., which we propose to treat as a valid

subgenus instead of a synonym.

Tribes in Aphnaeinae Distant, 1884

Inspection of the genomic tree reveals three strongly supported clades in the subfamily Aphnaeinae

Distant, 1884 that we define as tribes (Figs. 20, 21): nominotypical, “Apharitini” Chou et al., 1994, and

the third one that does not have a name and is described below. The name “Apharitini” was published in

Chou et al. (1994) in an informal way without description, definition, or references to them (fails ICZN

Art. 13.) and is a nomen nudum. The name for this tribe that satisfies the requirements of the ICZN Code

is proposed below. We define three tribes and not two because the phylogenetic affinities of the unnamed

tribes with the nominotypical one are not particularly strong (86%), and combining their clades may not

result in a monophyletic taxon if this topology is incorrect. The three clades are the same in the recently

published large-scale tree (Kawahara et al. 2023), but the topology is different in a tree based on a more

limited set of gene markers (but a larger set of taxa) (Boyle et al. 2015).

Cigaritini Grishin, new tribe

http://zoobank. org/E44D983 1-7137-4120-86CB-700DBCC8D752

Type genus. Cigaritis Donzel, 1848.

Definition. The clade with Cigaritis (type species Cigaritis zohra Donzel, 1848) and related genera is

genetically differentiated from other clades and is at the tree level of a tribe (Figs. 20, 21). This new tribe

is morphologically diverse and can be distinguished from other members of the subfamily Aphnaeinae

Distant, 1884 by the shape of uncus, which is highly variable, but nevertheless bilobed or divided, with

centrally concave distal margin (see Stempffer (1967) for illustrations and more detailed descriptions): in

Lipaphnaeus Aurivillius, 1916, subtriangular uncus is deeply divided with narrow, tooth-like pointed

lobes; in Chloroselas Butler, 1886, the lobes are small and subtriangular uncus is with a central notch

separating finely serrated lobes; in Cigaritis Donzel, 1848, uncus is broader than long, nearly rectangular

or trapezoidal in dorsal view (sometimes nearly vestigial), lobes widely separated, uncus mostly concave

(may be with irregularities) between the lobes; in Chrysoritis Butler, 1898 and Crudaria Wallengren,

1875, uncus is similar, trapezoidal or heart-shaped, but less broad, with rounded lobes and convex margin

between them; in Pseudaletis H. H. Druce, 1888, uncus is divided for nearly its entire length with finger-

like terminally rounded lobes. In other Aphnaeinae tribes, uncus in undivided and not strongly bilobed:

typically, from almost square to broadly rectangular, with nearly flat (with some irregularities) distal

margin, or dome-shaped with convex distal margin, which is only slightly concave in Trimenia Tite &

Dickson, 1973 (type species Zeritis wallengrenii Trimen, 1887), thus resembling Chrysoritis, but uncus is

narrower and without clearly defined lobes expanded laterally (as in Chrysoritis and Crudaria).

Furthermore, 7rimenia has saccus, which is not developed in Chrysoritis. A combination of the following

nuclear genomic base pairs is diagnostic: cce332.12.5:A61T, cce1232.20.1:A596G, cce1351.40.3:A349T,

cce5072.9.1:A67C, cce2368.14.7:G95T.

Genera included. The type genus (1.e., Cigaritis Donzel, 1848), Chloroselas Butler, 1886, Chrysoritis

Butler, 1898, Crudaria Wallengren, 1875, Lipaphnaeus Aurivillius, 1916, and Pseudaletis H. H. Druce,

1888, including their subgenera and synonyms (e.g., Cesa Seven, 1997, Vansomerenia Heath, 1997, and

Apharitis Riley, 1925).

Parent Taxon. Subfamily Aphnaeinae Distant, 1884.

Comment. This tribe corresponds to “Apharitini” of Chou et al. (1994), published without description,

definition, or references to them: a nomen nudum (fails ICZN Art. 13.). Apharitis Riley, 1925 (type

species Polyommatus epargyros Eversmann, 1855) is a junior subjective synonym of Cigaritis.

Pseudaletidina Grishin, new subtribe

http://zoobank. org/D8A065B1-FOCF-4A7F-BADA-FO6FDEECA919

Type genus. Pseudaletis H. H. Druce, 1888.

Definition. Pseudaletis (type species Pseudaletis agrippina H. H. Druce, 1888) is in the lineage that is

sister to all other Cigaritini Grishin, trib. n. and is genetically differentiated from them at the subtribal

level (Figs. 20,21). Therefore, we propose to treat this lineage as a subtribe. This new subtribe is

diagnosed by a combination of the following characters, as given for the Pseudaletis section by Eliot

(1973): palpi short—much less than half of the head length—covered in appressed scales, proboscis very

short (but functional), forewing appears disproportionately large comparatively to hindwing; uncus

divided for nearly its entire length with finger-like terminally rounded lobes, falces rudimentary, pointed

processes inflexibly fused to tegumen; female abdomen with a prominent tuft of specialized scales, which

are spoon-shaped with long “handles”. A combination of the following nuclear genomic base pairs is

diagnostic: cce1853.23.8:T1384A, cce133.4.1:A287G, cce4260.4.1:G34A, cce1367.9.3:G1252A, ccel17940.6.2:C71A.

Genera included. Only the type genus.

Parent Taxon. Tribe Cigaritini Grishin, trib. n.

Axiocersini Grishin, new tribe

http://zoobank. org/I BBFE9EC-A B8B-4709-A250-4DA082ED2B4E

Type genus. Axiocerses Hiibner, [1819].

Definition. Axiocerses (type species Papilio perion Stoll, 1782, which is a junior subjective synonym of

Papilio harpax Fabricius, 1775) and Zeritis Boisduval, 1836 (type species Zeritis neriene Boisduval,

1836) are confident sisters in the genomic tree (Figs. 20, 21), consistently with similarities in their

morphology reported previously (Stempffer 1967). The two genera form a clade that originates early in

the radiation of the subfamily Aphnaeinae Distant, 1884, and, therefore, it corresponds to a tribe. This

new tribe is distinguished from the relatives by a combination of the following characters: uncus very

broad and short, distal margin straight or convex, lobes nearly triangular or rounded, falces thick at the

base, then strongly angled with free branch long and slender, ventral side with apophysis, tegumen with

uncus hood-shaped, tegumen with convex anterior margin; palpi short, not extending or slightly extending

beyond the fronts, 2" segment of palpi with long scales and hairs; tarsus unsegmented, with spines below;

forewing with only 10 veins (Stempffer 1967; Henning and Henning 1996). The similarity in uncus,

falces, and tegumen unifies Axiocerses and Zeritis Boisduval, 1836 (Stempffer 1967). A combination of

the following nuclear genomic base pairs is diagnostic: cce243.9.9:A1417C, cce15587.11.3:G103A,

cce127.4.3:A149T, cce980.22.7:C902T, cce2423.1.2:T23 15C.

Genera included. The type genus (1.e., Axiocerses Hitibner, [1819]) and Zeritis Boisduval, 1836.

Parent Taxon. Subfamily Aphnaeinae Distant, 1884.

Aloeidina Grishin, new subtribe

http://zoobank. org/A32E LEE2-A06D-4100-AFD9-3214F38A2C93

Type genus. A/oeides Hubner, [1819].

Definition. Within Aphnaeini Distant, 1884, the clade of several genera that includes Aloeides (type

species Papilio pierus Cramer, 1779) corresponds to the subtribal level in the tree (Figs. 20, 21). This new

subtribe is distinguished from its relatives by a combination of these characters, as discussed and

illustrated by Stempffer (1967), Tite & Dickson (1973), and Eliot (1973): foreleg and midleg tibiae with

apical spurs, palpi smooth, with equal length scales (in several species with some scattered long ribbon-

shaped blunt scales), or with uniquely long and bristly white scales (in Erikssonia Trimen, 1891),

forewing vein R4+s originates at or beyond the junction of the discocellular vein and vein Mj, vein Ro

originates next to the origin of vein R4+s. A combination of the following nuclear genomic base pairs is

diagnostic: cce5760.10.2:C484T, cce2790.13.2:T63C, cce2790.13.2:A183G, cce1354.3.7:A61T, cce1354.3.7:

T1903A.

Genera included. The type genus (i.e., A/oeides Hiibner, [1819]), Argyraspodes Tite & Dickson, 1973,

Erikssonia Trimen, 1891, and Trimenia Tite & Dickson, 1973.

Parent Taxon. Tribe Aphnaeini Distant, 1884.

Phasisina Grishin, new subtribe

http://zoobank. org/B6D8239D-DAF0-4865-9F3E-18677ABDEA6F

Type genus. Phasis Hubner, [1819].

Definition. Within Aphnaeini Distant, 1884, the clade of several genera that includes Phasis (type species

Papilio salmoneus Stoll, 1781, which is a junior subjective synonym of Papilio thero Linnaeus, 1764)

corresponds to the subtribal level in the tree (Figs. 20, 21). This new subtribe is distinguished from its

relatives by a combination of the following characters, as discussed and illustrated by Tite & Dickson

(1973): tibia of all legs without apical spurs, forewing vein M2 originates much closer to the origin of vein

M, than to the origin of vein M3, vein R2 originates at a distance from vein R4+s, size larger with forewing

longer than 16 mm. A combination of the following nuclear genomic base pairs is diagnostic: cce288.3.2:

AT9C, cce33.3.3:A234G, cce2859.6.1:T729C, cce511.6.1:A54G, cce14215.5.1:T850C, cce33280.1.7:T944T

(not A), cce3467.4.4:A374A (not G), cce7428.5.1:G156G (not A), cce4435.12.1:C616C (not A), ccel239.1.

3:T235T (not G).

Genera included. The type genus (1.e., Phasis Hiibner, [1819]) and 7ylopaedia Tite & Dickson, 1973.

Parent Taxon. Tribe Aphnaeini Distant, 1884.

Surendrini Kocak & Seven, 1997 is a tribe

Currently placed in the tribe Arhopalini Bingham, 1907, Surendrina Kocgak & Seven, 1997 is not

monophyletic with it and instead is sister to Theclini Swainson, 1830 (Fig. 20). It is conceivable to place

Surendrina in Theclini, but the two groups are more distinct from each other than subtribes and are at the

tree level of tribes. Therefore, we propose to treat the former taxon as a tribe Surendrini Kogak & Seven,

1997, stat. nov.

Drinini Grishin, new tribe

http://zoobank. org/200 LE28A-4C8C-45D9-B228-E34D99B26E85

Type genus. Drina Nicéville, 1890.

Definition. Currently in Loxurini Swinhoe, 1910, Drina (type species Myrina donina Hewitson, 1865) is

not monophyletic with it and is not closely related to that tribe, instead forming a separate lineage

originating early in the diversification of Theclinae Swainson, 1831 (Fig. 20). Therefore, we propose that

this lineage corresponds to a tribe. This new tribe is diagnosed by a combination of the following

characters, as given for the Drina section by Eliot (1973): male genitalia with significantly reduced

(nearly vestigial) tegumen (not wider than valva in lateral view), uncus, and falces, and long and narrow

vinculum; forewing with 11 veins, the three M veins are nearly at the same distance from each other,

hindwing with a single tail at vein CuA2. A combination of the following nuclear genomic base pairs is

diagnostic: cce305.14.6:G130A, cce305.14.6:TI31C, ccel1105.7.5:G93A, cce144.8.2:G223A, cce204.17.10:

C49A, cce3081.9.2:G97G (not T), cce2598.5.13:G484G (not C), cce2598.5.13:C485C (not A), cce948.2.2:

T73T (not A), cce948.2.2: A139A (not G).

Genera included. Only the type genus.

Parent Taxon. Subfamily Theclinae Swainson, 1831.

Hypochrysopini Grishin, new tribe

http://zoobank.org/713 1748 1-COFE-4839-97E2-341444327DD7

Type genus. Hypochrysops C. Felder & R. Felder, 1860.

Definition. Currently placed in Luctini Waterhouse & Lyell, 1914, Hypochrysops (type species Papilio

polycletus Linnaeus, 1758) and related genera are not monophyletic with it and instead form a distinct

clade within Theclinae Swainson, 1831 not confidently associated with any other subtribe (Fig. 20).

Therefore, this clade represents a subtribe. This new tribe is diagnosed by a combination of the following

characters, as given for the Hypochrysops section by Eliot (1973): uncus not produced, rounded, falces

prominent, strongly curved, juxta absent or vestigial, aedeagus very thick, just slightly narrower than

valva, valva rhomboidal, saccus not developed; ventral wing surface typically with obsolete or distorted

patterns with metallic silver or green spots and bands and red blotches. A combination of the following

nuclear genomic base pairs is diagnostic: cce3313.6.1:G1784C, cce3313.6.1:G2131C, cce67043.1.6:C55G,

cce67043.1.6:A56T, ccel184.15.22:G142C.

Genera included. The type genus (i.e., Hypochrysops C. Felder & R. Felder, 1860), Philiris R6ber, 1891,

and Titea Eliot, 1973.

Parent Taxon. Subfamily Theclinae Swainson, 1831.

Jalmenini Grishin, new tribe

http://zoobank. org/D58DOD0A-382D-4E6D-B879-75D3DE7A3670

Type genus. Ja/menus Hubner, 1818.

Definition. Currently in Zesiusinae Swinhoe, 1912, Jalmenus (type species Jalmenus evagoras Hiibner,

1818, which is a junior homonym of Papilio evagoras Donovan, 1805) is far removed from the genus

Zesius Hiibner, [1819] (type species Zesius chrysomallus Hiibner, 1823) in the genomic tree, and instead

forms a distinct lineage within Theclinae Swainson, 1831 not confidently associated with other genera

(Fig. 20). Therefore, this lineage represents a tribe. This new tribe is diagnosed by a combination of the

following characters, as given for the Ja/menus section (excluding Pseudalmenus H. H. Druce, 1902) by

Eliot (1973): uncus and tegumen narrower in lateral view, longer than in relatives, ventral side not

expanded, falces smaller, tegumen not expanded anteriad, valva without costal process, simple and

rounded; palpi with 3' segment very long, 2" segment with bristle-like scales. A combination of the

following nuclear genomic base pairs 1s diagnostic: cce9330.11.2:G69A, cce7486.3.3:T58G, cce9657.10.

14:T3166C, cce10680.1.1:T28C, cce4529.2.2:A67G.

Genera included. Only the type genus.

Parent Taxon. Subfamily Theclinae Swainson, 1831.

Pseudalmenini Grishin, new tribe

http://zoobank. org/BB6B6C59-EA D7-42B4-B7E6-CA95E94A4 19D

Type genus. Pseudalmenus H. H. Druce, 1902.

Definition. In the genomic tree, Pseudalmenus (type species Jalmenus myrsilus Westwood, 1851, which

is a subspecies of Thecla chlorinda Blanchard, 1848) is a weakly supported (54%) sister of Jalmenus

Hiibner, 1818, and therefore may not be monophyletic with it (Fig. 20). Hence, we propose that this

lineage represents a tribe. This new tribe was included in the Ja/menus section by Eliot (1973) and is

diagnosed by a combination of the following characters: 3 segment of palpi shorter than in Jalmenini

trib. n., 2"? segment hairy; uncus with ventral portion expanded, protruding posteriad of the dorsal

margin, falces long and strongly curved, tegumen well-developed, expanded anteriad, valva with the

curved costal process giving it a crab claw-like appearance. A combination of the following nuclear

genomic base pairs is diagnostic: ccel0780.3.1:G247A, ccel122.11.2:C1079G, ccel1670.2.2:C750T,

cce24738.4.8:A1793G, ccel0780.2.2:A2954G.

Genera included. Only the type genus.

Parent Taxon. Subfamily Theclinae Swainson, 1831.

Myrinini Toxopeus, 1929 is a tribe

Currently in Amblypodiini Doherty, 1886, close relatives Myrina [Fabricius], 1807 (type species Papilio

alcides Cramer, 1776) and Jraota F. Moore, 1881 (type species Hesperia maecenas Fabricius, 1793) are

distantly related to Amblypodia Horsfield, 1829 (type species Thecla narada Horsfield, 1828). The clade

of these three genera is not strongly supported (42%) in our tree (Fig. 20), and their union is not

monophyletic in a global phylogeny of butterflies (Kawahara et al. 2023). Therefore, we propose a status

of a tribe for Myrinini Toxopeus, 1929, stat. nov., which consists of two genera (Myrina and Iraota).

Horagina Swinhoe, 1910 and Loxurina Swinhoe, 1910 are

subtribes of Cheritrini Swinhoe, 1910

Currently regarded as distinct tribes, Cheritrini Swinhoe, 1910, Horagini Swinhoe, 1910, and Loxurini

Swinhoe, 1910 (Eliot 1973) are closely related to each other and are at the tree level of subtribes (Fig. 20).

Being combined, all three constitute one tribe. The priority of these names could not be determined

because they were proposed (as subfamilies) on the same page of the same work (1.e., issued on the same

date). As the first revisers, we give priority to Cheritrini Swinhoe, 1910, because this group includes more

genera and species than the other two. As a result, we propose that Horagina Swinhoe, 1910, stat. nov.

and Loxurina Swinhoe, 1910, stat. nov. are subtribes of Cheritrini Swinhoe, 1910.

Rapalini Grishin, new tribe

http://zoobank.org/6B76C64C- 1C57-4CC8-BBA2-925D4AFBCF7D

Type genus. Rapala F. Moore, 1881.

Definition. Currently, in Deudorigini Doherty, 1886, several genera, including Rapala (type species

Thecla varuna Horsfield, 1829), form a clade that is not confidently monophyletic with it: only 26%

partitions in the genomic tree support their grouping with Deudorigini. Low support values indicate a

more distant relationship and a possibility of incomplete lineage sorting or gene exchange around the time

of origin of these clades. The clade consisting of Rapala (mostly Oriental) and three Afrotropical genera

closely related to Pilodeudorix H. H. Druce, 1891 (type species Pilodeudorix barbatus H. H. Druce,

1891) is most confidently supported (100%) and corresponds to the level of a tribe in the tree (Fig. 20).

This new tribe differs from relatives by male genitalia having conjoined valvae that evenly taper to

narrow rounded or pointed apices, uncus and tegumen broad, two lobes of uncus with a concave margin

between them, hood-shaped; secondary sexual characters in males: an oval brand of small androconia

near the base of cell Sc+Ri-RS (at least in non-African species), and typically a hair tuft on ventral

forewing near inner margin to complement the brand, sometimes with other brands, including those on

abdomen; hindwing tailed, forewing veins R4+s and Mi originate separately, although may be very

narrowly separated at their origins (Eliot 1973). Most confidently distinguished by DNA and a

combination of the following base pairs in the nuclear genome is diagnostic: cce303273.1.1:G197A,

cece 1093.2.1:A4672C, cce3516.7.1:A173T, cce12299.7.3:G134A, cce4160.2.2:A207G.

Genera included. The type genus (i.e., Rapala F. Moore, 1881), Pilodeudorix H. H. Druce, 1891,

Hypomyrina H. H. Druce, 1891, and Paradeudorix Libert, 2004.

Parent Taxon. Subfamily Theclinae Swainson, 1831.

Pilodeudorigina Grishin, new subtribe

http://zoobank. org/5826F9A8-6834-487C-B207-DC883CE19307

Type genus. Pilodeudorix H. H. Druce, 1891.

Definition. Afrotropical clade of Rapalini trib. n. that includes Pilodeudorix (type species Pilodeudorix

barbatus H. H. Druce, 1891, which is a junior subjective synonym of Sithon camerona Plétz, 1880) is

genetically differentiated from non-Arican (mostly Oriental) species at the tree level of a subtribe (Fig.

20). This new subtribe is diagnosed by a combination of the following characters: abdomen frequently

with scent brands and hindwings with hair tufts; aedeagus shorter and less gracile that in the

nominotypical tribe, frequently expanded terminally, vesica with many small cornuti and usually with

large cuneus; basally fused valvae with a rectangular gap between them in many species, in others, each

valva with a process, hook-like in ventral view, uncus lobes are frequently less separated from each other

than in the nominotypical subtribe (Stempffer 1967). Best distinguished by DNA and a combination of

Oxylidina

100 Hemiolaina

100

Hypotheclina

Cupidopsina

Niphandina

100

Oxylides faunus|19119A09|Cameroon|1989

Syrmoptera melanomitra|19119A10|Cameroon|1987

Hemiolaus caeculus caeculus|21019F04|Zambia|1961

Ancema ctesia|21018G06|Naga Hills|old

Remelana jangala|21018G12|India:Sikkim|old

Hypolycaena sipylus|21019A01|Indonesia:Buru|old

Leptomyrina lara|22025D05|Namibia|1972

Anthene emolus|19118B04|Myanmar|2003

Neurellipes lusones|19118B06|Cameroon|1989

Hypothecla astyla|19119A11|Philippines:Leyte|1986

Cupidopsis jobates|22026G07|Kenya|1978

Niphanda tessellata|19114F04|Thailand|1971

Theclinesthina —— Theclinesthes miskini|22026H10|Australia|1943

Neolucia agricola|22026H12|Australia|1942

140 Azanina r Azanus ubaldus|20128A02|South Africalold

Azanus isis|22038B10|Uganda|1951

ee Unina -—> Una usta|22026G09|Malaysia:Malaccal|old

, 54 Petrelaea dana|22026H01|India:Darjeeling|old

Danina Nacaduba kurava|22026H03|Sri Lankalold

60 ‘ Danis danis|22027A10|Ambonjold

lonolycina -—— lonolyce helicon|22038A11|Myanmar|1989

Paraduba owgarra|22103G03|New Guinea|1972

Pithecops corvus|22027E04|Bali|1980

Pithecops dionisius|22027E07|T of euanthes|Buru|1898

Zizula hylax|20127H04|Phillipines:_Luzon|old

ug? = Oraidium barberae|21109A05|South Africa|1962

Pithecopsina

74 100

Zizulina

Brephidiina Brephidium exilis|6827|USA:TX,San Patricio Co.|2016

Oreolyce vardhana|22026F01|Himalaya|1924

Celastrina argiolus|6242|Bosnia|2009

Megisba malaya|22038B12|Indonesia:Lombok|1990

Jamides bochus|22027B04|India:Nilgiri Hils|old

Catopyrops ancyra|22026H09|Lombok|old

Zizeeria karsandra|22027C09|Nepal|1967

74 Famegana nisa|22027D01|NGuinea|1963

96 Catochrysopina—~——_———— Epimastidia inops|22027B01|Aru|1884

68 Catochrysops strabo|22027B05|Nepal|1973

gq Oboroniina Oboronia punctatus|22028D04|Ghana|1965

Lepidochrysops parsimon|22028D01|Kenyalold

Caleta caleta|22027A04|Celebes|old

Castalius rosimon|22027C07|Nepal|1964

Scolitantides orion|20062A01|Bohemia|1958

ay Euphilotes enoptes|PAO65|USA:CA, Sierra Co.|2016

Uranothaumatina;—~ Phlyaria cyara|22027B09|Cameroonjold

AG 100 ‘Actizarina Uranothauma crawshayi|22038B04|Malawilold

ei Tantotiva Actizera lucida|22027D04|Malawi|1952

Leptotes cassius|10423|Jamaica|2017

Lampides boeticus|20055G01|Greece|2018

Cacyreus lingeus|22027B11|Ethiopia|1939

Cupido argiades|22027E09|Austria|1927

Elkalyce cogina|22038B08|Brazil:SP|1991

Pseudochrysops bornoi|22037G05|DR|1981

Polyommatus icarus|PAOE03|France|2017

Zizeeriina ia

4 Fameganina

100

100 ws

Castaliina aT

Scolitantidina BO

Lampidina

Everina

100

Polyommatina

Fig. 22. The phylogenetic tree of selected Polyommatinae (other Lycaenidae are shown in Fig. 20) inferred from protein-

coding regions of the nuclear genome (autosomes). Family-group names are shown above or below the corresponding

branches. Not all subtribes are shown and/or labeled (see the subtribal classification list of Lycaenidae below). Names, clades,

and species of new subtribes proposed in this work are shown in color. Names of other subtribes are shown in black, and names

of subfamilies and tribes are shown in shades of gray.

the following nuclear genomic base pairs is diagnostic: cce303351.9.14:A88G, cce303351.9.14:A89G,

cece 14215.8.1:C143T, cce881.1.6:A79G, cce462.24.2:C89G.

Genera included. The type genus (1.e., Pilodeudorix H. H. Druce, 1891), Hypomyrina H. H. Druce, 1891,

and Paradeudorix Libert, 2004.

Parent Taxon. Tribe Rapalini Grishin, trib. n.

Oxylidini Eliot, 1973, Remelanini Eliot, 1973, and Hypolycaenini Swinhoe, 1910

belong to Polyommatinae Swainson, 1827, not to Theclinae Swainson, 1831

Traditionally placed among hairstreaks (Theclinae Swainson, 1831) due to their appearance (frequently

with very long hindwing tails), species from the tribes Oxylidini Eliot, 1973, Remelanini Eliot, 1973, and

Hypolycaenini Swinhoe, 1910 are confidently placed as a sister clade to “Blues” and are not

monophyletic with the subfamily Theclinae (Figs. 20, 22). Therefore, they do not belong to Theclinae.

Their genetic differentiation from the clade that consists of traditional Polyommatinae Swainson, 1827

(tribes Lycaenesthini Toxopeus, 1929, Hypotheclini Eliot, 1973, and Polyommatini Swainson, 1827) is

smaller than that for other subfamilies of Lycaenidae. Insufficient differentiation argues against treating

Oxylidini, Remelanini, and Hypolycaenini as a subfamily of their own. Therefore, we place them in the

subfamily Polyommatinae. We see that the three subfamilies, Lycaeninae, Theclinae, and Polyommatinae,

are closely related to each other (Figs. 20, 22), as expected and evidenced by morphology (Eliot 1973).

The genetic distinction of Lycaeninae from the two other subfamilies is more pronounced, and the tree

branches separating them are more prominent (Fig. 20). However, Theclinae and Polyommatinae are less

distinct from each other, and “blues” originate from within “hairstreaks”, not next to them, like butterflies

originate from within moths, birds from within reptiles, and tetrapods from within fishes. Furthermore,

due to their close relationship, it is conceivable to unify Theclinae and Polyommatinae into one subfamily

(Polyommatinae). We are not taking this step here and continue with the traditional tri-subfamily

arrangement for now, simply rearranging tribes among Theclinae and Polyommatinae to restore

monophyly. See our proposed subtribal classification of Lycaenidae below.

Hemiolaina Grishin, new subtribe

http://zoobank. org/45FFC7EB-6CFA-49A6-A688-EC98E721BA62

Type genus. Hemiolaus Aurivillius, 1922.

Definition. Hemiolaus (type species Jolaus caeculus Hopffer, 1855) forms a lineage sister to other

Oxylidini Eliot, 1973, but is genetically differentiated from them at the subtribal level, and therefore

represents a subtribe (Fig. 22). This new subtribe is diagnosed by a combination of the following

characters, as given for the Hemiolaus section by Eliot (1973): juxta enlarged, longer than half of valva,

shaped as the end of a nail puller with a deep cleft; ventral hindwing of males with a scent patch beneath a

hair brush; antennal club short, nudum confined to the club, about 32 segments, palpi with 3 segment

slightly less than half of the 2", tarsus of male foreleg terminally tapered and downturned. A combination

of the following nuclear genomic base pairs is diagnostic: cce54422.3.2:C373T, cce993.15.2:A922T,

cce303329.2.7:A2399C, cce2502.15.1:A320C, cce5483.2.11:T370A.

Genera included. Only the type genus.

Parent Taxon. Tribe Oxylidini Eliot, 1973.

Cupidopsina Grishin, new subtribe

http://zoobank.org/8AFD9453-3743-4ECB-BA87-4DAC0A3297FB

Type genus. Cupidopsis Karsch, 1895.

Definition. Confidently placed in the tribe Hypotheclini Eliot, 1973, the lineage with Cupidopsis (type

species Lycaena jobates Hopffer, 1855) is genetically differentiated from the Hypothecla Semper, 1890

lineage at the tree level of subtribes (Fig. 22) and therefore represents a subtribe. This new subtribe is

diagnosed by a combination of the following characters as given for the Cupidopsis section by Eliot

(1973): only 10 veins on the forewing, secondary sexual characters absent, aedeagus with developed

coecum and ductus entrance on dorsal side, saccus smaller than in relatives, nearly vestigial, tegumen

with uncus comparatively massive, the same length as valva in lateral view. A combination of the

following nuclear genomic base pairs is diagnostic: cce9377.2.3:A136T, cce4053.12.2:A3235C, cce332.21.

2:G117T, cce199. 20.2:A244C, cce3203.9.2:A172C.

Genera included. Only the type genus.

Parent Taxon. Tribe Hypotheclini Eliot, 1973.

Comments. A family-group name formed from the same genus was proposed as a nomen nudum (fails

ICZN Art. 13.) by Kogak (1996). The genomic tree demonstrates that this subtribe (as other Hypotheclin1)

belongs to Polyommatinae Swainson, 1827 (Figs. 20, 22), contrary to the hypothesis of Stradomsky

(2016), who nevertheless correctly associated Cupidopsis with Hypothecla.

Niphandina Sibatani & Ito, 1942 is a subtribe

In agreement with Stradomsky (2016), we find that Niphandini Sibatani & Ito, 1942 clusters closely with

Polyommatini Swainson, 1827, being at the tree level with subtribes (Fig. 22). Therefore, we confirm its

treatment as a subtribe Niphandina Sibatani & Ito, 1942, stat. conf.

Theclinesthina Grishin, new subtribe

http://zoobank. org/32E65 13 1-DDFB-4EBC-BE37-4F42E8F5F6D3

Type genus. 7heclinesthes Rober, 1891.

Definition. The clade with Theclinesthes (type species Plebeius (Theclinesthes) eremicola Rober, 1891,

which is a junior subjective synonym of Nacaduba miskini gaura Doherty, 1891) originates near the base

of Polyommatini Swainson, 1827 (Fig. 22) and therefore represents a subtribe. This new subtribe is

diagnosed by a combination of the following characters, as given for the Theclinesthes section by Eliot

(1973) and Stradomsky (2016): uncus lobes and (vestigial) falces directed ventrad, vinculum in lateral

view much broader than in relatives, as broad as valva, aedeagus basally bulbous and apically tapered,

ductus enters at anterior end, valva constricted in the middle. A combination of the following nuclear

genomic base pairs is diagnostic: cce2737.15.2:A259G, cce3516.7.8:A98T, cce10374.3.2:A67C, cce2234.8.

11:G1960A, cce2399.18.8:A86G.

Genera included. The type genus (1.e., Theclinesthes R6ber, 1891), Neolucia G. Waterhouse & Turner,

1905, and Sahulana Hirowatari, 1992.

Parent Taxon. Tribe Polyommatini Swainson, 1827.

Comment. The same name was published in a pioneering study by Stradomsky (2016) without explicitly

indicating that the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus

of this taxon was (fails ICZN Art. 16.2.). This name for the subtribe already discovered by Stradomsky

and confirmed by our genomic analysis is simply formalized here to comply with the ICZN Code ICZN

[International Commission on Zoological Nomenclature] 1999).

Azanina Grishin, new subtribe

http://zoobank. org/DF55B888-23ED-4B2E-94F9-B 1 B6685CBDA3

Type genus. Azanus F. Moore, 1881.

Definition. Azanus (type species Papilio ubaldus Stoll, 1782) is confidently placed in a clade of

Polyommatini Swainson, 1827 containing several subtribes, not confidently grouping with any of them

(Fig. 22). Therefore, the lineage with Azanus represents a subtribe. This new subtribe is diagnosed by a

combination of the following characters, as given for the Azanus section by Eliot (1973): male genitalia

elongated and flattened, uncus narrowly divided into separate lobes, forewings veins SC and R; come

together and then diverge, androconia of two unusual types: nearly rectangular scales with concave bases

and long padded scales, eyes hairy, ventral forewing with a dark streak below SC vein. A combination of

the following nuclear genomic base pairs is diagnostic: cce9549.2.2:A815G, cce302383.7.1:TI1I53A,

cce302383.7.1:C1154G, cce2510.1.2:A686G, ccel178.15.6:A356G.

Genera included. Only the type genus.

Parent Taxon. Tribe Polyommatini Swainson, 1827.

Comment. The same name was proposed as a nomen nudum (fails ICZN Art. 13.) by Kocgak (1996) and

then published in a pioneering study by Stradomsky (2016) without explicitly indicating that the name

was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus of this taxon was (fails

ICZN Art. 16.2.). This name for the subtribe already discovered by Kocgak and Stradomsky and confirmed

by our genomic analysis is simply formalized here to comply with the ICZN Code (ICZN [International

Commission on Zoological Nomenclature] 1999).

Unina Grishin, new subtribe

http://zoobank.org/2FD670E6-5ECD-404E-A 1F7-842AEF97335C

Type genus. Una Nicéville, 1890.

Definition. Una (type species Zizera? usta Distant, 1886) is confidently placed in the clade of Polyom-

matini Swainson, 1827 with several subtribes, not confidently grouping with any of them (Fig. 22).

Therefore, the lineage with Jonolyce represents a subtribe. This new subtribe is a union of the Una and

Petrelaea sections of Eliot (1973), who listed characters for them, and is diagnosed as follows: male

genitalia elongated and appear flattened, with gracile and long aedeagus and prominent saccus (absent in

close relatives); forewings with 11 veins, veins SC and Rj fuse at least for some distance. A combination

of the following nuclear genomic base pairs is diagnostic: ccel0730.5.6:A179T, cce7658.4.3:A184G,

cce4822.3.3:A98T, cce5018.4.1:A78G, cce870.7.1:G452A.

Genera included. The type genus (1.e., Una Nicéville, 1890), Orthomiella Nicéville, 1890, Petrelaea

Toxopeus, 1929, and Pseudonacaduba Stempffer, 1942.

Parent Taxon. Tribe Polyommatini Swainson, 1827.

Comment. The same name was proposed as a nomen nudum (fails ICZN Art. 13.) by Kocak & Seven

(1997).

Ionolycina Grishin, new subtribe

http://zoobank.org/7708 IBED-FF23-424A-98B3-54 LEO4BA53E5

Type genus. /onolyce Toxopeus, 1929.

Definition. Jonolyce (type species Ionolyce helicon javanica Toxopeus, 1929) is confidently placed in the

clade of Polyommatini Swainson, 1827 with several subtribes, not confidently grouping with any of them

(Fig. 22). Therefore, the lineage with Jonolyce represents a subtribe. This new subtribe is diagnosed by a

combination of the following characters, as given for Jonolyce by Tite (1963): cornuti in aedeagus are

large and spine-like, ribs in androconial scales are ribbon-like with nodular irregularities mainly in the

posterior third of the scale; fused part of veins SC and Rj is typically longer than in relatives, and the free

end of vein SC is faint. A combination of the following nuclear genomic base pairs is diagnostic:

cce437.15.1:A182G, cce303334.4.2:C106G, cce3111.1.6:A86G, cce3368.2.2:T241A, cce29649.12.1:A151G.

Genera included. The type genus (i.e., Jonolyce Toxopeus, 1929) and Paraduba Bethune-Baker, 1906.

Parent Taxon. Tribe Polyommatini Swainson, 1827.

Pithecopina Grishin, new subtribe

http://zoobank.org/3 ESE4A9A-64A9-4AFC-85DD-81B13BES53FBE

Type genus. Pithecops Horsfield, 1828.

Definition. The clade with Pithecops (type species Pithecops hylax corax Fruhstorfer, 1919, which is a

subspecies of Pithecops corvus Fruhstorfer, 1919) is confidently placed as sister to the “crown group” of

Polyommatini Swainson, 1827 that undergoes extensive diversification (Fig. 22), and we include it in the

“crown group” despite its unusual wing patterns. The Pithecops clade does not have close relatives within

Polyommatini and, therefore, represents a subtribe. This new subtribe is diagnosed by a combination of

the following characters, as given for the Pithecops section by Eliot (1973): male genitalia elongated and

appear flattened, uncus broadly divided nearly to its base, secondary sexual characters absent, veins SC

and R; fuse at least for some distance, eyes not hairy, palpi hairy. A combination of the following nuclear

genomic base pairs is diagnostic: cce59502.1.2:A118G, cce1246.19.3:A71G, cce9990.6.1:G740A, cce1317.

1.1:C772T, cce3516.4.2:G83T.

Genera included. Only the type genus.

Parent Taxon. Tribe Polyommatini Swainson, 1827.

Comment. The same name was published in a pioneering study by Stradomsky (2016) without explicitly

indicating that the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus

of this taxon was (fails ICZN Art. 16.2.). This name for the taxon already discovered by Stradomsky and

confirmed by our genomic analysis is simply formalized here to comply with the ICZN Code (ICZN

[International Commission on Zoological Nomenclature] 1999).

Zizulina Grishin, new subtribe

http://zoobank.org/A230CCD 1-B083-4025-8B78-A3 1A89478932

Type genus. Zizu/a Chapman, 1910.

Definition. The lineage with Zizula (type species Lycaena gaika Trimen, 1862, which is a junior

subjective synonym of Papilio hylax Fabricius, 1775) is a confident sister to Brephidiina Stempffer, 1957,

but is at the tree level that corresponds to subtribes in the “crown group” of Polyommatini Swainson,

1827 (Fig. 22) and therefore represents a subtribe. This new subtribe is diagnosed by a combination of the

following characters, as given for the Zizula section by Eliot (1973): male genitalia unusual, aedeagus

stout and terminally divided into two processes of about half of its length, dorsal and ventral, together

resembling a beak, valva with a rod-like process of about the same length as genitalia and long bristles

twice of valval length, veins SC and Ri fused towards costa, secondary sexual characters absent. A

combination of the following nuclear genomic base pairs is diagnostic: cce993.15.2:A161G, cce993.15.2:

T162C, cce811.10.3:A2207G, cce811.10.3:T2197C, ccel162.15.2:TISIA.

Genera included. Only the type genus.

Parent Taxon. Tribe Polyommatini Swainson, 1827.

Comment. The same name was proposed as a nomen nudum (fails ICZN Art. 13.) by Kocak (1996) and

then published in a pioneering study by Stradomsky (2016) without explicitly indicating that the name

was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus of this taxon was (fails

ICZN Art. 16.2.). This name for the subtribe already discovered by Kogak and Stradomsky and confirmed

by our genomic analysis is simply formalized here to comply with the ICZN Code (ICZN [International

Commission on Zoological Nomenclature] 1999).

Jamidina Grishin, new subtribe

http://zoobank. org/F3E26669-CDF0-4EFC-9539-F88A3D47B1F7

Type genus. Jamides Hubner, [1819].

Definition. The lineage with Jamides (type species Papilio bochus Stoll, 1782) is a confident sister to

Celastrinina Tutt, 1907, but splits from the latter at the tree level of subtribes (Fig. 22), thus representing a

subtribe. This new subtribe is diagnosed by a combination of the following characters, as given for the

Jamides section by Eliot (1973): male genitalia with vinculum lacking cephalad expansion, uncus directed

ventrad, falces very long (nearly half of valva length), aedeagus longer than valva (usually by a third or

more), valva deeply bilobed; forewing veins SC and R: are not fused for any distance, but connected with

a short cross-vein. A combination of the following nuclear genomic base pairs is diagnostic: cce23510.3.2:

T93C, cce23510.3.2:A432G, cce1568.2.4:A5519G, cce1568.2.4:A6856C, cce10823.2.3:T258C.

Genera included. Only the type genus.

Parent Taxon. Tribe Polyommatini Swainson, 1827.

Comment. The same name was proposed as a nomen nudum (fails ICZN Art. 13.) by Kocak (1996) and

then published in a pioneering study by Stradomsky (2016) without explicitly indicating that the name

was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus of this taxon was (fails

ICZN Art. 16.2.). This name for the subtribe already discovered by Kocgak and Stradomsky and confirmed

by our genomic analysis is simply formalized here to comply with the ICZN Code (ICZN [International

Commission on Zoological Nomenclature] 1999).

Fameganina Grishin, new subtribe

http://zoobank.org/07D24435-1EAD-4C80-9350-0A 1FA6003972

Type genus. Famegana Eliot, 1973.

Definition. The lineage with Famegana (type species Lycaena alsulus Herrich-Schaffer, 1869, which is a

junior subjective synonym of Lycaena nisa Wallace, 1866) is sister to Zizeeriina Chapman, 1910 with

moderate confidence (Fig. 22). Because the confidence of this grouping is not the highest and because this

lineage originates at the tree level of subtribes, it represents a subtribe. This new subtribe is diagnosed by

a combination of the following characters, as given for the Famegana section by Eliot (1973): in male

genitalia, tegumen and uncus bulky, falces stout and nearly rigidly connected, uncus lobes terminally

pointed and slightly downturned; veins SC and Rj touch each other over a short distance, eyes not hairy,

palpi with bristles. A combination of the following nuclear genomic base pairs is diagnostic: cce1088.12.

3:A100T, cce1088.12.3:G102A, cce18.45.4:G1256T, ccel8.45.4:G1255A, cce10490.1.2:T1933A.

Genera included. Only the type genus.

Parent Taxon. Tribe Polyommatini Swainson, 1827.

Comment. The same name was proposed as a nomen nudum (fails ICZN Art. 13.) by Kocak & Seven

(1997) and then published in a pioneering study by Stradomsky (2016) without explicitly indicating that

the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus of this taxon

was (fails ICZN Art. 16.2.). This name for the subtribe already discovered by Kocak& Seven and

Stradomsky and confirmed by our genomic analysis is simply formalized here to comply with the ICZN

Code (ICZN [International Commission on Zoological Nomenclature] 1999).

Oboroniina Grishin, new subtribe

http://zoobank.org/FB96541D-672A-41A6-9C47-2EDAADECOD60

Type genus. Oboronia Karsch, 1893.

Definition. The clade with Oboronia (type species Oboronia staudingeri Hemming, 1960, which is a

junior subjective synonym of Plebeius punctatus Dewitz, 1879) is placed within the “crown group” of

Polyommatini Swainson, 1827 without strongly supported phylogenetic affinity to any subtribe (Fig. 22)

and therefore represents a subtribe of its own. This new subtribe is diagnosed by a combination of the

following characters, as given for the Euchrysops section by Eliot (1973): male genitalia with long falces,

vinculum broadening in the middle in lateral view, long and narrow valva, massive rod-shaped aedeagus

with anterior ductus entrance; veins SC and Ri: not fused. A combination of the following nuclear

genomic base pairs is diagnostic: cce349.2.1:C166A, cce349.2.1:A167T, cce935.8.2:A66G, cce2073.8.1:

A230G, cce178.15.6:A190G.

Genera included. The type genus (i.e., Oboronia Karsch, 1893), Euchrysops Butler, 1900, Lepidochrys-

ops Hedicke, 1923, Orachrysops Vari, 1986, and Thermoniphas Karsch, 1895.

Parent Taxon. Tribe Polyommatini Swainson, 1827.

Comment. The same name was published in a pioneering study by Stradomsky (2016) without explicitly

indicating that the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus

of this taxon was (fails ICZN Art. 16.2.). This name for the subtribe already discovered by Stradomsky

and confirmed by our genomic analysis is simply formalized here to comply with the ICZN Code ICZN

[International Commission on Zoological Nomenclature] 1999).

Uranothaumatina Grishin, new subtribe

http://zoobank. org/57D2B8F3-36FA-4457-88B2-FCIJDADC2EF8

Type genus. Uranothauma Butler, 1895.

Definition. The lineage with Uranothauma (type species Uranothauma crawshayi Butler, 1895) is

confidently placed as sister to Scolitantidina Tutt, 1907 (Fig. 22), but it was not traditionally included in

the latter subtribe. Additionally, because it originates at the tree level corresponding to subtribes, it

represents a subtribe. This new subtribe is a union of the Uranothauma and Phlyaria sections of Eliot

(1973), who listed characters for them, and is diagnosed as follows (see also Stradomsky (2016) for

genitalia illustrations): in male genitalia, saccus absent, falces developed, as long as tegumen with uncus,

vinculum expanded in the middle in lateral view, aedeagus shorter than valva, rod-shaped with ductus

entrance dorso-cephalad, valva elongated, undivided; veins SC and Ri touch each other or fuse at least for

some distance, eyes hairy, palpi hairy or bristly. A combination of the following nuclear genomic base

pairs is diagnostic: cce993.29.2:A515G, ccel03.22.12:A47G, cce462.35.1:G193T, cce912.1.1:C56A,

ccel 162.12.1:G739A.

Genera included. The type genus (i.e., Uranothauma Butler, 1895) and Phlyaria Karsch, 1895.

Parent Taxon. Tribe Polyommatini Swainson, 1827.

Comment. The same name was published in a pioneering study by Stradomsky (2016) without explicitly

indicating that the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus

of this taxon was (fails ICZN Art. 16.2.). This name for the subtribe already discovered by Stradomsky

and confirmed by our genomic analysis is simply formalized here to comply with the ICZN Code ICZN

[International Commission on Zoological Nomenclature] 1999).

Higher classification of Lycaenidae to the subtribal level

Based on our genome-scale phylogeny (Figs. 20-22) complemented with other studies (Talavera et al.

2012; Boyle et al. 2015; Robbins et al. 2022; Boyle et al. 2023; Kawahara et al. 2023), we propose the

following provisional classification of Lycaenidae into subfamilies, tribes, and subtribes. We partition the

family into eight subfamilies. If no tribes and subtribes are listed for a subfamily, we consider that

subfamily to be monotypic. If no subtribes are listed for a tribe, we consider that tribe to be monotypic.

The type genus name for each taxon is given in parentheses. New taxa and status changes are shown in

red font. Synonymy ts not provided.

Family Lycaenidae [Leach], [1815] (Lycaena [Fabricius], 1807)

Subfamily Curetinae Distant, 1884 (Curetis Hiibner, [1819])

Subfamily Liphyrinae Doherty, 1889 (Liphyra Westwood, [1864]), stat. rest.

Subfamily Miletinae Reuter, 1896 (Miletus Hiibner, [1819])

Tribe Lachnocnemini Clench, 1955 (Lachnocnema Trimen, 1887)

Tribe Miletini Reuter, 1896 (Miletus Hubner, [1819])

Subtribe Miletina Reuter, 1896 (Miletus Hubner, [1819])

Subtribe Megalopalpina Grishin, subtrib. n. (Megalopalpus Rober, 1886)

Tribe Spalgini Toxopeus, 1929 (Spalgis F. Moore, 1879)

Subtribe Spalgina Toxopeus, 1929 (Spalgis F. Moore, 1879)

Subtribe Tarakina Eliot, 1973, stat. rev. (Taraka Doherty, 1889)

Subfamily Poritiinae Doherty, 1886 (Poritia F. Moore, [1866])

Tribe Liptenini Rober, 1892 (Liptena Westwood, [1851 ])

Subtribe Durbaniina Clench, 1955 (Durbania Trimen, 1862)

Subtribe Pentilina Aurivillius, 1914 (Pentila Westwood, [1851])

Subtribe Liptenina Rober, 1892 (Liptena Westwood, [1851]); includes Mimacraeina Stempffer, 1961

Subtribe Iridanina Clench, 1965 U/ridana Aurivillius, 1920)

Subtribe Epitolina Jackson, 1962 (Epitola Westwood, [1851])

Subtribe Cooksoniina Safian, Boyle & Pierce, 2023 (Cooksonia H. H. Druce, 1905)

Tribe Poritiini Doherty, 1886 (Poritia F. Moore, [1866])

Subfamily Aphnaeinae Distant, 1884 (Aphnaeus Hiibner, [1819]); not monophyletic with Theclinae!

Tribe Axiocersini Grishin, trib. n. (Axiocerses Hubner, [1819])

Tribe Cigaritini Grishin, trib. n. (Cigaritis Donzel, 1848)

Subtribe Pseudaletidina Grishin, subtrib. n. (Pseudaletis H. H. Druce, 1888)

Subtribe Cigaritina Grishin (Cigaritis Donzel, 1848)

Tribe Aphnaeini Distant, 1884 (Aphnaeus Hubner, [1819])

Subtribe Aloeidina Grishin, subtrib. n. (A/oeides Hubner, [1819])

Subtribe Phasisina Grishin, subtrib. n. (Phasis Hubner, [1819])

Subtribe Aphnaeina Distant, 1884 (Aphnaeus Hubner, [1819])

Subfamily Lycaeninae [Leach], [1815] (Lycaena [Fabricius], 1807)

Subfamily Theclinae Swainson, 1830 (Thecla [Fabricius], 1807)

Tribe Theclini Swainson, 1830 (Thecla [Fabricius], 1807)

Tribe Surendrini Kocak & Seven, 1997, stat. nov. (Surendra F. Moore, 1879)

Tribe Arhopalini Bingham, 1907 (Arhopala Boisduval, 1832)

Tribe Drinini Grishin, trib. n. (Drina Nicéville, 1890)

Tribe Candalidini Eliot, 1973 (Candalides Hubner, [1819])

Tribe Hypochrysopini Grishin, trib. n. (Hypochrysops C. Felder & R. Felder, 1860)

Tribe Luciini Waterhouse & Lyell, 1914 (Lucia W. Swainson, 1833)

Tribe Ogyrini Waterhouse & Lyell, 1914 (Ogyris Angas, 1847)

Tribe Jalmenini Grishin, trib. n. (Ja/menus Hubner, 1818)

Tribe Pseudalmenini Grishin, trib. n. (Pseudalmenus H. H. Druce, 1902)

Tribe Amblypodiini Doherty, 1886 (Amblypodia Horsfield, 1829)

Tribe Myrinini Toxopeus, 1929, stat. nov. (Myrina [Fabricius], 1807)

Tribe Cheritrini Swinhoe, 1910 (Cheritra F. Moore, 1881)

Subtribe Cheritrina Swinhoe, 1910 (Cheritra F. Moore, 1881)

Subtribe Horagina Swinhoe, 1910, stat. nov. (Horaga F. Moore, 1881)

Subtribe Loxurina Swinhoe, 1910, stat. nov. (Loxura Horsfield, [1829])

Tribe Iolaini Riley, 1958 (Jo/aus Hubner, [1819])

Tribe Catapaecilmatini Eliot, 1973 (Catapaecilma Butler, 1879)

Tribe Zesiusini Swinhoe, 1912 (Zesius Hubner, [1819])

Tribe Tomarini Eliot, 1973 (Tomares Rambur, 1840)

Tribe Rapalini Grishin, trib. n. (Rapala F. Moore, 1881)

Subtribe Rapalina Grishin (Rapala F. Moore, 1881)

Subtribe Pilodeudorigina Grishin, subtrib. n. (Pilodeudorix H. H. Druce, 1891)

Tribe Deudorigini Doherty, 1886 (Deudorix Hewitson, 1863)

Tribe Eumaeini Doubleday, 1847 (Eumaeus Hubner, [1819])

Subtribe Eumaeina Doubleday, 1847 (Eumaeus Hubner, [1819])

Subtribe Rhammina Prieto & Busby, 2022 (Rhamma K. Johnson, 1992)

Subtribe Timaetina Busby & Prieto, 2022 (Timaeta K. Johnson, Kruse & Kroenlein, 1997)

Subtribe Atlidina Martins & Duarte, 2022 (Atlides Hubner, [1819])

Subtribe Evenina Faynel & Grishin, 2022 (Evenus Hubner, [1819])

Subtribe Jantheclina Robbins & Faynel, 2022 (Janthecla Robbins & Venables, 1991)

Subtribe Paiwarriina Lamas & Robbins,2022 (Paiwarria Kaye, 1904)

Subtribe Cupatheclina Lamas & Grishin, 2022 (Cupathecla Balint, 2005)

Subtribe Parrhasiina Busby & Robbins, 2022 (Parrhasius Hubner, [1819])

Subtribe Ipideclina Martins & Grishin, 2022 (Ipidecla Dyar, 1916)

Subtribe Calycopidina Duarte & Robbins, 2010 (Calycopis Scudder, 1876)

Subtribe Strymonina Tutt, 1907 (Strymon Hubner, 1818)

Subtribe Strephonotina K. Johnson, Austin, Le Crom & Salazar, 1997 (Strephonota K. Johnson et al., 1997)

Subtribe Trichonidina Duarte & Faynel, 2022 (Trichonis Hewitson, 1865)

Subtribe Callophryidina Tutt, 1907 (Callophrys Billberg, 1820)

Subfamily Polyommatinae Swainson, 1827 (Polyommatus Latreille, 1804)

Tribe Oxylidini Eliot, 1973 (Oxylides Hubner, [1819])

Subtribe Oxylidina Eliot, 1973 (Oxylides Hubner, [1819])

Subtribe Hemiolaina Grishin, subtrib. n. (Hemiol/aus Aurivillius, 1922)

Tribe Remelanini Eliot, 1973 (Remelana F. Moore, 1884)

Tribe Hypolycaenini Swinhoe, 1910 (Hypolycaena C. Felder & R. Felder, 1862)

Tribe Lycaenesthini Toxopeus, 1929 (Lycaenesthes F. Moore, 1866)

Tribe Hypotheclini Eliot, 1973 (Hypothecla G. Semper, 1890)

Subtribe Hypotheclina Eliot, 1973 (Hypothecla G. Semper, 1890)

Subtribe Cupidopsina Grishin, subtrib. n. (Cupidopsis Karsch, 1895)

Tribe Polyommatini Swainson, 1827 (Polyommatus Latreille, 1804)

Subtribe Niphandina Sibatani & Ito, 1942, stat. conf. (Niphanda F. Moore, 1875)

Subtribe Theclinesthina Grishin, subtrib. n. (Theclinesthes Rober, 1891)

Subtribe Azanina Grishin, subtrib. n. (Azanus F. Moore, 1881)

Subtribe Unina Grishin, subtrib. n. (Una Nicéville, 1890)

Subtribe Danina Ko¢ak & Seven, 1997 (Danis [Fabricius], 1807)

Subtribe Ionolycina Grishin, subtrib. n. (Jonolyce Toxopeus, 1929)

Subtribe Pithecopina Grishin, subtrib. n. (Pithecops Horsfield, 1828)

Subtribe Zizulina Grishin, subtrib. n. (Zizu/a Chapman, 1910)

Subtribe Brephidiina Stempffer, 1957 (Brephidium Scudder, 1876)

Subtribe Celastrinina Tutt, 1907 (Celastrina Tutt, 1906)

Subtribe Jamidina Grishin, subtrib. n. (Jamides Hubner, [1819])

Subtribe Zizeeriina Chapman, 1910 (Zizeeria Chapman, 1910)

Subtribe Fameganina Grishin, subtrib. n. (Famegana Eliot, 1973)

Subtribe Catochrysopina Toxopeus, 1929 (Catochrysops Boisduval, 1832)

Subtribe Oborontina Grishin, subtrib. n. (Oboronia Karsch, 1893)

Subtribe Castaliina Distant, 1884 (Castalius Hubner, [1819])

Subtribe Scolitantidina Tutt, 1907 (Scolitantides Hubner, [1819])

Subtribe Uranothaumatina Grishin, subtrib. n. (Uranothauma Butler, 1895)

Subtribe Actizerina Kogak, 1996 (Actizera Chapman, 1910)

Subtribe Leptotina Wagener, 1995 (Leptotes Scudder, 1876)

Subtribe Lampidina Tutt, 1907 (Lampides Hubner, [1819])

Subtribe Everina Tutt, 1907 (Everes Hubner, [1819])

Subtribe Polyommatina Swainson, 1827 (Polyommatus Latreille, 1804)

Our classification of Polyommatini Swainson, 1827

compared to that by Stradomsky (2016)

In his pioneering work based on limited DNA sequence data and careful genitalic comparison,

Stradomsky (2016) proposed to partition the tribe Polyommatini into 22 subtribes. Stradomsky’s

classification fares well compared to our genomic results (see above), and his study is impressive in its

insight. Out of our 23 subtribes, 20 match Stradomsky’s in names, and one, Celastrinina Tutt, 1907, was

referred to by its junior subjective synonym, Lycaenopsina Swinhoe, 1910. The remaining two subtribes,

Ionolycina subtrib. n. and Unina subtrib. n., were placed by Stradomsky into his Danina Kocak &

Seven, 1997 and “Azanina,” respectively. Una Nicéville, 1890 cannot belong to “Azanina,” because it is

in the clade with Danis [Fabricius], 1807 and not with Azanus F. Moore, 1881 (see Fig. 22 and Kawahara

et al. (2023)). While it is indeed possible to unify these four groups into a single subtribe, Danina, genetic

differentiation within this subtribe would be larger than in other subtribes in Polyommatini (Fig. 22).

Therefore, dividing the group into four subtribes brings the classification in line with the genetic

differentiation within other Polyommatini subtribes. Finally, Stradomsky’s “Cacyreina” is merged into

our Lampidina Tutt, 1907 due to genetic similarities, and Stradomsky’s phylogeny based on a small

number of gene markers is poorly supported around these taxa. We put names of subtribes used by

Stradomsky in quotes because they were proposed somewhat informally: authorship of previously

published names was not indicated, and for the names we could not find in previous publications,

Stradomsky did not explicitly indicate that they were intentionally new (fails ICZN Art. 16.1.) and did not

specify what their type genera were (fails ICZN Art. 16.2.). Moreover, it remains unclear from the text of

his article which names Stradomsky considered new in the sense of the ICZN Code (if any) and if he

intended to propose new ICZN-compliant names in his work.

Paralycaeides Nabokov, 1945 is a subgenus of /tylos Draudt, 1921

and Eldoradina Balletto, 1993 of Nabokovia Hemming, 1960

Inspection of genomic trees reveals that two pairs of Pseudochrysops bornoi]22037G05|DR|1981

: 1 ; Itylos moza|22028E03|Bolivia|1949

eenkta: (1) Itylos Draudt, 1921 (type aReett> Cupido ° Itylos pacis|22076C08|Peru:Arequipa|2009

speciosa Staudinger, 1894, which is a junior sear a ed teat

subjective synonym of Lycaena titicaca Weymer, oe aralycaeides inconspicua|22028E08|Perulold

1890 : k Paralycaeides vapa|22028E09|Bolivia|1954

) and Paralycaeides Nabo OV, 1945 (type Pseudolucia chilensis|22028E05|Chile|1954

‘ . . Pseudolucia andina|22075G04|Chile|1993

species Itylos LNCONSPICUua Draudt, 1921) and (2) ) Pseudolucia vera|22075F 10|Chile|1990

; i 1 Pseudolucia collina|22075F12|Chile|1991

Nabokovia Hemming, 1960 (type species Thecla faga Pseudolucia plumbea|22076C04|Chile|1993

1 j abokovia ada|22028C07|Chile|1952

Dognin, 1895 and Eldoradina Balletto, 1993 (type | ig ooene le Sal soapacoeceusiee?

species Nabokovia (Eldoradina) cyanea _ Balletto, Pieredas satel ea il ate Me z

. a emiargus Ceraunus “HOPKINS CO.

1993) are closely related to each other in each pair Cyclargus thomasi|LEP22359]FL, Monroe Co.

(Fig. 23): COI barcode difference of 5.9%—6% (39-40 | Fig. 23. Nuclear genome tree (autosomes): genus /ty/os

bp) in each pair. Furthermore, at least one genus in (red, subgenus Paralycaeides in magenta) and genus

Nabokovia (blue, subgenus E/doradina in violet color).

each pair consists of a small number of species.

Therefore, we propose to treat the junior name in each pair as a subgenus name: Paralycaeides Nabokov,

1945 of Jtylos Draudt, 1921 and Eldoradina Balletto, 1993 of Nabokovia Hemming, 1960.

Shijimia Matsumura, 1919 is confirmed as a valid genus

with Shijimia potanini Alphéraky, 1889, new combination

Genomic sequencing and analysis of representatives of the subtribe Everina Tutt, 1907 (type genus Everes

Hiibner, [1819])) reveals that Shijimia Matsumura, 1919 (type species Lycaena moorei Leech, 1889) may

not be monophyletic with Cupido Schrank, 1801 (type species Papilio minimus Fuessly, 1775) and

instead may be sister to Bothrinia Chapman, 1909 (type

. we Ee CF ee: A Cupido minimus|20058D07|Denmark|2006

species Cyaniris chennellii de Nicéville, [1884]) (Fig. Cupido argiades|22027E 10|Italy|1960

*“Cupido comyntas|3506|USA:TX,Hardin Co.|2015

24), confirming that it is meaningful to treat Shijimia as Silt meee ase ede ene cu tn eae

anal gre cuUS: Hy exsed Ucn e cd: ONG, Clete tw OsSyntypes ice “Frbolitinia nebulosala20270 1o|china: Sichuan [1929

Everes umbriel Doherty, 1889 (type locality Tenasserim a pororiniaic Hens lezas oe Myaninetle og)

Valley) currently treated as a junior subjective synonym “Tongeis fischeri|22027D09|Korea|1910

(or subspecies) of Lycaena potanini Alphéraky, 1889 ie Falicada nyseus|22027E01|no datalold

Thy Karyce cogina|22038B08|Brazil:SP|1991

kalyce cogina|22038B09|Brazil:SP|1995

(type locality in China: Gansu Province) in the genus

Tongeia Tutt, 1908 (type species Lycaena fischeri | Fig. 24. Nuclear genome tree (autosomes) of Everina

Eversmann, 1843), and found that it is not monophyletic a alae eae a Pa ee ae Ged),

with Tongeia fischeri, but is closely related to Shijimia

Matsumura, 1919 (type species Lycaena moorei Leech, 1889) (Fig. 24). Therefore, we propose a new

combination: Shijimia potanini (Alphéraky, 1889), comb. nov.

Family Hesperiidae Latreille, 1809

Pyrrhochalcia Mabille, 1904 is a subgenus of Coeliades Hiibner, 1818

Although immediately distinguishable by its much larger size, black wings with metallic-green shine (and

broad green streaks in females) above, and shiny cyan-green-olive hindwings beneath, Pyrrhochalcia

Mabille, 1904 (type and the only species Papilio iphis Drury, 1773) was recognized as a close relative of

Coeliades Hiibner, 1818 (type species Papilio forestan Stoll, 1782) by Evans (1937) and placed next to

Pyrrhiades Lindsey & Miller, 1965 (type species Papilio lucagus Cramer, 1777)—currently within

Coeliades—by Chiba (2009) in his key, differing by

the relative positions of vein origins on hindwing.

Moreover, some species of Coeliades are patterned

similarly, although without extensive green coloration

on ventral hindwing: C. /ucagus (Cramer, 1777) and

C. aeschylus (Pl6tz, 1884) (both formerly in

Pyrrhiades). Our genomic tree and recently published

phylogeny (Toussaint et al. 2021) support this close

relationship between Pyrrhochalcia and Coeliades by

placing the former as a close sister of the latter

without prominent separation between them (Fig. 25).

Genetic differentiation within Coeliades even after

sPyrrhochalcia iphis|17108E08|Ivory Coast|1965

ibyrrhochalcia iphis|17112G09|Ghana|1996

Pyrrhochalcia iphis|7873|Nigeria|1960

eee lucagus|17068F09|Ghanalold

tod oeliades anchises|17118E08|Kenya|1939

Coeliades pansa|17118G11|Madagascar|1962

ogc Oeliades rama|17118F02|Madagascar|old

Coeliades forestan|18054H02|Namibia|2002

Coeliades libeon|17118H01|Cameroon|1973

Coeliades keithloa|18096A08|South Africa|old

Coeliades hanno|17118F10|Uganda|1960

Coeliades pisistratus|17118F05|Kenya|1941

) Coeliades fervida|17118G06|Madagascar|1990

Coeliades chalybe|17118H04|Cameroon|1972

Coeliades bixana|18019D05|Nigeria|1972

zg hoaspes stigmata|18028D09|no datalold|

72Choaspes adhara visaya|18093E12|HT|Philippines|1979

oChoaspes benjaminii|21103A11|Sri Lanka|1904

Choaspes illuensis|18096A07|Indonesia:Afrak|old

og - Nhoaspes subcaudata|18028D12|no datalold

Choaspes furcata|18028E02|China:Sichuan|1938

Choaspes xanthopogon|19064E08|Malaysia|1992

Tool ekliades ramanatek|17118G05|Madagascar|1990

Tekliades ramanatek|7871|Madagascar|1990

Fig. 25. Nuclear genome tree (autosomes): genus

Coeliades (blue, with subgenus Pyrrhochalcia

labeled in violet) and genus Choaspes (green).

including Pyrrhochalcia is approximately the same as

that within the genus Choaspes F. Moore, 1881 (type

species Hesperia (Thymele) benjaminii Guérin-

Méneville, 1843) (Fig. 25 blue vs. green). Therefore,

we propose that Pyrrhochalcia Mabille, 1904, stat.

nov. is a subgenus of Coeliades Hiibner, 1818.

Cecropterus (Thorybes) nevada (Scudder, 1872) is restricted to OR, CA, and NV and

Cecropterus (Thorybes) dobra (Evans, 1952) is found eastward in the US

Genomic sequencing of specimens from the northeastern part of the range of the Cecropterus (Thorybes)

mexicana species group that consists of three species: Cecropterus (Thorybes) nevada (Scudder, 1872),

Cecropterus (Thorybes) dobra (Evans, 1952), and Cecropterus (Thorybes) mexicana (Herrich-Schaffer,

1869) reveals that all of them are C. dobra, which is genetically uniform throughout its range (Fig. 26).

Therefore, C. nevada is restricted to the westernmost part of the USA (Oregon, California, and Nevada)

and is separated from C. dobra by a wide gap in its distribution, according to iNaturalist observations

(2023) (Fig. 26).

ar & yet 2 is b

Cecropterus dobra|21089E11|USA:AZ,Coconino Co.|2021

Cecropterus dobra|14114A07|USA:AZ,Coconino Co.|1993

Cecropterus dobra|11395|USA:AZ,Apache Co.|2018

Cecropterus dobra|20102B12|USA:CO,Grand Co.|1995

Cecropterus dobra|11182|USA:NM, Otero Co.|2018

Cecropterus dobra|20045E09|USA:UT,San Juan Co.|2020

Cecropterus dobra|20045E10|USA:UT,San Juan Co.|2020

Cecropterus dobra|20102B04|USA:CO,Mesa Co.|2020

Cecropterus dobra|22101A11|USA:UT, Iron Co.|1977

Cecropterus dobra|22101A12|USA:UT, Garfield Co.|1977

Cecropterus dobra]20102B06|USA:CO,Montrose Co.|1966

Cecropterus dobra|20102B08|USA:CO, Garfield Co.|1975

Cecropterus dobra|20102B10|USA:CO,Gilpin Co.|1990

Cecropterus dobra]20102B11|USA:CO,Clear Creek Co.|1968

Cecropterus dobra|20102B07|USA:CO, Gunnison Co.|1965

Cecropterus dobra|20102B09|USA:CO,Pitkin Co.|1973

Cecropterus dobra|]11263|USA:NM,Bernallilo Co.|2018

Cecropterus dobra|22101A10|USA:NM,San Miguel Co.|1978

Cecropterus dobra|20102B05|USA:CO,Mesa Co.|2020

P| Cecropterus dobra|22101A09|USA:NM,Rio Arriba Co.|1978

Cecropterus nevada aemilea|15024D06|USA:OR,Klamath Co.|1991

Cecropterus nevada aemilea|15024D07|USA:OR,Deuschutes Co.|2001

Cecropterus nevada aemilea|15095F02|ST|USA:OR, Klamath Co.|old

Cecropterus nevada aemilea|15024D08|USA:OR,Deuschutes Co.|2002

Cecropterus nevada blanca|22094A11|USA:CA,Mono Co.|1993

Cecropterus nevada nevada|PAO946|USA:CA, Sierra Co.|2019

Cecropterus nevada blanca|22094A12|USA:CA,Mono Co.|1993

=r Cecropterus nevada nevada|14114A09|USA:CA, Tulare Co.|2003

100 Cecropterus nevada nevada|14114A10|/USA:CA, Tulare Co.|2003

nevada Ti Cecropterus nevada blanca|22101B01|USA:CA,Mono Co.|1977

8 Cecropterus nevada blanca|PAO1152|USA:CA,Mono Co.|2019

Cecropterus nevada blanca|PAO1151|USA:CA,Mono Co.|2019

Cecropterus mexicana mexicana|14112D11|Mexico:SLP|1980

Cecropterus mexicana mexicana|19125B08|Mexico:Hidalgo|1988

Cecropterus mexicana mexicana|14114A12|Mexico:Hid|1981

Cecropterus mexicana mexicana|21115C02|ST|Mexico|old

Cecropterus mexicana mexicana]14114A11|Mexico:Hid|1981

Cecropterus mexicana mexicana|19125B07|Mexico:Col|1981

Cecropterus mexicana mexicana|14114B01|Mexico:O0ax|1986

Cecropterus mexicana mexicana (=ananius)|15032A01|ST|Mexicolold

Cecropterus mexicana mexicana|19125B06|Mexico:Oax|1988

Cecropterus diversus|14114B02|USA:CA,Madera Co.|1993

Cecropterus diversus|17116E02|USA:CA, Tuolumne Co.|1972

Cecropterus diversus|17114A01|USA:CA,Madera Co.|2007

Cecropterus diversus|22101B03|USA:CA,Plumas Co.|1986

Fig. 26. Cecropterus (Thorybes) dobra (blue) and Cecropterus (Thorybes) nevada (red): a) a distribution map made on the

basis of iNaturalist (2023) observations: iNaturalist maps for C. dobra and C. nevada were superimposed and merged in

Photoshop and re-colored (CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/), the map does not refer to

sequenced specimens, records were not checked and some may be misidentifications; b) nuclear genome tree (autosomes)

showing that specimens we sequenced from several localities in Utah, Colorado, New Mexico, and Arizona are C. dobra.

Cecropterus floridianus|22032A08|PT|USA:FL, Franklin Co.|1977

Cecropterus floridianus|22032A08|PT|USA:FL,Franklin Co.|1977

00 Cecropterus floridianus|22032A09|HT|USA:FL,Volusia Co.|1969 €ecropterus floridianus|22032A11|PT|USA:FL, Volusia Co.|1969

c arse Cecropterus floridianus|22032A11|PT|USA:FL, Volusia Co.|1969 Secropterus floridianus|22032A10|PT|USA:FL,Alachua Co.|1973

al 2 Cecropterus floridianus|22032A10|PT|USA:FL,Alachua Co.|1973 Cecropterus floridianus|22032A12|PT|USA:FL,Marion Co.|1988

7) Cecropterus floridianus|20062C06|PT|USA:FL,Levy Co.|1963 ‘éecropterus floridianus|20062C06|PT|USA:FL,Levy Co.|1963

7) F rT; Cecropterus floridianus|22032A07|PT|USA:FL,Dixie Co.|1988 1@becropterus floridianus|22032A09|HT|USA:FL, Volusia Co.|1969

= q Cecropterus floridianus|22032A12|PT|USA:FL,Marion Co.|1988 pe onierus floridianus|22032A07|PT|USA:FL, Dixie Co.|1988

AC) Cecropterus floridianus|22101A01 |PT|USA:FL,Martin Co.|1939 ecropterus floridianus|22101A01|PT|USA:FL,Martin Co.|1939

3S C. pylades (=timmaculata)|15095E09|"HT"|PA, Philadelphia Co.|old Cecropterus pylades|22064H06|Canada:Manitoba|1990

S a Cecropterus pylades|22064H03|Canada:Alberta|1977 ecropterus pylades|22064H04|Canada:Alberta|1977

= pascal PU ReSe SOR IROSICARAAH baci iors reese abe PT indecjonel Usa reMentaGriery. CO DOT?

ecropterus pylades anada:Alberta ecropterus pylades :AR,Montgomery Co.

Cecropterus pylades|22064H04|Canada:Alberta|1977 3%. pylades (=timmaculata)|15095E09|"HT"|PA,Philadelphia Co.

Cecropterus pylades|6022|USA:TX,Wise Co.|2016 4eecropterus pylades|6022|USA:TX,Wise Co.|2016

aa Cecropterus pylades|3313|USA:TX,Sabine Co.|2015 Cecropterus pylades|3313|USA:TX,Sabine Co.|2015

A Cecropterus pylades|8586|USA:OK, Atoka Co.|2017 #Pecropterus pylades|8586|USA:OK,Atoka Co.|2017

o a Cecropterus pylades|4403|USA:TX,Lamar Co.|2015 Cecropterus pylades|4403|USA:TX,Lamar Co.|2015

® Cecropterus pylades|9288|USA:AR,Montgomery Co.|2017 Cecropterus pylades|22064H03|Canada:Alberta|1977

3 Cecropterus indistinctus|22094A07|Canada:BC, Vancouver |.|1958 pees indistinctus|22094A07|Canada:BC, Vancouver |.|1958

= Fi Cecropterus indistinctus|22094A05|Canada:BC, Fitzgerald|1921 ecropterus indistinctus|22094A05|Canada:BC, Fitzgerald|1921

Q. 4 Cecropterus indistinctus|18037D11|USA:CA,SLO Co.|2002 s€ecropterus indistinctus|15024D05|USA:CA,SLO Co.|1994

se Cecropterus indistinctus|15024D03|USA:CA, Alpine Co.|1943 pros indistinctus|PAO35|USA:CA,Monterey Co.|2016

B ; PEM EILEL EA GSCI SRCAMIGH eres Ole. Diego Co.|1964 ecouirus Hap AEH nooueaHarrMenEs SGn neg

ecropterus indistinctus :CA,Monterey Co. ecropterus indistinctus exico:

‘ Cecropterus indistinctus|15024D05|USA:CA,San Luis Obispo Co.|1994 pocorn: indistinctus|17109A08|HT|USA:CA,San Diego Co.|1961

10 See orton teeue wndlsiine uAlezecsHitlikexiee:8C ITObe, Co.|1961 tho eh a indistinctue}is024D0a/ USA. CALAISIne rome alae

ecropterus indistinctus exico: ecropterus indistinctus :CA, Alpine Co.

7) nF Cecropterus rockiensis|22094A09|PT|USA:UT,Salt Lake Co.|1930 Cecropterus rockiensis|20045E08|PT|USA:UT,San Juan Co.|2020

3 - Cecropterus rockiensis|22099H06|PT|USA:UT,Washington Co.|1977 Gecropterus rockiensis|22099H08|PT|USA:UT,Salt Lake Co.|1946

= 5 Cecropterus rockiensis|22099G12|PT|USA:UT, Utah Co.|1947 gba edet rockiensis|22099H06|PT|USA:UT, Washington Co.|1977

3 ROM atc te (densis|22099HOSIPHUSASUT. Utah C ees ae ae Racontinds rocklonsls|22094A09/PTIUSALUT Salt Laks Co 11930

= ecropterus rockiensis :UT,Utah Co. ecropterus rockiensis :UT,Salt Lake Co.

= - Cecropterus rockiensis|22068D07|PT|USA:UT,Beaver Co.|2022 Cecropterus rockiensis|22068D07|PT|USA:UT, Beaver Co.|2022

= S Cecropterus rockiensis|22099H10|PT|USA:UT, Zion NP|1928 Cecropterus rockiensis|22099HO9|PT|USA:UT, Utah Co.|1946

Cecropterus rockiensis|22099HO7|PT|USA:UT,Salt Lake Co.|1967 cropterus rockiensis|22099H05|PT|USA:CO, Eagle Co.|1976

nO ; Cecropterus rockiensis|22064H01|PT|USA:NE,Sioux Co.|1983 gsecropterus rockiensis|22099H0O2|PT|USA:CO, Garfield Co.|1977

ae Cecropterus rockiensis|22064HO02|PT|USA:NE, Sioux Co.|1983 100) Cecropterus rockiensis|22099HO7|PT|USA:UT,Salt Lake Co.|1967

c Cecropterus rockiensis|22099H04|PT|USA:MT, Yellowstone Co.|1948 ecropterus rockiensis|20045E07|PT|USA:UT,San Juan Co.|2016

et of*— Cecropterus rockiensis|8970|PT|USA:NM,Otero Co.|2017 Cecropterus rockiensis|11465|PT|USA:AZ,Apache Co.|2018

7) 8 Cecropterus rockiensis|15099HO9|PT|USA:NM, Lincoln Co.|1981 '€ecropterus rockiensis|21089E12|PT|USA:AZ,Lockett Mdw|2021

Y 7 Cecropterus rockiensis|9057|PT|USA:NM, Otero Co.|2017 ppcreptene rockiensis|22094A02|PT|USA:AZ,Grand Cyn S rim|1942

ec Cecropterus rockiensis|22094A08|PT|USA:CO, Boulder|1953 ecropterus rockiensis|22094A03|PT|USA:AZ,Grand Cyn S rim|1942

eco r i e eastesnosrloshcO.coas O90 Serer eshesoeanasr|USANE Sct Co '36

x 0 ecropterus rockiensis :CO,Eagle Co. ecropterus rockiensis :NE,Sioux Co.

8 Bie Cecropterus rockiensis|20045E07|PT|USA:UT,San Juan Co.|2016 ecropterus rockiensis|22099H04|PT|USA:MT, Yellowstone Co.|1948

4 or 5 f rockionsis|SG0U[PT|USA:NM Sandoval Go:l2017- Co.|1979 ake abo ate aU eA pe cee

ecropterus rockiensis :NM, Sandoval Co. ecropterus rockiensis :NM, Otero Co.

Cecropterus rockiensis|20045E08|PT|USA:UT,San Juan Co.|2020 Gecropterus rockiensis|15099HO9|PT|USA:NM,Lincoln Co.|1981

* Cecropterus rockiensis|22099H02|PT|USA:CO, Garfield Co.|1977 Cecropterus rockiensis|22099H01|PT|USA:CO, Boulder Co.|1954

yr Cecropterus rockiensis|21089E12|/PT|USA:AZ,Lockett Mdw|2021 €ecropterus rockiensis|22064HO1|/PT|USA:NE, Sioux Co.|1983

Cecropterus rockiensis|22094A02|PT|USA:AZ,Grand Cyn S rim|1942 §,ecropterus rockiensis|8970|PT|USA:NM, Otero Co.|2017

7 C. rockiensis|22094A03|PT|USA:AZ,Grand Cyn S rim|1942 Cecropterus rockiensis|22099H03|HT|USA:CO, Jefferson Co.|1979

T Cecropterus rockiensis|11465|PT|USA:AZ,Apache Co.|2018 Cecropterus rockiensis|22094A08|PT|USA:CO, Boulder|1953

Cecropterus rockiensis|18037D10|PT|USA:AZ,Graham Co.|2009 Cecropterus rockiensis|18037D10|PT|USA:AZ,Graham Co.|2009

* p Shes Ge SbOR IIS ATA TE onan Goo boas athe aibosuftusal@6QslUSALAZ, Santa Ceue CO 12017

4 ecropterus albosuffusa :AZ,Santa Cruz Co. ecropterus albosuffusa :AZ,Santa Cruz Co.

y Cecropterus albosuffusa|13386D04|USA:AZ,Cochise Co.|1991 Raha ais albosuffusa|20062C04|USA:AZ,Cochise Co.|1970

TO Cecropterus albosuffusa|12264|USA:AZ,Cochise Co.|2019 Cecropterus albosuffusa|12264|USA:AZ,Cochise Co.|2019

ao Cecropterus albosuffusa|20062C04|USA:AZ,Cochise Co.|1970 bat aoe albosuffusa|19013H07|Mexico:NL|1978

Cecropterus albosuffusa|22099H12|Mexico:Dgo|1988 ecropterus albosuffusa|20062C05|Mexico:NL|1981

z Cecropterus albosuffusa|15104C02|HT|TX,Jeff Davis Co.|1940 ecropterus albosuffusa|22101A04|Mexico:DF|1952

7 Cecropterus albosuffusa|9810|USA:TX,Jeff Davis Co.|2017 ecropterus albosuffusa|22101A05|Mexico:DF|1952

4 100 ; Cecropterus albosuffusa|19013H06|Mexico:Coah|1978 ecropterus albosuffusa|19013H08|Mexico:NL|1978

vi Cecropterus albosuffusa|20062C05|Mexico:NL|1981 stecropterus albosuffusa|22056A04|Mexico:NL|1981

Cecropterus albosuffusa|22056A11|USA:TX,Real Co.|1969 + 100 Gecropterus albosuffusa|21014G02|Mexico:Pue|1991

0 4) 9 a peor Cecropterus albosuffusa|19013H05|Mexico:Coah|1978 Cecropterus albosuffusa|21014G01|Mexico:Pue|1991

8 7 Cecropterus albosuffusa|22056A10|Mexico:Coah|1981 Cecropterus albosuffusa|22099H12|Mexico:Dgo|1988

& ry Cecropterus albosuffusa|19013H08|Mexico:NL|1978 Heceherus albosuffusa|22056A07|Mexico:Coah|1981

3 0 Cecropterus albosuffusa|22101A05|Mexico:DF|1952 ecropterus albosuffusa|9810|USA:TX,Jeff Davis Co.|2017

re) p Cecropterus albosuffusa|22056A04|Mexico:NL|1981 Gecropterus albosuffusa|22056A08|Mexico:Coah|1976

& ‘eer Cecropterus albosuffusa|22056A08|Mexico:Coah|1976 Gecropterus albosuffusa|19013H06|Mexico:Coah|1978

ba G Cecropterus albosuffusa|8378|USA:TX,Blanco Co.|2017 es albosuffusa|8378|USA:TX,Blanco Co.|2017

icc 8 Cecropterus albosuffusa|22101A04|Mexico:DF|1952 ee albosuffusa|15104C02|HT|TX,Jeff Davis Co.|1940

. Cecropterus albosuffusa|19013H0O7|Mexico:NL|1978 cropterus albosuffusa|22056A10|Mexico:Coah|1981

o eT Cecropterus albosuffusa|22056A07|Mexico:Coah|1981 Cecropterus albosuffusa|22056A11|USA:TX,Real Co.|1969

Y ‘ Cecropterus albosuffusa|22101A02|Mexico:NL|1977 Secropterus albosuffusa|19013H05|Mexico:Coah|1978

2 re Cecropterus albosuffusa|21014G02|Mexico:Pue|1991 Cecropterus albosuffusa|22101A02|Mexico:NL|1977

o Cecropterus albosuffusa|21014G01|Mexico:Pue|1991 Cecropterus albosuffusa|13386D04|USA:AZ,Cochise Co.|1991

o Cecropterus oaxacensis|19125BO9|HT|Mexico:Oax|1988 Cecropterus oaxacensis|19125B09|HT|Mexico:0ax|1988

x Cecropterus drusius|14065A10|USA:AZ,Pima Co.|1991 Gecropterus drusius|14065A10|USA:AZ,Pima Co.|1991

S Cecropterus drusius|15097HO7|LT|USA:South AZ|old ef ecropterus drusius|14063A05|USA:AZ,Santa Cruz Co.|1957

Cecropterus drusius|9688|USA:AZ,Santa Cruz Co.|2017 sie ecropterus drusius|15097HO7|LT|USA:South AZ|old

Cecropterus drusius|9656|USA:AZ,Santa Cruz Co.|2017 ecropterus drusius|14063A07|USA:AZ,Santa Cruz Co.|1961

Cecropterus drusius|14063A07|USA:AZ,Santa Cruz Co.|1961

Cecropterus drusius|14063A05|USA:AZ,Santa Cruz Co.|1957

i@ecropterus drusius|9656|USA:AZ,Santa Cruz Co.|2017

Cecropterus drusius|9688|USA:AZ,Santa Cruz Co.|2017

0.007

0.003

Fig. 27. Phylogenetic trees of Cecropterus (Thorybes) pylades species group inferred from protein-coding regions of a) the Z

chromosome (best for species delimitation) and b) the mitochondrial genome. Different species are shown in different colors:

C. floridianus sp. n. (ted), C. pylades (green), C. indistinctus stat. nov. (cyan), C. rockiensis sp. n. (purple), C. albosuffusa

stat. nov. (blue), C. oaxacensis sp. n. (orange), and C. drusius (black). Primary type specimens are labeled in magenta (except

that C. oaxacensis 1s left in orange as the sole representative of its species).

Cecropterus albosuffusa (H. Freeman, 1943) and Cecropterus indistinctus (Austin &

J. Emmel, 1998) are species distinct from Cecropterus pylades (Scudder, 1870)

Genomic comparison of Cecropterus Herrich-Schaffer, 1869 (type species Cecrops zarex Hubner, 1818)

reveals close relationship between Cecropterus (Thorybes) pylades (Scudder, 1870) (type locality in

USA: Massachusetts) and Cecropterus (Thorybes) drusius (W. H. Edwards, [1884]) (type locality in

southern Arizona) that are unified by the presence of costal fold in males (Evans 1955). We regard them

as the C. pylades species group (Fig. 27). Genomic trees (the Z chromosome and the mitogenome)

confirm that C. drusius with its distinctive genitalia (Fig. 30q) is sister to all others but reveal that the

entity currently treated as a single species C. pylades consists of several genetically differentiated clades

(Fig. 27). The Z chromosome (Fig. 27a) and the mitochondrial genome (Fig. 27b) trees show identical

strongly supported topology between the clades (but not within clades, where the subtrees are comb-like

due to genetic similarity and gene exchange) and placement of specimens into them, thus increasing the

confidence in the results due to this uncommon congruence between nuclear and mitochondrial trees.

The extent of genetic differentiation suggests that the clades within C. pylades represent distinct

species (Cong et al. 2019a). We find that Cecropterus pylades albosuffusa (H. Freeman, 1943) (type

locality USA: Texas, Ft. Davis) forms a clade distant from the nominotypical C. pylades with Fs/Gmin of

0.39/0.001 and COI barcode difference of 2.1% (14 bp). Similarly, the westernmost Cecropterus pylades

indistinctus (Austin & J. Emmel, 1998) (type locality in USA: California: San Diego Co.) is separated

from the nominotypical C. pylades with Fst/Gmin of 0.41/0.002 and COI barcode difference of 1.7% (11

bp). Therefore, we propose treating Cecropterus (Thorybes) albosuffusa (H. Freeman, 1943), stat. nov.

and Cecropterus (Thorybes) indistinctus (Austin & J. Emmel, 1998), stat. nov. as species-level taxa, not

subspecies of C. pylades. Hence, no subspecies are recognized in the C. pylades species group.

Furthermore, three additional clades with strong genetic differentiation do not have names and represent

new species. These three new species are described below. Finally, we note that the speciation scenario in

the “crown” subgroup of the C. pylades group consisting of four USA species: Floridian, eastern, west-

coastal, and central (Fig. 27 red, green, cyan, and purple) parallels that of the Erynnis brizo (Boisduval &

Le Conte, [1837]) species group as laid out by Burns (2020).

Cecropterus (Thorybes) rockiensis Grishin, new species

http://zoobank.org/7CC2D85B-497D-4A81-9486-82434CCBE 143

(Figs. 27 part, 28, 29 part, 30k, 1)

Definition and diagnosis. Both the Z chromosome and the mitogenome trees reveal partitioning of

western US populations previously assigned to Cecropterus (Thorybes) pylades (Scudder, 1870) (type

locality in USA: Massachusetts) into two clades: Cecropterus (Thorybes) indistinctus (Austin & J.

Emmel, 1998), stat. nov. (type locality in the USA: California: San Diego Co., holotype sequenced as

NVG-17109A08) and a clade consisting of specimens from and around the Rocky Mountains region in

the US, not associated with any available names (Fig. 27 cyan and purple). The Fst/Gmin between the two

clades are 0.37/0.004, and their COI barcodes differ by 1.1% (7 bp). Therefore, the Rocky Mountains

clade represents a species-level taxon. This new species is generally similar in appearance to its closest

relative, C. indistinctus, in the following combination of characters: stronger checkered fringes (especially

on the forewing), ventral wing surface distally paler gray-brown, but not strongly overscaled with white,

on average smaller hyaline spots, and less rounded forewings; and differs from it by more prominently

checkered fringes, paler ground color, stronger expressed darker framing around (or in place of) hyaline

forewing spots, better defined ventral hindwing bands, typically larger hyaline spots and specimen size. In

male genitalia, uncus arms are thicker and not as widely separated as in C. (Thorybes) albosuffusa (H.

Freeman, 1943), stat. nov. (type locality USA: Texas, Ft. Davis), more angled than rounded at the base

between them; similar to C. pylades and C. indistinctus and differ from them by somewhat wider

Fig. 28. Holotype of Cecropterus (Thorybes) rockiensis sp. n. in dorsal (left) and ventral (right) views, data in text.

separation of uncus arms, rather parallel than

slightly converging distad and usually longer

compared to tegumen than in the other two

Species, a notch between ampulla and harpe is

typically shallower and wider, harpe is longer,

more upcurved. Definitive identification is

provided by DNA, and a combination of the

following characters is diagnostic in nuclear

genome: aly5196.9.2:C9I5T, aly536.8.1:C750T,

aly1259.10.2:A1122G, aly276561.5.1:G2469A,

x ry

aly5021.6.4:A1940G and in the COI barcode:

A217G, T460C, T596C, A637A. J ¥

Barcode sequence of the holotype: Sample ~) | \ 7

NVG-22099H03, GenBank OR578714, 658 a [ Ld

5 » fs ae floridianus

base pairs: \s \ y : ates

AACTTTATATTTTATTTTCGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAG SaaS ane : y

TTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCA

AATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTCTTTATAGT

ATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCCCTTATACTAGG

GGCTCCTGACATAGCTTTTCCTCGTATAAATAATATAAGATTTTGATTATTACC L ., J @ - floridianus sp. 0.

TCCATCTTTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGAGCAGGTAC &, \ V aay \ ery @ - pylades

TGGATGAACTATTTACCCCCCTTTATCTTCTAATATTGCTCATCAAGGAGCTTC SN ae I ee (° > indistinctus stat. n.

AGTAGATTTAGCAATTTTTTCTTTACATCTTGCTGGAATTTCTTCAATTTTAGG ; ik Ye : , < AS : y, % j [0 - rockiensis sp. n.

AGCTATTAATTTTATTACAACTATTATCAATATACGAATTAATAATTTATCATT - at apa oes mi me _ Lv ¥ - albosuffusa stat. n.

TGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCTTTATTACTTTT » ent yy A- oaxacensis sp. Nn.

ACTTTCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAA oN -

CCTAAATACTTCATTTTTTGATCCAGCAGGTGGAGGAGATCCAATTTTATATCA Fig. 29. A map of Paitencedice specimens from the Cecropterus

ACATTTATTT

(Thorybes) pylades group. Different species are shown in different

Type ree Holotype: ¢ deposited 1 in the |symbols of different colors: C. floridianus sp. n. (larger red

California Academy of Sciences, San circles), C. pylades (smaller green circles), C. indistinctus stat.

: : aes: nov. (cyan diamonds), C. rockiensis sp. n. (purple squares), C.

Francisco, CA, USA [CAS], illustrated in Fig. albosuffusa stat. nov. (smaller dark blue downturned triangles),

28, bears six printed (other text but “COLO” |and C. oaxacensis sp. n. (larger orange upturned triangle) and

on the first label is handwritten) labels: five | labeled on the map near their type localities. Type localities for

white [ COLO. V-24-79 | Jefferson Co. | Clear |i names ae insted by fn cles placed inside cymbols,

Cr. Cyn. ], [Ray E. Stanford | collector |, | circle framed with the color of the taxon (for C. pylades only).

| Collection of | C.D.MacNeill ], [DNA

sample ID: | NVG-22099H03 | c/o Nick V. Grishin |, [| {QR Code} CASENT | 8566837 ], and one red

[| HOLOTYPE co | Cecropterus (Thorybes) | rockiensis Grishin ]. Paratypes: 20ch'ch 799: 19 Montana,

Yellowstone Co., Billings, 5-Jun-1948, Neil Euting leg. (NVG-22099H04, CASENT8566838) [CAS];

200 Nebraska, Sioux Co., Monroe Cyn., 6 mi. N of Harrison, 25-Jun-1983, S. M. Spomer leg. (NVG-

22064H01 & HO2); Utah: Salt Lake Co.: 1c Mill Creek Canyon, 28-Jun-1967, C. J. Callaghan leg.

(NVG-22099H07, CASENT8566841) [CAS]; Salt Lake, City Creek Canyon: Ico 15-Jun-1930, Lloyd M.

Martin leg. (NVG-22094A09) [LACM]; 1c 9-Jun-1946, L. I. Hewes leg. (NVG-22099H08, CASENT

8566842) [CAS]; Utah Co.: 1o& Provo Canyon, 14-Jun-1947, William A. Hammer leg. (NVG-22099G12,

CASENT8566834) [CAS]; lo Mt. Timpanogos, 5.6 mi W of Jct. Hwy 189 & 92 on 92, 22-Jul-1946, C.

D. MacNeill leg. (NVG-22099H09, CASENT8566843) [CAS]; 1c& Beaver Co., East Fork Baker Canyon,

SH153, Tushar Mts, N side of Beaver Canyon, larva collected on 1-Jul-2022, eclosed 7-Dec-2022, Todd

Stout leg. (NVG-22068D07); 12 Washington Co., 11-May-1977, D. F. Shillingburg leg. (NVG-

22099H06, CASENT8566840) [CAS]; 12 Zion National Park, 15-Jun-1928, T. Craig leg. (NVG-

22099H10, CASENT8566844) [CAS]; San Juan Co.: 12 La Sal Mts., Pack Creek day use area, 31-May-

2016, Robb Hannawacker leg. (NVG-20045E07); 1c Abajo Mts., Indian Creek trail, el. 6400'-7400'", 8-

May-2020, Robb Hannawacker leg. (NVG-20045E08); Colorado: 1¢& Garfield Co., Glenwood Cyn, el.

6200', 8-Jun-1977, Ray E. Stanford leg. (NVG-22099H02, CASENT8566836) [CAS]; 1c Eagle Co.,

Fryingpan River, 10-Jun-1976, Ray E. Stanford leg. (NVG-22099H05, CASENT8566839) [CAS];

Boulder Co.: 19 Lefthand Canyon, 16-May-1954, Donald Eff leg. (NVG-22099H01, CASENT8566835)

[CAS]; Io Flagstaff Mtn., 15-Jun-1953, Donald Eff leg. (NVG-22094A08) [LACM]; New Mexico: Il¢&

floridianus

Le! 1 MM

floridianus °

aa ~ a

pylades pylades pylades

pylades

indistinctus

Ke) 1mm

rockiensis

—

Fig. 30. Male genitalia of Cecropterus (Thorybes) pylades species group: a—d) C. floridianus sp. n. from USA, FL: a) NVG-

22101A01, paratype, genitalia slide J. W. T. 25-34, data in text [CAS]; b) holotype, data in text; c) and d) from genitalia slides

G11 and G14, respectively, by E. L. Bell, only valvae shown [AMNH]; e-i) C. pylades from USA: e-g) left valva in situ, N. V.

Grishin, leg.: e) TX, Wise Co., LBJ National Grassland, 4-May-2008 and f, g) OK: Murray Co., 5 mi S of Davis, 23-Apr-2008;

h) NVG-9288, AR, Montgomery Co., Ouachita National Forest, 6.5 air mi WNW of Oden, 6-Jul-2017, N. V. Grishin leg.; i)

NJ, from genitalia slide G13 by E. L. Bell, only valvae shown [AMNH]; j) C. indistinctus stat. nov., USA: CA, San Diego Co.,

El Cajon, 28-Apr-1934, Ray Hulbirt leg., genitalia slide J. W. T. 25-36 by J. W. Tilden [CAS]; k,l) C. rockiensis sp. n.

paratypes from USA: k) NVG-11465 from AZ: Apache Co. and 1) NVG-8970 from NM: Otero Co., data in text; m—o) C.

albosuffusa stat. nov.: m, n) Mexico [TMMC]: m) NVG-22056A08, Coahuila, Zaragosa, C. J. Durden leg., 11-Apr-1976,

genitalia vial NVG-22056A09 and n) NVG-22056A04, Nuevo Leon: Galeana, Cerro Potosi, C. J. Durden leg., 25-Jul-1981,

genitalia vial NVG-22056A05; 0) USA: AZ, Santa Rita Mts., 10-Jul-1941, J. W. Tilden leg. and genitalia slide J. W. T. 25-13

[CAS]; p) C. oaxacensis sp. n. holotype from Mexico: Oaxaca, data in text; q) C. drusius USA: AZ, from genitalia slide G47

by E. L. Bell, aedeagus (left) and valva (right) [AMNH]. Panels b, h, k, 1, n, p) show complete genitalia in dorsal (above) and

left lateral (below) views, and m) only left lateral view. Panels a, j, 0) assemble genitalia parts from slides to display aedeagus

(if detached, top left), detached valva (left), and the rest of the genital capsule in lateral view (right). All images are to scale.

Sandoval Co., Cibola National Forest, SH165 4.2 mi S of Placitas, GPS 35.2502, —106.4104, 14-May-

2017, Qian Cong, Jing Zhang & Nick V. Grishin leg. (NVG-8800); 1c 1¢ Lincoln Co.,1.5 mi E of

Capitan Gap Rd N water course, el.7000', 10-May-1981, J. McCaffrey leg. (NVG-15099H08 & H09)

[FMNH]; 2c’o Otero Co., Lincoln National Forest, La Luz Canyon Rd., 4.8 air mi NE of High Rolls, GPS

32.9992, —105.7759, 21-May-2017, Qian Cong, Jing Zhang & Nick V. Grishin leg. (NVG-8970, Fig. 301

& NVG-9057); Arizona: Coconino Co.: lo 19 S rim of Grand Cyn, 10-Jun-1942, J. S. Garth leg. (NVG-

22094A02 & A03) [LACM]; 1c Lockett Meadow, GPS 35.3605, —111.6208, 24-May-2021, Brian

Banker leg. (NVG-21089E12); 1c Apache Co., Greens Peak area, Pipeline Spring at Fsl17, GPS

34.1413, —109.5809, 25-May-2018, Jing Zhang & Nick V. Grishin leg. (NVG-11465, Fig. 30k); lo

Graham Co., Adam's Flat, GPS 32.6508, —109.8125, 23-Apr-2009, Mark Walker leg. (NVG-18037D 10).

Type locality. USA: Colorado, Jefferson Co., Clear Creek Canyon.

Etymology. The name is given for the general area of the distribution of this species, which is in and

around the Rocky Mountains (the Rockies), by fusing the Latin suffix -ensis (meaning “from place” or “of

place”) with the word “Rockies”. The name is a masculine adjective in the nominative case.

English name. Rocky Mountains Cloudywing.

Distribution. Across the Rocky Mountains and neighboring states: confirmed from Montana, Nebraska,

Utah, Colorado, New Mexico, and Arizona.

Cecropterus (Thorybes) floridianus Grishin, new species

http://zoobank. org/EA537AE1-E4FB-4C72-8615-D9BE2DE7336A

(Figs. 27 & 29 parts, 30a—d, 31)

Definition and diagnosis. Both the Z chromosome and the mitogenome trees reveal that eastern US

populations previously assigned to Cecropterus (Thorybes) pylades (Scudder, 1870) (type locality in

USA: Massachusetts) are not monophyletic, and populations from Florida form a clade sister to three

species combined (C. pylades, C. indistinctus, and C. rockiensis sp. n.) (Fig. 27). Genetic differentiation

between C. pylades and the Floridian populations is notable: Fs/Gmin between the two clades are

0.24/0.003 and the COI barcode difference is 2.3%—2.4% (15-16 bp). Therefore, the Floridian clade

represents a distinct species. This new species is similar in appearance to C. pylades in darker ground

color, weaker checkered fringes (especially on forewing), weaker developed marginal pale overscaling on

wings beneath, larger size, and rounder wings; and differs from it by darker appearance and generally

smaller hyaline spots. In the male genitalia, most similar to C. pylades, e.g., uncus arms slightly converge

distad, but valva is usually broader, the central bump on its costa is typically less pronounced (in lateral

view), harpe is relatively shorter, broader, and straighter, less angled along the ventral margin, and uncus

arms are usually shorter compared to tegumen (Fig. 30a—d). Definitive identification is provided by DNA

and a combination of the following characters is diagnostic in nuclear genome: aly1409.4.2:G1779A,

aly383.20.2:TI131A, aly3507.12.1:G3947C, aly383.21.1:A1654G, aly1409.4.2:A1477C and in COI barcode:

T9LA, T232C, T355C, T478C, T514A.

Barcode sequence of the holotype: Sample NVG-22032A09, GenBank OR578715, 658 base pairs:

AACTTTATATTTTATTTTCGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCATTAATTGGAGATGACCAAATTTATAATACT

ATTGTCACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTCTTATACTAGGAGCTCCTGATATAGCCTTTCCTCGTA

TAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGAGCAGGTACTGGATGAACTGTTTATCCCCCATTATCTTCCAATATTGC

TCACCAAGGAGCTTCAGTAGATTTAGCAATTTTTTCTTTACATCTTGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAACTTATCA

TTTGATCAAATACCATTATTTATTTGAGCAGTTGGAATTACAGCTTTATTACTTTTACTTTCACTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT

CATTTTTTGATCCAGCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: co deposited in the National Museum of Natural History, Smithsonian

Institution, Washington, DC, USA [USNM], illustrated in Fig. 31, bears four printed labels: three white

[| HOLOTYPE o& | Cecropterus (Thorybes) | floridianus Grishin ]. Paratypes: 4¢'c 3992 from USA,

Florida: Io Franklin Co., USH98 0.4 mi. S of junction with Co. Rd. 370, 3 air mi N of Alligator Point,

GPS 29.9378, —84.3907, 29-Mar-1988, J. M. Burns leg., (NVG-22032A08) [USNM]; 1¢ Dixie Co., 16

km S Steinhatchee, end of Rt. 361, 4-Apr-1988, Scott W. Gross leg. (NVG-22032A07) [USNM]; Io

Levy Co., Cedar Key, 25-Jul-1963, C. J. Durden leg. (NVG-20062C06) [TMMC]; 19° Alachua Co.,

Gainesville, 20-Apr-1973, E. C. Knudson leg. (NVG-22032A10) [USNM]; 1c& Marion Co., Ocala

National Forest nr. Juniper Springs, 15-May-1988, Scott W. Gross leg. (NVG-22032A12) [USNM]; 1°

Volusia Co., New Smyrna Beach, G. W. Rawson leg. 10-Mar-1969 (NVG-22032A11) [USNM]; Ic

Martin Co., Port Sewall, 16-Mar-1939, genitalia 25-34 J. W. Tilden (NVG-22101A01, Fig. 30a) [CAS].

Fig. 31. Holotype of Cecropterus (Thorybes) floridianus sp. n. in dorsal (left) and ventral (right) views, data in text.

Type locality. USA: Florida, Volusia Co., New Smyrna Beach.

Etymology. The name for this Floridian species is formed by adding “-us” and is a masculine adjective.

English name. Florida Cloudywing.

Distribution. Confirmed only from the USA: Florida, but is likely to be found at least in Georgia.

Cecropterus (Thorybes) oaxacensis Grishin, new species

http://zoobank.org/5638F005-DC60-47A2-BB6F-6D9B0650F399

(Figs. 27 & 29 parts, 30p, 32, 33)

Definition and diagnosis. Inspection of genomic trees reveals that a single specimen from Mexico,

Oaxaca, initially identified by us as “Cecropterus albosuffusa” (curated with “Cecropterus drusius” in the

collection), is not placed among Cecropterus (Thorybes) albosuffusa (H. Freeman, 1943) (type locality

USA: Texas, Ft. Davis) specimens we sequenced from across the range (Fig. 27). This specimen is sister

to all analyzed C. albosuffusa, some from Puebla and DF in Mexico. This consistent placement of the

specimen in the trees constructed from protein-coding regions in autosomes, Z chromosome, and

mitochondrial genome, where all sequenced C. albosuffusa specimens across the range from Arizona and

Texas to Pueblo cluster closely together, and its distinction in the COI barcode of 1.2% (8 bp, while C.

albosuffusa did not show variation in the barcode) suggest that it represents a distinct species. This new

Species is diagnosed by white hindwing fringe from vein M2 to tornus, similar to Cecropterus (Thorybes)

drusius (W. H. Edwards, [1884]) (type locality in southern Arizona) but has C. albosuffusa-like genitalia

with rounded (Fig. 30p), not claw-shaped (Fig. 30q) harpe, rounder hindwings in males (in C. drusius

males, hindwings are slightly extended at tornus, almost lobed), broad paler “frosty” submarginal area on

ventral hindwing, which C. drusius typically lacks (some specimens with narrower pale overscaling), and

broader forewing subapical spots in a straight line, each spot is nearly square. In male genitalia (Fig. 30p),

it is most similar to C. albosuffusa (Fig. 30m—o) but differs in thicker and shorter relative to tegumen

uncus arms, broader and more rounded in lateral view tegumen, and broader, rounder and more upturned

harpe. In DNA, a combination of the following characters is diagnostic in nuclear genome: aly638.13.2:

A120C, aly638.13.2:C165T, aly4592.3.6:T120C, aly4592.3.6:AIS9T, aly727.34.3:C417T, aly596.8.8:G120G

(not A), aly596.8.8:G618G (not A), aly767.17.3:A273A (not G), aly767.17.3:T941T (not G), aly1432.13.4:

C50C (not T) and COI barcode: A181G, A421A, T574C, C595C, T604C.

Barcode sequence of the holotype: Sample NVG-19125B09, GenBank OR578716, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGTTTACTTATTCGAACTGAAT TAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT

ATTGTCACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGGGGATTTGGAAATTGATTAATTCCTCTTATATTAGGAGCTCCTGATATAGCTTTTCCTCGTA

TAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTCTTTTAATT TCAAGAAGTATT GTT GAAAACGGAGCAGGTACTGGATGAACTGTTTATCCCCCTTTATCTTCTAATATTGC

TCATCAAGGAGCTTCAGTAGATTTAGCAATTTTTTCTTTACATCTTGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACTATTAT TAATATACGAATTAATAATTTATCA

TTTGATCAAATACCATTATTTATTTGAGCTGTTGGAAT TACAGCCTTATTACTTTTACTTTCATTACCTGTTTTAGCTGGAGCTATTACCATATTATTAACTGATCGAAACTTAAATACCT

CATTTTTTGATCCTGCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

YN es X & “heed oi 5 ‘ W pas

YN, wots ie SAN Mae NES me lek io! Ly 7 Made ae lis, el 9

Fig. 33. Cecropterus (Thorybes) oaxacensis sp. n. female, iNaturalist observation 110602850 from Mexico: Oaxaca, San Miguel

Tequixtepec, 17-Jun-2014, © John Kemner; photographs show the same individual. Images are color-corrected, and the rightmost is rotated approximately 90°

clockwise. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/

sa eh

Type material. Holotype: & deposited in the University of Texas Biodiversity Center collection, Austin,

TX, USA [TMMC], illustrated in Fig. 32, bears four printed labels: three white [ OA.Tlalixtac.002 | 5 mi

sample ID: | NVG-22056A03 | c/o Nick V. Grishin ], and one red [ HOLOTYPE co | Cecropterus (Thorybes)

| oaxacensis Grishin ], collected by John Kemner on 17-May-1988 (1.e., “88138”: day 138 of 1988).

Type locality. Mexico: Oaxaca, Tlalixtac de Cabrera, Hwy 175, ca. 5 mi north of Oaxaca City.

Etymology. The name is given for the type locality and is a masculine adjective in the nominative case.

English name. Oaxaca Cloudywing.

Distribution. Known only from Mexico: Oaxaca. Specimens from phenotypically similar (but mostly

darker-fringed) populations to the north (e.g., Puebla and Ciudad de México) are Cecropterus (Thorybes)

albosuffusa (H. Freeman, 1943) as identified by genomic sequencing (Fig. 27).

Telemiades solon P\6tz, 1882 is a junior subjective synonym

of Nascus (Bron) broteas (Cramer, 1780)

The name Jelemiades solon Pl6tz, 1882 (type locality in South America), currently applied to a valid

species of Nascus Watson, 1893 (type species Papilio phocus Cramer, 1777), was proposed in a key with

a specimen number 4874 in Berlin collection (MFNB) mentioned and the drawing “t. 154” referenced

(Plétz 1882). Neither the specimen nor the illustration or its copy could be found. Godman (1907) skipped

the numbers t. 149 to t. 159 in his analysis of unpublished illustrations of American Hesperiidae by Plotz,

and none of these drawings were copied. The fate of the original Pl6tz’s illustrations is still unknown

(Zhang et al. 2023d). A search of the Hesperiidae holdings in MFNB did not yield the specimen with the

number 4874. However, the catalog of the old Hesperiidae collection in MFNB handwritten by Hopffer

(Zhang et al. 2023d) has a record for No. 4874: two specimens collected in “Rio” [Brazil: Rio de Janeiro].

Initially, they were listed as “sp.” (1.e., unidentified), but subsequently, “sp.” was crossed out, and

“Pherenice Hew.” was written instead. Eudamus pherenice Hewitson, 1867 (type locality in Brazil) is

currently regarded as a junior subjective synonym of Nascus (Nascus) phocus (type locality in Suriname).

Thus, the appearance of these two specimens No. 4874 was likely that of Nascus, even if they were

misidentified by Hopffer (1.e., they were not pherenice but some other similar species), and thus, if they

were 7. solon, consistent with the placement of 7. solon in Plétz’s key among species currently in Nascus.

Therefore, it is possible that the specimen(s) referred to by Plétz as “4874” was (were) listed in the

Hopffer catalog for that entry and collected in Southeast Brazil (Rio de Janeiro), a detail not given in the

original description of 7. solon.

Evans (1952) applied the name “Nascus solon” to an Amazonian species not known from

Southeast Brazil. This discrepancy found after an inspection of the Berlin collection catalog prompted us

to study the original description of 7. solon more closely. We concluded that Evans misidentified 7. solon

because the species Evans identified as “N. solon” does not agree with the original description of 7. solon.

Most significantly, Plétz mentions a brown “hair pencil” (a tuft of long hair-like scales) at the base of cell

1° fice., LA+2A-3A] on ventral hindwing in 7. so/on, but this tuft is pale, mostly yellow, in Evans’ “N.

solon.” Then, in T. solon, pale spots in the middle of the forewing are close together and “only separated

by veins” (Pl6tz 1882); but in “NV. solon”, the spot in cell M3-CuA; does not reach the cell origin, which is

filled with the ground color (yellow-brown) for at least half of the width of the pale spot in cell CuAi-

CuA2 along vein CuA}. Furthermore, in 7. solon, the hyaline spot in forewing cell Mi-Mb is small, a pale

spot by the costa in the middle of the forewing is mentioned only as “beneath, costal margin is also

spotted with pale’, and the ventral hindwing is with brown “crossbar in cell 7 [Sc+Ri-RS] and in the

discal cell”. In contrast, in “N. solon’, the spot in the forewing cell Mi-Mp is nearly the same size as the

spot in the cell Rs-Mj, forewing is with a well-developed hyaline spot by mid-costa, which is seen from

the dorsal side as well (hyaline!), hindwing is with weakly developed or missing cental brown spot in the

discal cell, and the spot in the cell Sct+Ri-RS is small, not a “crossbar”. Therefore, Evans’ “N. solon” is

not conspecific with the true 7. solon.

Next, we searched for specimens that agree with the original description of 7. solon. The specimen

we found to match the description closely was No. 4865 in MFNB. This specimen was previously curated

as a type of Netrocoryne seneca Plotz, 1882 (type locality Brazil) because No. 4865 was mentioned by

Pl6tz (1882) in the original description of N. seneca. However, this specimen is a pseudotype because it

agrees neither with the original description nor with a copy of Pl6étz’s unpublished illustration of N.

seneca (Zhang et al. 2023d). It is possible that due to some mistakes in referencing the MFNB specimen

numbers, this specimen No. 4865 was instead (or in addition) a syntype of 7. solon. However, we do not

have defendable evidence to support this hypothesis. Therefore, we proceeded with the neotype

designation because there is an exceptional need to clarify both the taxonomic identity and the type

locality of 7. solon. This taxon has been misidentified by Evans (1952), who applied this name to a

species that does not agree with the original description of 7. solon. This mistake creates inconsistencies

in the literature and the potential for further destabilization of nomenclature due to the existence of

additional species in this group unless the name T. solon is objectively defined by the neotype. Therefore,

N.V.G. designates the specimen No. 4865 in MFNB illustrated in Fig. la—c in Zhang et al. (2023d) (DNA

sample NVG-15031F11) as the neotype of Telemiades solon Plétz, 1882.

Our neotype of 7. solon satisfies all requirements set forth by the ICZN Article 75.3, namely:

75.3.1. It is designated to clarify the taxonomic identity of Telemiades solon Pl6tz, 1882, which has been

misinterpreted and attributed to a different species that does not agree with the original description of T.

solon, and to detail its type locality that was given only generally (as “South America”) in the original

description; 75.3.2. The characters to differentiate this taxon from others were specified by Pl6tz (1882),

and we regard them as follows: forewing with a hyaline spot in cell CuA2-1A+2A, hyaline spots in the

middle of the forewing are crowded together and separated only by veins, hyaline spots in cells Mi-Mo2

and M>-Ms3 are small, and the former is merged with the apical spots that together form an oval-shaped

hyaline patch separated by veins, a hyaline spot in cell R2-R3 is merged with this patch and not offset

basad, the hyaline spot is absent by the costal margin near its middle, but the costal margin with a pale

spot in the middle beneath; ground color of wings olive-brown, the base of ventral hindwing and most of

ventral hindwing are clay-yellow, ventral hindwing with brown crossbars in cell Sct+Ri-RS and the discal

cell, and, in addition to the broadly brown outer margin area, with a postdiscal brown band and a brown

tuft of hair-like scales at the base of cell 1A+2A-3A; 75.3.3. The neotype specimen is a male bearing

eight labels (1t red, 3 bluish-greenish, the last orange, and others white): [ typus ], [ 4865 ], [ Bahia

Nick V. Grishin ], [ {QR Code} http://coll.mfn-berlin.de/u/ | 940b3c |], [ not a type specimen of |

Netrocoryne seneca | Pl6tz, 1882 | determined by Zhang, | Cong et al. 2023 | and illustrated in Fig. la—c

(without the last label, which was added later) in Zhang et al. (2023d); the neotype has a chipped off

tornus on both hindwings; 75.3.4. We searched for syntypes of 7. solon in the MFNB collection because

the original description specified specimen(s) with the number 4874 in Berlin. While there was an entry in

the old collection catalog with No. 4874 listing two specimens, we could not find them among

Hesperiidae holdings, and therefore, we believe that syntypes were lost; 75.3.5. The neotype closely

agrees with the original description of 7. so/on in all (but one) characters, as evidenced by comparing the

neotype illustrated in Fig. la—-c in Zhang et al. (2023d) with the characters for this taxon given in the

original description (Pl6tz 1882) and listed above (75.3.2.); the only discrepancy is that palpi are nearly

white beneath, not clay-yellow (could have been discolored) as stated by Pl6tz (1882); 75.3.6. The

neotype is from Brazil: Bahia, which is within the original type locality given as “South America”; 75.3.7.

The neotype is in the collection of the Museum fiir Naturkunde, Berlin, Germany (MFNB).

Genomic sequencing confirms the phenotypic assessment of the 7. solon neotype as a specimen of

Nascus (Bron) broteas (Cramer, 1780) (type locality in Suriname) (Zhang et al. 2023d) because it groups

with specimens of the latter species in the tree (Fig. 34). Notably, Draudt (1922) has already placed 7.

solon within his Nascus cous (Méschler, 1879) (listing Nascus eugamon Godman & Salvin, 1893 as a

synonym of the latter), and expressed an opinion that these may be males of N. broteas, which was then

known only by females. Therefore, as a result of the neotype designation, Te/emiades solon Plétz, 1882,

Syn. nov. becomes a junior subjective synonym of Nascus (Bron) broteas (Cramer, 1780). The COI

barcode eee of 7. solon neotype, sample NVG-15031F11, GenBank OR578717, 658 base pairs, is:

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTCTTAGATTACTAATTCGAACT GAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACT

ATCGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATT GATTAGTACCTCTTATACTAGGAGCTCCTGATATAGCATTTCCACGAA

TAAATAACATAAGATTTTGATTATTACCTCCATCATTAACATTATTAATTTCAAGAAGAATTGTCGAAAATGGTGCTGGTACTGGATGAACAGTTTACCCCCCTT TATCAGCAAATATTGC

TCACCAAGGTTCTTCCGTAGATTTAGCAATCTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCT

TTTGATCAAATACCATTATTTATTTGAGCTGTAGGAAT TACAGCATTATTATTACTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT

CTTTCTTTGACCCAGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT

Nascus (Bron) corilla Evans, 1952 is a species-level taxon

Nascus solon corilla Evans, 1952 (type locality in Venezuela) was proposed as a subspecies of a species

Nascus corilla]17104F06|05-SRNP-55005|Costa Rica|2005

= Nascus corilla}17103E03|Panama|1969

Nascus corilla|18054A11|Colombia|1924

100 Nascus lux [not solon]|17103E04|PT|Peru|1994

: Nascus lux [not solon]|17103G06|PT|Brazil:RO|1994

Nascus lux [not solon]|18088H10|PT|Brazil:AM|2007

Nascus lux [not solon]|21012D07|HT|Brazil:AP|1918

aa0 Nascus lux [not solon]|18098E10|H3956|PT|French Guiana|1992

Nascus broteas|22018C05|Suriname|old

Nascus broteas|18088H11|Brazil:PA|2009

Nascus broteas|17103E05|Brazil:PA|1981

3 Nascus broteas (=cous)|15031G05|ST|Colombia|1876

i op Nascus broteas|22018C04|Suriname|old

Nascus broteas (=solon)|15031F11|NT|Brazil:BA|old

Nascus broteas|17103E06|Brazil:RJ|old

Nascus broteas|17103G05|Argentina|1999

Nascus prax|18098E12|H11686|French Guiana|1996

0.006 28

10)

Fig. 34. The phylogenetic tree of Nascus (Bron) inferred from nuclear genome protein-coding regions (autosomes): N. (B.)

corilla stat. nov. (blue), N. (B.) /ux sp. n. (red), and N. (B.) broteas (black). Primary type specimens are labeled in magenta.

that Evans misidentified as “N. solon”. We argue above that the true Telemiades solon Plotz, 1882 (type

locality in Brazil: Bahia) is conspecific with Nascus broteas (Cramer, 1780) (type locality in Suriname).

Because a species that Evans considered to be “N. so/on” is distinct from N. broteas, it is not conspecific

with the true 7. solon and should not be identified by this name. Because no other available name applies

to Evans’ “N. solon”, Nascus corilla Evans, 1952, stat. nov. becomes a species-level taxon.

Nascus (Bron) lux Grishin, new species

http://zoobank. org/4B4097CE-A43 D-4A BB-A5E5-lEAE4FD5C049

(Figs. 34 part, 35)

Definition and diagnosis. Inspection of genomic trees reveals that Amazonian populations, which Evans

(1952) considered to be conspecific with Nascus corilla Evans, 1952, stat. nov. (type locality in

Venezuela) and misidentified as Telemiades solon Plétz, 1882 (type locality in Brazil: Bahia) as

determined above, are genetically differentiated from N. corilla with Fst/Gmin of 0.48/0.003 (although their

COI barcodes do not reveal differences but in | or 2 base pairs) and therefore represent a distinct species

(Fig. 34). This species does not have a name. This new species keys to “Nascus solon solon” D.5.3(b) in

Evans (1952) and is distinguished from its closest relative, N. corilla, stat. nov. (see above), by pale-

yellow to orange-yellow patches of scales, variable in their expression, dividing the brown outer marginal

area on the ventral hindwing (that is solid dark brown in N. corilla) into narrow postdiscal and broad

submarginal bands in males, and usually having five (not four) subapical hyaline spots in females; and

from other species of Nascus by the following combination of characters: forewing apical spot in cell Ro-

R3 is in line with others, not offset basad; yellow or pale brown tuft of long scales at the base of cell

1A+2A-3A on ventral hindwing; palpi beneath and cheeks are white; prominent hyaline spot in the

middle of forewing by costal margin in males; forewing typically larger than 28 mm in males and 30 mm

in females. A combination of the following nuclear genomic characters is diagnostic: aly525.35.1:C54T,

aly214.21.1:C303T, aly214.21.1:G312A, aly26.5.3:C294T, aly50.27.2:A51G.

Fig. 35. Holotype of Nascus /ux sp. n. in dorsal (left) and ventral (right) views, data in text.

Barcode sequence of the holotype: Sample NVG-21012D07, GenBank OR578718, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTCTTAGATTATTAATTCGAACTGAATTAGGCACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACA

ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGACTAGTACCTCTTATATTAGGAGCTCCTGATATAGCATTTCCACGAA

TAAATAATATAAGATTTTGATTATTACCTCCATCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGTACTGGTTGAACAGTTTACCCCCCTTTATCAGCAAATATTGC

TCACCAAGGATCTTCTGTAGATTTAGCAATTTTTTCATTACATTTAGCAGGAATTTCCTCAATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCT

TTTGATCAAATACCATTATTTATTTGAGCTGTAGGTATTACAGCTTTATTATTATTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT

CTETTTTTGATCCTCCAGGAGGAGGTGATCCAATICTTTATCAACATTTATT?T

Type material. Holotype: ¢& deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA

[CMNH], illustrated in Fig. 35, bears four printed (last two digits of the year handwritten) labels: three

white | Uassa Island, | Uassa Swamp. | S. M. Klages, C. M. Acc. 6176 ], [ May | 1918 ], [ DNA sample

ID: | NVG-21012D07 | c/o Nick V. Grishin ], and one red [HOLOTYPE oc | Nascus (Bron) | lux

Grishin |. Paratypes: 4c’c’, one from each locality Peru: Huanuco, Tingo Maria, 800m, May-Jun-1994,

genitalia X-5174 J. M. Burns 2002 (NVG-17103E04, USNMENT00913776); Brazil: Rond6nia, 62 km S

Ariquemes, Fazenda Rancho Grande, elevation 165m, GPS —10.53, —63.80, 27-Aug-8-Sep-1994, Ron

Leuschner leg. (NVG-17103G06, USNMENT00913805); Amazonas, Maues, Rio Preto, 15-25-Nov-2007

(NVG-18088H10); and French Guiana: Roura, Coralie, GPS 4.5083, —52.3750, L. Sénécaux & A.

Docquin leg. 24-Jul-1992 (NVG-18098E10, H3956).

Type locality. Brazil: Amapa, Rio Uaca region (“Uassa Swamp”), which is by the border between Brazil

and French Guyana.

Etymology. In Latin, /ux means “light” and refers to the lighter (i.e., paler) overall appearance of this

sunny species, light—instead of brown—tuft of scales on the hindwing (a beam of light), and a sprinkle of

light scales between the postdiscal and submarginal brown bands on the ventral hindwing (a phenotypic

character that typically separates this species from its closest relative). The name is a noun in apposition.

Distribution. Generally, in and around the Amazonian region in South America. This species has been

recorded from French Guiana, Peru, Ecuador, and Brazil (Amapa, Amazonas, Rondonia).

Comment. This name is proposed for Evans’ concept of “Nascus solon solon” (Evans misidentified

Telemiades solon Plotz, 1882), and due to genetic differentiation, the two taxa Evans considered to be

subspecies: “Nascus solon corilla” and “Nascus solon solon” are distinct species: Nascus corilla and

Nascus lux sp. n., respectively.

Cogia hiska Evans, 1953 (with its subspecies Cogia hippalus hester Evans, 1953) is a

species distinct from Cogia hippalus (W. H. Edwards, 1882)

Genomic sequencing of Cogia hippalus (W. H. Edwards, 1882) (type locality USA: AZ, Pima Co.

Tucson, lectotype sequenced as NVG-15101B12) specimens across the range reveals their partitioning

into two clades with genetic differentiation at the species level: Fs/Gmin and COI barcode difference of

0.49/0.004/2.9% (19 bp) (Fig. 36). Therefore, the two clades represent two distinct species. One clade

contains specimens from the northwestern part of the range northeast to South Texas, USA, and south to

Oaxaca, Mexico: the nominotypical C. hippalus and its close relative Cogia hippalus peninsularis L.

Miller & MacNeill, 1969 (type locality Mexico: Baja California Sur, Arroyo San Bartolo, holotype

sequenced as NVG-15095C07). The other clade consists of specimens from the southeastern part of the

range from Mexico: Tamaulipas to Venezuela: Cogia hippalus hiska Evans, 1953 (type locality Costa

Rica: Puerto Carrillo) and Cogia hippalus hester Evans, 1953 (type locality Venezuela: Merida). Our

methods of analysis do not find species-level genetic differences between C. h. hiska and C. h. hester. The

names hiska and hester were proposed in the same work issued on the same date. As the first revisers, we

a ri Cogia outis|12408|USA:OK,Cleveland Co.|2019

3 Cogia outis]17116A05|USA:TX,Cooke Co.|1973

700 Cogia outis]15095E10|ST|USA:TX,Blanco Co.|old

z Cogia outis|18116B07|ST|USA:TX,Blanco Co.|1895

Cogia outis|19014A11|USA:TX,Uvalde Co.|1968

Cogia hippalus hippalus|17113D07|Mexico:Son|1987

Cogia hippalus hippalus|15101B12|LT|USA:AZ,Pima Co.|old

Cogia hippalus hippalus|19014A10|USA:TX,Hidalgo Co.|1974

Cogia hippalus hippalus|20059G05|USA:TX,Starr Co.|2007

b Cogia outis|17116A05|USA:TX,Cooke Co.|1973

€ogia outis]15095E10|ST|USA:TX, Blanco Co.|old

Cogia outis]19014A11|USA:TX,Uvalde Co.|1968

Gogia outis]12408|USA:OK,Cleveland Co.|2019

Cogia outis|18116B07|ST|USA:TX,Blanco Co.|1895

Cogia hippalus hippalus|]19014A10|USA:TX,Hidalgo Co.|1974

iGogia hippalus hippalus|15101B12|LT|USA:AZ,Pima Co.|old

Cogia hippalus hippalus|19124H08|Mexico:Oax|1988

gia hippalus hippalus|17113D07|Mexico:Son|1987

100

y Cogia hippalus hippalus|19124H08|Mexico:Oax|1988 g@ogia hippalus hippalus|17113D06|Mexico:Son|1987

i 7a Cogia hippalus hippalus|17113D06|Mexico:Son|1987 o€ogia hippalus hippalus|20059G05|USA:TX, Starr Co.|2007

Cogia hippalus hippalus|22064F06|USA:NM,Eddy Co.|2014 Cogia hippalus hippalus|22064F06|USA:NM, Eddy Co.|2014

2 ie Cogia hippalus peninsularis|15095C07|HT|Mexico:BCS|1961 "Cogia hippalus peninsularis|15095C07|HT|Mexico:BCS|1961

a Cogia hippalus peninsularis|18028B06|Mexico:BCS|1978 9 ogia hippalus peninsularis|18028B07|Mexico:BCS|1979

60 oa Cogia hippalus peninsularis|18028B07|Mexico:BCS|1979 feogia hippalus peninsularis|20124D01|PT|Mexico:BCS|1961

Cogia hippalus peninsularis|20124D01|PT|Mexico:BCS|1961 Cogia hippalus peninsularis|18028B06|Mexico:BCS|1978

3 Cogia hiska hiska [not hippalus]|17111F05|Mexico:Hid|1981 Cogia hiska hiska [not hippalus]|19014A12|Mexico:Tam|1975

é Cogia hiska hiska [not hippalus]|17111F07|Mexico:Hid|1982 o§s0gia hiska hiska [not hippalus]|19124H0O7|Mexico:SLP|1987

Cogia hiska hiska [not hippalus]|19092G04|03-SRNP-101|Costa Rica 7€0gia hiska hiska [not hippalus]|17111F05|Mexico:Hid|1981

oe e Cogia hiska hester [not hippalus]|15105B11|Colombia|1952 s¢ogia hiska hester [not hippalus]|15105B11|Colombia|1952

Fig. 36. Phylogenetic trees of selected Cogia inferred from protein-coding regions of a) the nuclear (autosomes) and b) the

mitochondrial genomes. Different species are shown in different colors: C. hippalus (blue with its subspecies C. h. peninsularis

labeled in violet), C. hiska (red, with its subspecies C. h. hester labeled in magenta), and C. outis (black).

give precedence to hiska due to its larger distribution. Thus, we propose that Cogia hiska Evans, 1953,

stat. nov. is a species and Cogia hiska hester Evans, 1953, comb. nov. is its subspecies.

Lectotype designation for Eudamus caicus Herrich-Schiaffer, 1869

with the type locality likely in Mexico: Oaxaca

Eudamus caicus Herrich-Schaffer, 1869 (type locality Tropical America, possibly into southern USA),

currently a valid species in the genus Cogia Butler, 1870 (type species Cogia hassan Butler, 1870) was

described from an unstated number of specimens without details about their localities (Herrich-Schaffer

1869). One specimen without a locality label is curated in the MFNB collection as a syntype of E. caicus.

We determine that this specimen is indeed a syntype because it agrees with the original description and

matches closely in wing patterns a specimen BMNH(E) 1236437 (a male, in BMNH) that Godman

selected as the most similar in his collection to the unpublished drawing by Plétz of Eudamus schaefferi

Pl6tz, 1881 (a replacement name for EF. caicus Herrich-Schaffer, 1869, erroneously deemed preoccupied),

such similar-styled labels on specimens that, in his opinion, closely resembled the originals of Pl6tz’s

drawings that he inspected (Godman 1907), and we use this specimen as a “proxy” for the drawing. We

note that E. schaefferi (Plotz’s t[afel]. 129, which is E. caicus H.-S.) was not mentioned in Godman’s

publication (1907), which might be because that work dealt with American species, but the locality for E.

schaefferi was not explicitly stated in the original description and, due to the lack of locality labels on the

syntype, likely not appearing on the Plétz’s drawing numbered 129. This Godman’s specimen from “N.

Sonora, | Mexico” is actually Cogia caicus moschus (W. H. Edwards, 1882), but is similar in wing pattern

to the nominotypical C. caicus; its photographs are shown on the Butterflies of America website (Warren

et al. 2023). To stabilize nomenclature, N.V.G. hereby designates the syntype in the MFNB collection, a

female with the following seven printed labels, the 1° purple and others white: [ Origin ], [ Coll. H—

Sch. |, [| Daunus Cr. |, [| Caicus | HS. | Achlyodes ], [ Caicus | H-Sch. ], [ {QR Code} http://coll.mfn-

Eudamus caicus Herrich-Schaffer, 1869. Genomic trees place the lectotype among specimens from

Mexico, Oaxaca (Fig. 37), suggesting that it was collected there because it is genetically within this

metapopulation. Therefore, we infer that the type locality of Cogia caicus (Herrich-Schaffer, 1869) may

be in Oaxaca and will test this hypothesis further by sequencing specimens from other localities.

Cogia moschus|15097HO6|LT|AZ,Graham Co. fg

Cogia moschus|10881|USA:AZ,Pinal Co.|2018

Cogia moschus|18033E12|Mexico:Son|2010

= Cogia moschus|15097HO6|LT|AZ,Graham Co. © gg Ogia moschus|15097HO6|LT

Cogia moschus|18033E12|Mexico:Son|2010 Cogia moschus|18033E12|Mex

C. caicus|15032A02|LT|no datalold C. caicus|15032A02|LT|no datalold Go Caicus|15032A02|LT|

Cogia caicus|22079A03|Mexico:0ax|1989 Cogia caicus|17113D04|Mexico:Oax|1988 100 fg0gia caicus|22079A03|Mex

Cogia caicus|20062G07|Mexico:Oax|1988 Cogia caicus|20062G07|Mexico:0ax|1988 9sCogia caicus|20062G07|Mex

Cogia caicus|17113D04|Mexico:O0ax|1988 Cogia caicus|22079A03|Mexico:0ax|1989 Cogia caicus|17113D04|Mex

Cogia chiagua|19124HO5|PT|Mexico:Chia|1987 Cogia chiagua|19124HO5|PT|Mexico:Chia|1987 Gogia chiagua|19124HO5|PT

Cogia chiagua|22079A01|HT|Guatemala|1993 Cogia chiagua|22079A01|HT|Guatemala|1993 {gogia chiagua|22079A01|HT

0.002 Cogia chiagua|17109FO9|PT|Guatemala|1968 — 0.003 Cogia chiagua|17109FO9|PT|Guatemala|1968 001 ~ Cogia chiagua|17109FO9|PT

Fig. 37. Phylogenetic trees of selected Cogia species inferred from protein-coding regions of a) the nuclear genome

(autosomes), b) the Z chromosome, and c) the mitochondrial genome. Different species are shown in different colors: C.

moschus stat. rest. (blue), C. caicus (green), and C. chiagua sp. n. (red). Primary type specimens are labeled in magenta.

Cogia moschus (W. H. Edwards, 1882) is a species distinct

from Cogia caicus (Herrich-Schaffer, 1869)

We find the genetic differentiation between Cogia caicus (Herrich-Schaffer, 1869) (type locality likely in

Mexico: Oaxaca, as deduced above, lectotype sequenced as NVG-15032A02, in MFNB) and Cogia caicus

moschus (W. H. Edwards, 1882) (type locality in USA: AZ, Graham Co., lectotype sequenced as NVG-

15097H06, in CMNH) to be of a magnitude suggestive of distinct species: Fst/Gmin/COI differences are

0.50/0.003/0.9% (6 bp) (Fig. 37). Therefore, we propose that Cogia moschus (W. H. Edwards, 1882),

stat. rest. is a species-level taxon.

Cogia chiagua Grishin, new species

http://zoobank. org/OOE80EF8-25B0-4A36-97FC-E6157CD96DE5

(Figs. 37 part, 38, 39a)

1cm

Fig. 38. Holotype of Cogia chiagua sp. n. in dorsal (left) and ventral (right) views, data in text.

Definition and diagnosis. In addition to Cogia moschus (W. H.

Edwards, 1882) (type locality in USA: AZ, Graham Co.) and

Cogia caicus (Herrich-Schaffer, 1869) (type locality likely in

Mexico: Oaxaca), genomic trees reveal a third lineage of similar

genetic differentiation (Fig. 37 red) with Fst/Gmin/COI differences

from the former and the latter, respectively: 0.49/0.009/0.9% (6 bp)

and 0.4/0.006/0.5% (3 bp) that represents a species. This new

species differs from its two close relatives by being darker overall,

smaller (or lacking) hyaline spots, and darker palpi beneath. Male

genitalia are variable, but the harpe typically is broader, rounder,

and dorsally with more robust teeth on a shorter ridge near the

ampulla; aedeagus with a smaller number of cornuti (Fig. 39). A

combination of the following characters in the COI barcode is

diagnostic: A40A, C343C, T349T, T386T, A481G, T556A.

Barcode sequence of the holotype: Sample NVG-22079A01,

GenBank OR578719, 658 base pairs:

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGTTTATTAATTCGTACTGAATTAG

GAACTCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTT

TTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCCTTAATATTAGGAGCTCCTGATATAGC

TTTTCCTCGTATAAATAATATAAGATTTTGATTACTTCCCCCATCATTAACATTATTAATTTCTAGAAGTATTGTAG

AAAATGGTGCTGGTACTGGATGAACAGTATATCCCCCCCTTTCATCAAATATTGCACATCAAGGTTCATCAGTAGAT

TTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCATCTATTTTAGGTGCTATTAATTTTATTACTACAATTATTAA

AT’

TATACGAATTAGAAATTTGTCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACAGCTTTATTACTTT

TACTTTCTTTACCTGTATTAGCTGGTGCTATTACTATACTTTTAACAGAT CGAAATCTTAATACATCATTTTTTGAT

CCT GCTGGAGGAGGAGACCCTATTTTATATCAACATTTATTT

Type material. Holotype: & deposited in the McGuire Center for re a

Lepidoptera and Biodiversity, Gainesville, FL, USA [MGCL], ~ b

illustrated in Fig. 38, bears five printed labels: four white | Fig. 39. Male genitalia of Cogia in lateral

| Antigua, Sacatepequez | Guatemala | September 16, 1993 | 180°) a pg amines ee

D.L.Lindsley ], [ Cogia Butler | caicus (Herrich-Schaffer) | caicus | mini-slide 153, data in text. b) Gomis

(Herrich-Schaffer) |, [ D.L. Lindsley colln. | MGCL Accession | # | stat. rest., Mexico: N Sonora, Morrison

2008-20 ], [DNA sample ID: | NVG-22079A0I | c/o Nick V. neh ee aS eae,

Grishin ], and one red [ HOLOTYPE o@ | Cogia chiagua | Grishin ]. | Natural History Museum London and are made

Paratypes: 3c'c, 19: 1c Mexico, Chiapas, Comitén, Laguna ie unger Census onuionse (accuser

ps://creativecommons.org/licenses/by/4.0/).

Chamula, 7100’, 13-May-1987, C.J. Durden leg. (NVG-19124H05)

[TMMC] and Guatemala: Io Panajachel, 2-Jun-1968, Beals leg. (NVG-17109F09) [LACM] and Duenas,

G.C. Champion leg. [BMNH]: 1o& (BMNH(E) 1236437, genitalia mini-slide 153, Fig. 39a) and 19.

Type locality. Guatemala: Sacatepéquez Department, Antigua.

Etymology. The name is a fusion of Chia[pas| + Gua|temala] for the known distribution of this species

and is a feminine noun in apposition.

Distribution. Currently known from Mexico: Chiapas and from Guatemala.

Pholisora albicirrus Glassberg, 2023 is a species distinct

from Pholisora catullus (Fabricius, 1793)

We find the genetic differentiation between Pholisora catullus (Fabricius, 1793) (type locality “Indiis,”

probably eastern USA) and Pholisora catullus albicirrus Glassberg 2023 (type locality in USA: AZ,

Santa Rita Mts.) to be of a magnitude suggestive of distinct species: Fs/COI differences are 0.46/2.3% (15

bp) (Fig. 40), similar to that for Pholisora crestar J. Scott & Davenport, 2017 (type locality in USA: CA,

Tulare Co.) (Zhang et al. 2020). Therefore, we propose that Pholisora albicirrus Glassberg 2023, stat.

nov. is a species-level taxon in agreement with phenotypic differences mentioned in the original

description (Glassberg 2023), which, from our experience with other Hesperiidae, also suggest species,

and not subspecies, status.

a Pholisora catullus|22088B12|Mexico:Dur|1967 b -holisora catullus|22088B10|Mexico:NL|1965

Pholisora catullus|3277|USA:TX,Brewster Co.|2001 }holisora catullus|22088B08|Mexico:SLP|1973

Pholisora catullus|20045E03|USA:UT|2020 sPholisora catullus|3277|USA:TX,Brewster Co.|2001

Pholisora catullus|13344|USA:NM,Dona Ana Co.|2021 Pholisora catullus|22088B12|Mexico:Dur|1967

079 Pholisora catullus|3990|USA:TX,Starr Co.|2015 **Pholisora catullus|3276|USA:IN, Elkhart Co.|1988

Pholisora catullus|22088B08|Mexico:SLP|1973 g#holisora catullus|4278|USA:IN,Montgomery Co.|2015

Pholisora catullus|3278|USA:NM,Lea Co.|1979 oP. catullus|22065G03|USA:MD,Montgomery Co.|1999

Pholisora catullus|4278|USA:IN,Montgomery Co.|2015 holisora catullus|13344|USA:NM,Dona Ana Co.|2021

Pholisora catullus|3276|USA:IN, Elkhart Co.|1988 A holisora catullus|3278|USA:NM,Lea Co.|1979

oy Pholisora catullus|22088B09|Mexico:Hid|1987 holisora catullus|3990|USA:TX,Starr Co.|2015

Pholisora catullus|16107D02|USA:TX,Jeff Davis Co.|2016 Pholisora catullus|19042A05|Mexico:Hid|1964

: Pholisora catullus|22088B10|Mexico:NL|1965 *Bholisora catullus|22088B09|Mexico:Hid|1987

Pholisora catullus|19042A05|Mexico:Hid|1964 Pholisora catullus|20045E03|USA:UT|2020

Pholisora catullus]22031F10|USA:CA,Kern Co.|1984

I=aq P. catullus|22031F09|USA:CA, Tulare Co.|1995

P. catullus|22031F08|USA:CA, Tulare Co.|1984

0 Pholisora catullus|22088B05|USA:CA, Alpine Co.|1968

>? Pholisora catullus|3266|USA:CA,Mono Co.|1969

sa Pholisora catullus|21021D03|USA:CA,Mono Co.|2021

Pholisora catullus|20038E12|USA:CA,Inyo Co.|2018

0 Pholisora catullus|20038E09|USA:CA, Inyo Co.|2018

P. catullus|17066H12|PT of crestar|CA,Mono Co.|2006

Pholisora crestar|20038E11|USA:CA,Kern Co.|2003

sq, Pholisora crestar|20038E10|USA:CA,Kern Co.|2016

jop NOlisora crestar|17066H11|PT|USA:CA,Kern Co.|2010

36 Pholisora crestar|22088B04|USA:CA,Kern Co.|1994

Pholisora crestar|19083E02|HT|USA:CA, Tulare Co.|2013

Pholisora crestar|17066H10|PT|USA:CA, Tulare Co.|2015

7 Pholisora albicirrus|22088B11|Mexico:BCS|1982

Pholisora albicirrus|22088B07|Mexico:Sin|1968

Pholisora mejicanus|7976|USA:NM,Colfax Co.|1989

Pholisora mejicanus|19013D11|USA: CO,EI Paso Co.|1982

* Pholisora mejicanus|17067A02|USA:NM, Colfax Co.|1996

Pholisora mejicanus|17067A01|USA:NM,Lincoln Co.|2000

0.005

1Pholisora catullus]22031F10|USA:CA,Kern Co.|1984

peiscla catullus|22031F08|USA:CA, Tulare Co.|1984

holisora catullus|22031FO9|USA:CA, Tulare Co.|1995

Bholisora catullus|20038E09|USA:CA, Inyo Co.|2018

‘8 catullus|17066H12|PT of crestar|CA,Mono Co.|2006

Pholisora catullus|20038E12|USA:CA,Inyo Co.|2018

‘Bholisora catullus|21021D03|USA:CA,Mono Co.|2021

ePholisora catullus|22088B05|USA:CA, Alpine Co.|1968

Pholisora catullus|3266|USA:CA,Mono Co.|1969

ooPholisora albicirrus|22088B11|Mexico:BCS|1982

*'Pholisora albicirrus|22088B07|Mexico:Sin|1968

Pholisora crestar|19083E02|HT|USA:CA, Tulare Co.|2013

holisora crestar|17066H10|PT|USA:CA, Tulare Co.|2015

sPholisora crestar|17066H11|PT|USA:CA,Kern Co.|2010

iRholisora crestar|22088B04|USA:CA,Kern Co.|1994

poleers crestar|20038E11|USA:CA,Kern Co.|2003

holisora crestar|20038E10|USA:CA, Kern Co.|2016

sf holisora mejicanus|7976|NM,Colfax Co.|1989

6 P. mejicanus|19013D11|CO,EI Paso Co.|1982

9. mejicanus|17067A01|NM,Lincoln Co.|2000

P. mejicanus|17067A02|NM,Colfax Co.|1996

0.02

Fig. 40. Phylogenetic trees of Pholisora species recorded from the USA inferred from protein-coding regions of a) the Z

chromosome (best for species delimitation) and b) the mitochondrial genome. Different species are shown in different colors:

P. catullus (blue), P. crestar (violet), and P. albicirrus stat. nov. (red).

Celotes sabinus Grishin, new species

http://zoobank.org/O85EAF93-91A9-4F81-886C-0E77073C8BOE

(Figs. 41 part, 42, 43a)

Definition and diagnosis. Inspection of genomic trees reveals that Celotes nessus (W. H. Edwards, 1877)

(type locality USA: Texas, Bexar Co., San Antonio; lectotype sequenced as NVG-15097F12) as currently

circumscribed (Fig. 41 blue and red) is not monophyletic, and populations from the eastern part of the

range (Fig. 41 blue) are sister to Celotes spurcus A. Warren, Steinhauser, Hernandez-Mejia & Grishin,

2008 (type locality in Mexico: Querétaro) (Fig. 41 green). While species, in general, do not have to be

monophyletic, populations currently identified as C. nessus from the western part of the range (Fig. 41

red) are genetically differentiated from the eastern populations (which include nominotypical) at the level

characteristic of distinct species, with Z chromosome Fs/Gmin of 0.32/0.008 and COI barcode difference

of ~2.0% (13 bp, but barcodes introgress between these species). Therefore, these western populations are

a species distinct from C. nessus. This western species does not have a name because the only two junior

synonyms of C. nessus: Spilothyrus notabilis Strecker, [1878] (type locality in the USA: Texas, vicinity

of New Braunfels and San Antonio; two syntypes sequenced as NVG-15039C06 and NVG-15039C07)

and Carcharodus radiatus P\6tz, 1884 (type locality in USA: Texas, syntypes not located, attributed to a

species by locality), are conspecific with the eastern species. This new species is distinguished from C.

spurcus by approximately two times shorter process of valva (from the base of ampulla), which is similar

in length to C. nessus, and from C. nessus by terminally broader harpe, wider separation between harpe

and ampulla (broader gap between them), wider process of valva, broader valva narrowing less towards

vinculum, and two small teeth on aedeagus shaft: by its bend and halfway between the bend and distal end

(Fig. 43). A combination of the following nuclear genomic characters is diagnostic: aly2284.30.1:

G1323A, aly40182.1.2:C154A, aly40182.1.2:C171T, aly1445.3.1:G246A, aly1445.3.1:A195G.

Celotes sabinus|20065A08|PT|USA:AZ,Mohave Co.|2008 b

Celotes sabinus|22104H11|PT|USA:AZ,Mohave Co.|1972

Celotes sabinus|22105A03|PT|USA:AZ, Yavapai Co.|1976

Celotes sabinus|22104H12|PT|USA:AZ,Gila Co.|1960

Celotes sabinus|8304|PT|USA:AZ,Pinal Co.|2017

es Celotes sabinus|22105A01|PT|USA:AZ,Pima Co.|1951

16 Celotes sabinus|22104H09|PT|USA:AZ,Santa Cruz Co.|1938

: Celotes sabinus|22104H08|PT|USA:AZ,Pima Co.|1938

Celotes sabinus|2252|PT|USA:AZ,Santa Cruz Co.|1972

Celotes sabinus|22105A02|HT|USA:AZ,Pima Co.|1960

Celotes sabinus|2115|PT|USA:AZ,Santa Cruz Co.|1981

Celotes sabinus|2116|PT|USA:AZ,Santa Cruz Co.|1978

Celotes sabinus|2113|PT|Mexico:Son|1984

Celotes sabinus|5997|PT|USA:AZ,Santa Cruz Co.|2016

Celotes sabinus|2114|PT|Mexico:Son|1984

a 24

L 26

a “0

0.007 16

100 Celotes sabinus|20066B02|PT|Mexico:Son|1998 0.007

Celotes nessus|22105A05|USA:TX,Hudspeth Co.|1967

Celotes nessus|2247|USA:TX,Brewster Co.|1982

Celotes nessus|19012E05|USA:TX,Jeff Davis Co.|2018

by Celotes nessus|3370|M|USA:TX,Hidalgo Co.|2015

Celotes nessus|19012E03|F|USA:TX,Jeff Davis Co.|2018

0 Celotes nessus|3956|USA:TX,Hidalgo Co.|2015

i Celotes nessus (=notabilis)|15039C07|ST|USA:central TX|old

Celotes nessus|2245|USA:TX,Brewster Co.|1982

Celotes nessus|2246|USA:TX,Brewster Co.|1982

Celotes nessus|15097F12|LT|USA:TX,Bexar Co.|old

Celotes nessus (=notabilis)|15039C06|ST|USA:central TX|old

Celotes nessus|22105A04|Mexico:Tam|1970

Celotes nessus|22104H10|USA:TX,Live Oak Co.|1940 100

Celotes nessus|2254|USA:TX,Jeff Davis Co.|1969

Celotes nessus|2255|USA:TX, Williamson Co.|1971

Celotes spurcus|17067E03|PT|Mexico:Queretaro|2007

Celotes spurcus|17067E04|PT|Mexico:Queretaro|2007

Celotes spurcus|22064H12|PT|Mexico:Queretaro|2007

Celotes spurcus|17067E05|PT|Mexico:Queretaro|2007

Celotes spurcus|22065E08|PT|Mexico:Queretaro|2007

Celotes limpia|2248|Mexico:Coah|1977

oy,- Celotes limpia|19012E04|PT|USA:TX,Jeff Davis Co.|2018

zz— Celotes limpia|2253|USA:TX,Brewster Co.|2003

Celotes limpia|2249|PT|USA:TX, Presidio Co.|1966

Celotes sabinus|20065A08|PT|USA:AZ,Mohave Co.|2008

Celotes sabinus|22105A03|PT|USA:AZ, Yavapai Co.|1976

Celotes sabinus|22104H11|PT|USA:AZ,Mohave Co.|1972

Celotes sabinus|22104H12|PT|USA:AZ,Gila Co.|1960

“— Celotes sabinus|22104H08|PT|USA:AZ,Pima Co.|1938

Celotes sabinus|22105A01|PT|USA:AZ,Pima Co.|1951

p> Celotes sabinus|2115|PT|USA:AZ,Santa Cruz Co.|1981

z Celotes sabinus|5997|PT|USA:AZ,Santa Cruz Co.|2016

Celotes sabinus|22105A02|HT|USA:AZ,Pima Co.|1960

Celotes sabinus|2116|PT|USA:AZ,Santa Cruz Co.|1978

= Celotes sabinus|22104HO9|PT|USA:AZ,Santa Cruz Co.|1938

i, Celotes sabinus|2113|PT|Mexico:Son|1984

Celotes sabinus|2114|PT|Mexico:Son|1984

Celotes sabinus|20066B02|PT|Mexico:Son|1998

Celotes sabinus|2252|PT|USA:AZ,Santa Cruz Co.|1972

Celotes sabinus|8304|PT|USA:AZ,Pinal Co.|2017

Celotes nessus|22105A05|USA:TX,Hudspeth Co.|1967

; Celotes nessus|2246|USA:TX,Brewster Co.|1982

ig. Celotes nessus|2245|USA:TX,Brewster Co.|1982

7a, Celotes nessus|2247|USA:TX, Brewster Co.|1982

Celotes nessus|2254|USA:TX,Jeff Davis Co.|1969

Celotes nessus ae TsUdeC OHS e eaioeien TX\old

tm Celotes nessus (=notabilis)|15039C07|ST|USA:central TX|old

Celotes nessus|19012E03|F|USA:TX,Jeff Davis Co.|2018

, Celotes nessus|19012E05|USA:TX,Jeff Davis Co.|2018

6 Celotes nessus|2255|USA:TX,Williamson Co.|1971

0 Celotes nessus|15097F12|LT|USA:TX,Bexar Co.|old

HL 45 Celotes nessus|22104H10|USA:TX,Live Oak Co.|1940

s*S— Celotes nessus|22105A04|Mexico:Tam|1970

Celotes nessus|3956|USA:TX,Hidalgo Co.|2015

Celotes nessus|3370|M|USA:TX,Hidalgo Co.|2015

Celotes spurcus|17067E03|PT|Mexico:Queretaro|2007

7a, ~6Celotes spurcus|17067E04|PT|Mexico:Queretaro|2007

77 Celotes spurcus|22065E08|PT|Mexico:Queretaro|2007

7 Celotes spurcus|17067E05|PT|Mexico:Queretaro|2007

Celotes spurcus|22064H12|PT|Mexico:Queretaro|2007

7. Celotes limpia|2249|PT|USA:TX,Presidio Co.|1966

za Celotes limpia|19012E04|PT|USA:TX,Jeff Davis Co.|2018

Celotes limpia|2253|USA:TX, Brewster Co.|2003

Celotes limpia|2248|Mexico:Coah|1977

at 22

Fig. 41. Phylogenetic trees of Ce/otes inferred from protein-coding regions of a) the nuclear genome (autosomes) and b) the Z

chromosome. Different species are shown in different colors: C. sabinus sp. n. (red), C. nessus (blue), and C. spurcus (green).

Primary type specimens are labeled in magenta.

Barcode sequence of the holotype: Sample NVG-22105A02, GenBank OR578720, 658 base pairs:

AACTTTATATTTCATTTTTGGAATTTGAGCAGGCATAGTAGGTACTTCTCTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTCTAATTGGGGATGATCAAATTTATAATACT

ATTGTAACAGCACATGCCTTCATTATAATTTTTTTTATGGTAATGCCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCTGATATAGCATTCCCACGTA

TAAATAATATAAGATTTTGATTATTACCTCCTTCTTTAACACTTCTTATT TCAAGAAGTATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCTCTATCATCTAATATTGC

TCATCAAGGTTCATCTGTTGACTTAGCTATCTTTTCTTTACATCTAGCAGGAATTTCATCAATCTTAGGAGCAATTAACTTCATTACAACTATTATTAATATACGAATTAGAAATTTATCA

TTTGATCAAATACCTTTATTCGTATGAGCTGTAGGAATTACAGCATTACTTTTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACAT

CTTTCTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTT

Type material. Holotype: o& deposited in the California Academy of Sciences, San Francisco, CA, USA

[CAS], illustrated in Fig. 42, bears seven printed labels (date on the first label handwritten): six white

Academy of Sciences |], [DNA sample ID: | NVG-22105A02 | c/o Nick V. Grishin |, [ {QR Code}

CASENT | 8568344 ], and one red [ HOLOTYPE @ | Celotes sabinus | Grishin ]. Paratypes: 13c'c’, 499:

USA, Arizona: Mohave Co., 12 Hualapai Mts., lower el., 16-Apr-2008, Ken Davenport leg. (NVG-

20065A08, CSU_ENT1024696) [CSUC]; Ic nr. Wickieup, 30-Mar-1972, J. W. Tilden leg. (NVG-

22104H11, CASENT8568341) [CAS]; 12 Yavapai Co., 8 mi SW of Prescott, 21-Apr-1976, James W.

“Bill” Tilden leg. (NVG-22105A03, CASENT8568345) [CAS]; 1c Maricopa Co., Camp Creek on Cave

yg as eC

Fig. 42. Holotype of Celotes sabinus sp. n. in dorsal (left) and ventral (right) views, data in text.

Creek Rd., 12 mi NE of Jct. of Cave Creek and

Scottsdale Rds., 8-Apr-1968, J. A. Miller leg.,

genitalia NVG140320-91 (NVG-2250) [TAMU];

lo Gila Co., Sevenmile wash, 22-Aug-1960, P.

A. Opler leg. (NVG-22104H12, CASENT

8568342) [CAS]; Ic Pinal Co., Coronado Na-

tional Forest, Santa Catalina Mts., Peppersauce

Canyon, 26-Mar-2017, Q. Cong, J. Zhang, and N.

V. Grishin leg. (NVG-8304); Pima Co.: Id

Baboquivari Mts., Brown Canyon, 21-Mar-1938,

J. W. Tilden leg., genitalia J.W.T. 25-15 (NVG-

22104H08, CASENT8568338) [CAS] (Fig. 43a); \ ig AF,

Io Santa Catalina Mts., Molino Basin, 7-Sep- Pe b

1951, C. D. MacNeill leg. (NVG-22105A01, Fig. 43. genitalia of Celotes from USA, aa Tian

CASENT8568343) [CAS]; Santa Cruz Co.: 1c | a) Celotes sabinus sp. n. paratype, slide J. W. T. 25-15, AZ:

is ; Baboquivari Mts., Brown Canyon, 21-Mar-1938, DNA sample

ae pean eta i ee nk ot NVG-22104H08. b) Celotes nessus, slide 25-16, TX: George

eg. (NVG-2115); 2¢¢ Walker Canyon nr. Pena | west, 12-Jun-1940, DNA sample NVG-22104H10. Specimens

Blanca Lake, 16-Aug-1972, John Hafernik leg., | are in CAS, collected and genitalia prepared by J. W. Tilden.

genitalia NVG140320-92 & -93 (NVG-2251 & | Genital capsule is shown on the right, separated valva is on the

; os . left with aedeagus above it. Aedeagus of C. sabinus is shown

el i ceie Ae ae A — Rie ae in ventrolateral view as mounted on the slide.

nia Gulch, 30-Mar- , N. Grishin leg. -

5997); 1o& Patagonia, 24-Mar-1938, J. W. Tilden leg. (NVG-22104H09, CASENT8568339) [CAS]; 19

3.5mi SW of Patagonia, 6-Aug-1978, Jim P. Brock leg. (NVG-2116); Mexico: Sonora: 1c 16 mi E of

Tecoripa, 15-Mar-1984, Jim P. Brock leg. (NVG-2114); 12 8 mi W of Rio Yaqui, 16-Mar-1984, Jim P.

Brock leg. (NVG-2113); Ih ca. 8 mi NE of Bavispe, elevation ca. 4000’, 25-Mar-1998, Richard W.

Holland leg. (NVG-20066B02, CSU_ENT1024701) [CSUC].

Type locality. USA: Arizona, Pima Co., Santa Catalina Mountains, Sabino Canyon.

Etymology. The name is formed from the type locality of this species, Sabino Canyon, a place familiar to

many naturalists, which is just northeast of Tucson at the foothills of the Santa Catalina Mountains in

southeastern Arizona, where this species is common. The name ts a masculine adjective.

English name. Arizona streaky-skipper.

Distribution. Currently known from USA: Arizona and Mexico: Sonora and is likely present in south-

western New Mexico.

Comment. We were surprised to learn that C. sabinus sp. n. is more distant from C. nessus than morpho-

logically distinct C. spurcus, which is rather close to C. nessus genetically.

Charmion Nicéville, 1894 is a genus distinct from Celaenorrhinus Hibner, [1819]

Genomic tree reveals that Hesperia ficulnea

Celaenorrhinus aegiochus|18011B06|Panama|1981

Hewitson, 1868, the type species of the Celaenorrhinus monartus|18088A09|Mexico:Ver|2010

: ee ae C. eligius|18013G07|10-SRNP-20588|Costa Rica|2010

genus Charmion Nicéville, 1894 currently Celaenorrhinus syllius|7993|Ecuador|2002

: : : : Celaenorrhinus spilothyrus|18011B08|Sri Lanka|1976

regarded as a junior subjective synonym of Celaenorrhinus sumitra|21116C08|Indialold

. * Bettonula bettoni|18064A04|Uganda|1955

the genus Celaenorrhinus WHtibner [1819] Charmion ficulnea [not Celaenorrhinus]|18087G11|Indonesia|2010

: P 1; ligi Stoll 1781 : Seed Gacatarakraas(ksctmian ver:

arangesa dasahara anmar

(type pn le aa ie a ) 1S Stance a tertullianus|18073G06|Sierra Leone|old

Eretis melania|17069B02|Tanzania|1963

not ONO etic with It (Fig. 44 red). We Sape lucidella inot Sarangesaii18011C01|Kenya|1955

Pseudocoladenia dan|7331|Myanmar|2001

find that Bettonula Libert & Larsen, 2014 Apallaga mokeezi|18011B09|South entey8

(type species Celaenorrhinus bettoni Butler, UP e Menage Puke eve Uneral ee |

1902) renders Celaenorrhinus paraphyletic. Fig. 44. Nuclear genome tree (autosomes): Charmion (red) and

Celaenorrhinus (blue), Sape (magenta) and Sarangesa (green).

Therefore, to restore the monophyly, we

propose that Charmion Nicéville, 1894, stat. rest. is a genus distinct from Celaenorrhinus Hubner, [1819].

Sape Mabille, 1891 is a genus distinct from Sarangesa F. Moore, [1881]

Genomic tree reveals that Sape lucidella Mabille, 1891, the type species of the genus Sape Mabille, 1891

currently treated as a junior subjective synonym of the genus Sarangesa F. Moore, [1881] (type species

Sarangesa albicilia F. Moore, [1881]) is not monophyletic with it (Fig. 44 magenta). We find that Eretis

Mabille, 1891 (type species Eretis melania Mabille, 1891) renders Sarangesa paraphyletic. Therefore, to

restore the monophyly, we propose that Sape Mabille, 1891, stat. rest. is a genus distinct from Sarangesa

F. Moore, [1881].

Cupithina Grishin, new subtribe

http://zoobank. org/905E8 1 10-34EC-4CB3-A0C0-3F 90024 14D3E

Type genus. Cupitha F. Moore, 1884.

Definition. The tribe Astictopterini Swinhoe, 1912 splits into two clades containing approximately the

same number of genera, each supported by 100% of partitions (see Fig. | in Zhang et al. (2023b) and

Figs. 45, 46). Although neither clade is very prominent (branches separating them are not particularly

long), both are most strongly supported. Therefore, to bring order to the genera in Astictopterini, we

divide the tribe into two subtribes. The clade with the type species of the tribe contains generally larger

Species with more robust bodies and corresponds to the nominotypical subtribe. The second clade, with

Cupitha (type species Cupitha tympanifera F. Moore, 1884, which is a junior subjective synonym of

Pamphila purreea Moore, 1877), consists of smaller and frequently brighter patterned species and

corresponds to the subtribe without an available name. This new and mostly Afrotropical subtribe is

distinguished from its relatives by a combination of the following characters (Evans 1937; Evans 1949):

palpi either porrect with convergent 3 segment or erect with thin and erect 3™ segment; antennal club

with pointed apiculus, either obtuse or hooked; caudal angle of hindwing discal cell not bent up: median

vein and vein M3 collinear, end of cell relatively straight, and vein 3A usually shorter than vein CuAz;

thorax not shaggy beneath; coxae and tibiae of hindlegs not densely fringed; valvae symmetrical, uncus

typically narrowing to a point, ovate, terminal part narrow, frequently needle-like, uncus usually not

expanded terminally and not hourglass-shaped. Most confidently identified by DNA and a combination of

the following nuclear genomic base pairs is diagnostic: aly1775.3.2:A50G, aly27.16.1:A638C,

aly27.16.1:C644G, aly1603.20.3:G76C, aly1651.28.7:A167G.

Genera included. The type genus (1.e., Cupitha F. Moore, 1884), Acada Evans, 1937, Acleros Mabille,

1885, Andronymus Holland, 1896, Caenides Holland, 1896, Ceratricula Larsen, 2013, Fresna Evans,

1937, Gorgyra Holland, 1896, Gyrogra Lindsey & Miller, 1965, Hollandus Larsen & Collins, 2015,

Hypoleucis Mabille, 1891, Melphina Evans, 1937, Melphinyet Larsen, 2012, Noctulana Larsen, 2012,

Tribes Subtribes Genera Subgenera

tolefae Husnaoeseo irene saaiiecr

H TAL or Herila herilus|18064E01|Tanzania|1951

ea LULL FN Pardaleodes edipus|17108G05|Congo|1981

baialalall Gerais a eee EY rire

Argemma argyrosticta|18064D06|Cameroon|old

Acleros (lsocleros) mackenii|17092B05|South Africa|1968

gs Acleros (lsocleros) mackenii|18099G03|Kenya|old

Acleros (Isocleros) mackenii|20126G11|?ST|South Africalold

3e Acleros (Isocleros) instabilis [not mackenii]|18099G01|Kenya|1955

joo Acleros (Isocleros) instabilis [not mackenii]|18099G05|Uganda|1921

Acleros (Isocleros) instabilis [not mackenii]|21099E10|Kenya|1957

Acleros (lsocleros) olaus [not mackenii]|18073C07|ST|Congolold

700 Lp-g5 Acleros (Isocleros) olaus [not mackenii]|18099G02|Malawilold

Acleros (lsocleros) olaus (=nyassicola) [not mackenii]|20082G06|HT|Malawilold

Acleros (lsocleros) togo|22017G12|HT|Togo|1893

Isocleros su | se

— Acleros (Isocleros) togo|22047H11|PT|Liberia|1946

TT Acleros (lsocleros) ploetzi|18073C05|Gabon|1892

Acleros (lsocleros) bibundica|18073D06|ST|Equatorial Guinea|1904

Acleros (Acleros) leucopyga|18019F01|Madagascar|old

100 av Acleros (Acleros) nigrapex|21099E06|Cameroon|old

00 Acleros (Acleros) bobiri]21099E09|Ghana|1967

Acleros (Acleros) sparsum|7794|Cameroon|1987

Acleros (Paracleros) substrigata]17091H01|Cameroonlold

Acleros (Paracleros) biguttulus|18073D04|Equatorial Guinea|1913

5 Acleros (Paracleros) placidus|21099E04|Liberia|1958

Acleros

Paracleros 100

LI Andronymus caesar|17092B02|Uganda|1961

pe} Acada biseriata|17069G02|Kenya|1950

Teniorhinus watsoni|20126F12|T|Gabonlold

Fresna (Fresna) netopha|17092A07|Uganda|1960

Fresna 94 Fresna (Fresna) nyassae|18054G01|Malawi|1996

EE Fresna (Fresna) maesseni|21043E02|HT|Ghana|1970

Fresna (Fresna) carlo|21102B02|Cameroonlold

Fresna (Mesna) larea [not Meza]|19043D02|Tanzania|1930

Fresna (Mesna) mabea [not Meza]|20124H11|T|Gabon,Ogowelold

3 72 _Fresna (Mesna) bassa [not Meza leucophaea]|20124HO07|HT|Liberia|1956

Too ~Fresna (Mesna) bassa [not Meza leucophaea]|21099F09|PT|Liberia|1955

Fresna (Mesna) bassa [not Meza leucophaea]|21099F10|PT|Liberia|1955

re Fresna (Mesna) leucophaea [not Meza]|20124H08|T|Gabon|old

TO Fresna (Mesna) leucophaea [not Meza]|21099F08|Cameroon|old

Fresna (Mesna) leucophaea [not Meza]|21099F07|T|Gabon|old

73 Paronymus punctata [not Ceratrichia]|18073A05|HT|West Africalold

ago 140 Paronymus punctata [not Ceratrichia]|21099A08|Liberia|1955

Was Geratricula 36 Paronymus semilutea [was Ceratricula]|21099A09|Cameroon|old

ae 2, 100 Paronymus semilutea [was Ceratricula]|21118G05|ST|Nigeria|1885

3 Paronymus indeterminabilis [not semilutea, was Ceratricula]|18073A07|ST|Eq. Guinea|1906

100 00 Paronymus indeterminabilis [not semilutea, was Ceratricula]|18073A08|ST|Eq. Guinea|1906

Paronymus congdoni [not semilutea, was Ceratricula]|19043B08|Uganda|1956

Paronymus xanthias|18072H11|ST|Sierra Leonelold

7 Paronymus cybeutes pallida [not Meza]|19043D04|Uganda|1957

00 Paronymus cybeutes cybeutes [not Meza]|21099G07|Cameroon|old

aay,

Nido Fresna

Mesna subgen. n.

100

Cupithina subtrib. n. Paronymus

100 Paronymus cybeutes cybeutes [not Meza]|21099G06|ST|Gabonlold

700 Paronymus volta [not Meza cybeutes]|21043D12|HT|Ghana|1969

Paronymus volta [not Meza cybeutes]|21099G05|PT|Ghana|1970

Paronymus nevea|7804|Cameroon|1989

Paronymus indusiata [not Meza]|21099F11|Liberia|1958

F Paronymus hidaroides|KS19|Cameroon

7 Paronymus mabillei [not Meza]|21099G03|Cameroon|old

Paronymus ligora|21099G09|Cameroonlold

me Semalea sextilis|18075A02|T|Ghana|1882

5 Semalea arela|19043C07|Uganda|1953

Semalea corvinus [not sextilis]|18075A05|T|Sierra Leone|1887

Semalea pulvina|7803|Cameroon|1989

100 98 Semalea rega [was Xanthodisca]|18073A03|ST|Sierra Leone|old

Semalea rega (=evansi) [was Xanthodisca]|18087B08|T|Sierra Leone|1906

: Semalea rega (=staudingeri) [was Xanthodisca]|20125A08|HT|Cameroon|old

100 ony ee ik Semalea vibius [was Xanthodisca]|18096F03|Congo|old

was Xanthodisca 7 — Semalea vibius [was Xanthodiscal|7765|Cameroon|1987

Semalea vibius [was Xanthodisca]|18099F02|Uganda|1940

Semalea malawi|19043B12|Malawi|1940

Semalea

: Hypoleucis tripunctata|17091H02|Uganda|1960

Hypoleucis oo Hypoleucis ophiusa|18095A03|Cameroonlold

. Phe Hypoleucis dacena|18011C03|Cameroon|old

Astictopterini Xanthoneura Xanthoneura (Xanthoneura) corissa|17091D06|Borneol|old

Xanthoneura —- Xanthoneura (Xanthoneura) patmapana [not corissa]|18096B10|Javalold

Lippina subgen. n. Er Xanthoneura (Lippina) telesinus|17091D07|Philippines:Luzon|old

Xanthoneura (Lippina) obscurior|17091D08|Philippines:Luzon|1966

Dotta Dotta tura|17093B01|Tanzania|1954

Dotta stellata|17093B03|Kenya|1957

Dotta callicles|18054F12|Namibia|1992

To Galerga paroechus [was Perrotia]|18099H08|Madagascar|1990

Galerga kingdoni [was Perrotia]|21101B03|Madagascar|old

tal ps Galerga ariel [not Xanthodisca]|19043C03|Madagascar|old

do 86 Galerga albiplaga [was Perrotia]|21101B06|Madagascar|old

Galerga paroechus [was Perrotia]|7779|Madagascar|1990

Fulda Galerga ellipsis|7815|Madagascar|1988

100 Fulda coroller|7762|Madagascar|1991

Isoteinon lamprospilus|17091A08|Japan|1929

100 FOO Isoteinon abjecta|20126F10|Congo|1910

ye Isoteinon anomoeus [not Astictopterus]|21097H11|Liberia|1958

[700 Isoteinon punctulata [not Astictopterus]|21068F04|Africa|1956

Isoteinon inornatus [not Astictopterus]|21098A01|South Africalold

. Astictopterus chinensis|18021G05|China:Hong Kong|1960

Astictopterus i Astictopterus olivascens (=henrici)|20126G01|T|China:Hainan|old

a af Eee ATUGEEONIGcHaeeh ee

i i onza cretacea|17069H12|Nigeria|1951

Astictopterina 100 -— Pteroteinon laufella|7757|Liberia|1988

Hidari irava|7823|Singapore|1989

50 700 ZOphopetes MeL TAOIBINICcHalta

100 Zophopetes cerymica|21101B11|Nigeria|1965

Zophopetes 100 Zophopetes dysmephila|18099H09|Kenya|1958

Zophopetes nobilior|18075D05|T|Gabun|1892

Leona (Leona) stoehri|18075D01|HT|Togolold

100

Galerga

106

Isoteinon

100 100

Leona Tf 2° Leona (Leona) leonora|18087A09|Gabon|1969

9A 00 Leona (Leona) reali (=na)|20124HO6|HT|Liberia|1958

Leona ee TT EET TE Leona (Leona) lota|21101F02|Cameroon|old

Wen opala | Leona (Ganda) ganda [not Zophopetes]|21101B08|Cameroonlold

34 Leona (Mopala) orma|18094H04|Cameroon|old

Lennia Lennia binoevatus|21101F04|Gabon|old

= eS Lennia maracanda|21101F06|Gabonlold

Lennia lena|21101F07|Cameroon|old

Fig. 45. The phylogenetic tree of selected Ceratrichiini and Astictopterini inferred from protein-coding regions of the nuclear

genome (autosomes). Levels in the tree that approximately correspond to the taxonomic hierarchy are marked above as Tribes,

Subtribes, Genera, and Subgenera. Family-group names (roman font) and relevant genus-group names (genera in bold italics

and subgenera in italics) are shown by corresponding branches. New species are in green, clades of new subgenera are in

magenta, labels of taxa previously in Meza are in red, and others are colored as follows: elevated to species (blue), transferred

between genera (cyan; green arrows show the transfer), and included into other genera as subgenera or synonyms (violet).

Tribes Subtribes Genera Subgenera

Meza meza|17091H09|Cameroon|old

robe eg Herila herilus|18064E01|Tanzania|1951

Argemma argyrosticta|18064D06|Cameroonlold

Ceratrichia nothus|18053E03|no datajold

Acleros (Isocleros) mackenii|17092B05|South Africa|1968

AEleros (lsocleros) mackenii|18099G03|Kenyalold

cleros (lsocleros) mackenii|20126G11|?ST|South Africaljold

eteros (Isocleros) olaus [not mackenii]|18099G02|Malawilold

100 cleros (Isocleros) olaus (=nyassicola) [not mackenii]|20082G06|HT|Malawilold

Acleros (Isocleros) olaus [not mackenii]|18073C07|ST|Congolold

sn Acleros (Isocleros) instabilis [not mackenii]|21099E10|Kenya|1957

fen nian ean aan ioAAcleros (Isocleros) instabilis [not mackenii]|18099G01|Kenya|1955

Benet 80 Acleros (Isocleros) instabilis [not mackenii]|18099G05|Uganda|1921

Agleros (Isocleros) togo|22047H11|PT|Liberia|1946

Acleros (Isocleros) togo|22017G12|HT|Togo|1893

73 [oN Acleros (lsocleros) bibundica|18073D06|ST|Equatorial Guinea|1904

Acleros (lsocleros) ploetzi|18073C05|Gabon|1892

cleros (Paracleros) substrigata|17091H0O1|Cameroonl|old

Paracleros 1068

Acleros (Paracleros) biguttulus|18073D04|Equatorial Guinea|1913

[104 Acleros (Paracleros) placidus|21099E04|Liberia|1958

[\79 Acleros (Acleros) bobiri]21099E09|Ghana|1967

| 100 Acleros (Acleros) sparsum|7794|Cameroon|1987

[10 $F Acleros (Acleros) nigrapex|21099E06|Cameroon|old

Acleros (Acleros) leucopyga|18019F01|Madagascar|old

Acada biseriata|17069G02|Kenya|1950

Teniorhinus watsoni|20126F12|T|Gabon|old

Andronymus caesar|17092B02|Uganda|1961

Foo Fresna (Fresna) netopha|17092A07|Uganda|1960

[700 \ Fresna (Fresna) nyassae|18054G01|Malawi|1996

foe Fresna (Fresna) maesseni|21043E02|HT|Ghana|1970

Fresna (Fresna) carlo|21102B02|Cameroon|old

Fresna (Mesna) larea [not Meza]|19043D02|Tanzania|1930

Fresna (Mesna) mabea [not Meza]|20124H11|T|Gabon, Ogowe|old

Fresna (Mesna) bassa [not Meza leucophaea]|20124HO7|HT|Liberia|1956

A. (Mesna) bassa [not Meza leucophaea]|21099F09|PT|Liberia|1955

100 resna (Mesna) bassa [not Meza leucophaea]|21099F10|PT|Liberia|1955

Fresna (Mesna) leucophaea [not Meza]|21099F08|Cameroonlold

hy ontestta (Mesna) leucophaea [not Meza]|20124H08|T|Gabonlold

resna (Mesna) leucophaea [not Meza]|21099F07|T|Gabon|old

aaronymus punctata [not Ceratrichia]|21099A08|Liberia|1955

Paronymus punctata [not Ceratrichia]|18073A05|HT|West Africa|old

Paronymus semilutea [was Ceratricula]|21118G05|ST|Nigeria|1885

Acleros

100

was Ceratricula 100 100 Paronymus semilutea [was Ceratricula]|21099A09|Cameroonlold

cals . Paronymus indeterminabilis [not semilutea, was Ceratricula]|18073A07|ST|Eq. Guinea|1906

Cupithina subtrib. n. 100 99 10° Paronymus indeterminabilis [not semilutea, was Ceratricula]|18073A08|ST|Eq. Guinea|1906

Paronymus congdoni [not semilutea, was Ceratricula]|19043B08|Uganda|1956

Paronymus xanthias|18072H11|ST|Sierra Leone|old

62 Paronymus cybeutes pallida [not Meza]|19043D04|Uganda|1957

o Paronymus cybeutes cybeutes [not Meza]|21099G06|ST|Gabon|old

Paronymus cybeutes cybeutes [not Meza]|21099G07|Cameroon|old

faronymus volta [not Meza cybeutes]|21043D12|HT|Ghana|1969

aronymus volta [not Meza cybeutes]|21099G05|PT|Ghana|1970

Paronymus nevea|7804|Cameroon|1989

Paronymus ligora|21099G09|Cameroon|old

Paronymus mabillei [not Meza]|21099G03|Cameroon|old

Paronymus hidaroides|KS19|Cameroon

Paronymus indusiata [not Meza]|21099F11|Liberia|1958

Semalea corvinus [not sextilis]|18075A05|T|Sierra Leone|1887

Semalea sextilis|18075A02|T|Ghana|1882

Semalea a7 Semalea arela|19043C07|Uganda|1953

nog Semalea pulvina|7803|Cameroon|1989

Callie rega (=evansi) [was Xanthodisca]|18087B08|T|Sierra Leone|1906

emalea rega (=sierrae) [was Xanthodisca]|18073A01|ST|Sierra Leone|old

able rega [was Xanthodisca]|18073A03|ST|Sierra Leone|old

emalea rega (=staudingeri) [was Xanthodisca]|20125A08|HT|Cameroonj|old

bani vibius [was Xanthodisca]]18096F03|Congo|old

1o~emalea vibius [was Xanthodisca]|7765|Cameroon|1987

Semalea vibius [was Xanthodisca]|18099F02|Uganda|1940

Semalea malawi|19043B12|Malawi|1940

AGO [100 \ Hypoleucis tripunctata|17091H02|Uganda|1960

Astictopterini - p10 Hypoleucis ophiusa|18095A03|Cameroon|old

p Hypoleucis Hypoleucis dacena|18011C03|Cameroon|old

Xanthoneura Xanthoneura (Xanthoneura) corissa|17091D06|Borneolold

ONO eU TT 8 Lippina subgen.n, __—\ 10° Xanthoneura (Xanthoneura) patmapana [not corissa]|18096B10|Javalold

Lippina subgen. n. T700\, Xanthoneura (Lippina) telesinus|17091D07|Philippines:Luzon|old

Xanthoneura (Lippina) obscurior|17091D08|Philippines:Luzon|1966

[es \ Galerga paroechus [was Perrotia]|18099H08|Madagascar|1990

Galerga paroechus [was Perrotia]|7779|Madagascar|1990

Galerga ariel [not Xanthodisca]|19043C03|Madagascar|old

Galerga kingdoni [was Perrotia]|21101B03|Madagascar|old

Galerga albiplaga [was Perrotia]|21101B06|Madagascar|old

Galerga ellipsis|7815|Madagascar|1988

Fulda coroller|7762|Madagascar|1991

Dotta callicles|18054F12|Namibia|1992

Dotta stellata|17093B03|Kenya|1957

Dotta tura|17093B01|Tanzania|1954

Isoteinon abjecta|20126F10|Congo|1910

Isoteinon anomoeus [not Astictopterus]|21097H11

Isoteinon lamprospilus|17091A08|Japan|1929

EE Isoteinon punctulata [not Astictopterus]|21068F04|Africa|

Isoteinon inornatus [not Astictopterus]|21098A01|South Africalold

§tictopterus chinensis|18021G05|China:Hong Kong|1960

106 Astictopterus olivascens (=henrici)|20126G01|T|China:Hainanlold

Astictopterus jama|18089E02|Malaysia:Penang|1980

100 500 Monza SSM SIU A ga 1aqv787

j i 58 teroteinon laufella

Astictopterina Hidari irava|7823|Singapore|1989

Zophopetes haifa|17109A03|Kenya|1968

97 Zophopetes cerymica|21101B11|Nigeria|1965

31 Zophopetes 100 Zophopetes dysmephila|18099HO9|Kenya|1958

Zophopetes nobilior|18075D05|T|Gabun|1892

Leona (Leona) stoehri|18075D01|HT|Togolold

100

Paronymus

100 100

was Xanthodisca

Galerga

Astictopterus

100

82 teond 68 28 Leona (Leona) leonora|18087A09|Gabon|1969

Be Hy 100 Leona (Leona) lota|21101F02|Cameroonjold

Leona (Leona) reali (=na)|20124HO06|HT|Liberia|1958

Leona Mopala

100 P Leona (Mopala) orma|18094H04|Cameroonl|old

Leona (Ganda) ganda [not Zophopetes]|21101B08|Cameroon|old

O04 sonal Ganda subgen. n. ~ Lennia binoevatus|21101F04|Gabonlold

100 Lennia lena|21101F07|Cameroon|old

Lennia maracanda|21101F06|Gabonlold

Fig. 46. The phylogenetic tree of selected Ceratrichiini and Astictopterini inferred from protein-coding regions of the

mitochondrial genome. See Fig. 45 for notations.

Osmodes Holland, 1892, Osphantes Holland, 1896, Paracleros Berger, 1978 (see below), Paronymus

Aurivillius, 1925, Parosmodes Holland, 1896, Platylesches Holland, 1896, Rhabdomantis Holland, 1896,

Semalea Holland, 1896, Teniorhinus Holland, 1892, Xanthodisca Aurivillius, 1925 (see below),

Xanthonymus Grishin, 2019, and Zographetus Watson, 1893. All other genera placed in Astictopterini by

Zhang et al. (2023b) belong to the nominotypical subtribe Astictopterina.

Parent Taxon. Tribe Astictopterini Swinhoe, 1912.

Paracleros Berger, 1978 is a subgenus of Acleros Mabille, 1885

Acleros Mabille, 1885 (type species Cyclopides leucopyga Mabille, 1877) and Paracleros Berger, 1978

(type species Acleros biguttulus Mabille, 1889) are two phenotypically similar sister genera, which, taken

together, are prominently separated from others (Figs. 45, 46). COI barcode difference between their type

species is 9.1% (60 bp), which is borderline for distinct genera in many butterfly groups. Moreover,

Acleros, as currently circumscribed, is not a genetically prominent group and splits into two such groups

in the nuclear genome tree (Fig. 45): the nominotypical Ac/eros and the other one, which is proposed as a

new subgenus below. In the mitochondrial genome tree, Ac/eros is not even monophyletic, albeit with a

weaker support (Fig. 46). On the one hand, we see that Ac/eros and Paracleros taken together form a

prominent clade. On the other hand, Ac/eros and Paracleros are not prominently separated from each

other, and there is a third clade of nearly the same rank. This clade is currently included in Ac/leros but is

sister to Paracleros in the mitochondrial genome tree. Neither of these three groups consists of a large

number of species. For all these reasons, we propose to treat Paracleros Berger, 1978, stat. nov. as a

subgenus of Acleros Mabille, 1885.

Isocleros Grishin, new subgenus

http://zoobank.org/1 1OQEYE2-43 A8-422D-BF56-967608087687

Type species. Pamphila (?) mackenii Trimen, 1868.

Definition. As discussed in the previous section, Acleros Mabille, 1885 (type species Cyclopides

leucopyga Mabille, 1877) that includes Paracleros Berger, 1978 (type species Acleros biguttulus Mabille,

1889) splits into three prominent clades: the nominotypical Acleros, Paracleros, and the third clade not

associated with any available genus-group names (Figs. 45,46). The third clade represents a new

subgenus that keys to 41.B.(a) (excluding a”) or 41.B.(b)(b!) in Evans (1937) and is distinguished from its

relatives by darker distal half of ventral hindwing or if hindwing is more uniform in color then dorsal

forewing is with broadly white inner margin; tegumen with uncus are narrow in lateral view, uncus in

dorsal view is either bulb-shaped or continuously narrows to a point. A combination of the following

nuclear genomic base pairs is diagnostic: aly2627.4.1:T63A, aly2627.4.1:C69T, aly116.29.1:T2049A,

aly116.29.1:G2814A, aly9673.4.1:A480G.

Etymology. The name of the other subgenus was formed by adding the prefix par- (i.e., besides,

alongside) to the genus name. Similarly, we fuse the prefix iso- (1.e., similar, equal, the same) to the genus

name. The name is a masculine noun in the nominative singular.

Species included. The type species (1.e., Pamphila (?) mackenii Trimen, 1868), Acleros bibundica Strand,

1913, Acleros instabilis Mabille, 1889, Apaustus olaus Plétz, 1884, Acleros ploetzi Mabille, 1889, and a

new species described below.

Parent taxon. Genus Acleros Mabille, 1885.

Acleros ({socleros) instabilis Mabille, 1889 and Acleros [socleros) olaus (Pl6tz, 1884)

are Species distinct from Acleros [socleros) mackenii (Trimen, 1868)

Inspection of genomic trees (Figs. 45, 46) and analysis of genetic differentiation reveals that Acleros

instabilis Mabille, 1889 (type locality in Tanzania) and Apaustus olaus Plétz, 1884 (type locality in

Congo, syntype sequenced as NVG-18073C07) currently treated as subspecies of Acleros (Isocleros)

mackenii (Trimen, 1868), (type locality in South Africa, possible syntype sequenced as NVG-20126G11)

are genetically differentiated from it with Fs/COI barcode difference of 0.23/4% (26 bp) and 0.49/2.6%

(17 bp), respectively, and from each other with 0.39/4.7% (31 bp). Therefore, we propose to reinstate

these two taxa as species: Acleros ([socleros) instabilis Mabille, 1889, stat. rest. and Acleros (Isocleros)

olaus (Pl6tz, 1884), stat. rest.

Acleros nyassicola Strand, 1921 is a junior subjective synonym of Acleros ([socleros)

olaus (Pl6tz, 1884), not of Acleros ([socleros) mackenti (Trimen, 1868)

In the genomic trees, the holotype of Ac/eros nyassicola Strand, 1921 (type locality in Malawi, sequenced

as NVG-20082G06, in SDEI) reveals that it is not conspecific with Acleros (Isocleros) mackenii (Trimen,

1868), (type locality in South Africa, possible syntype sequenced as NVG-20126G11) and instead groups

with Acleros UIsocleros) olaus (Pl6tz, 1884), stat. rest. (type locality in Congo, syntype sequenced as

NVG-18073C07) (Figs. 45, 46). Therefore, we propose to treat Acleros nyassicola Strand, 1921 as a

junior subjective synonym of Acleros ([socleros) olaus (P16tz, 1884).

Acleros (Isocleros) togo Grishin, new species

http://zoobank.org/10245D25-D8E1-4342-A2AA-0104A185EA97

(Figs. 45-46 part, 47)

Definition and diagnosis. Genomic trees reveal that two specimens from Western Africa identified as

Acleros olaus (Pl6tz, 1884), stat. rest. (type locality in Congo, syntype sequenced as NVG-18073C07)

are not monophyletic with A. olaus and form a clade approximately equidistant from it and Acleros

mackenii (Trimen, 1868) (type locality in South Africa, possible syntype sequenced as NVG-20126G11)

with Acleros instabilis Mabille, 1889, stat. rest. (type locality in Tanzania) (Figs. 45, 46), suggesting that

these two specimens belong to a distinct species. Its genetic differentiation measured by Fs/COI barcode

difference is: 0.31/5.5% (36 bp) from A. olaus, 0.31/4.7% (31 bp) from A. mackenii, and 0.41/5.3% (35 bp

from A. instabilis, which is substantial and provides strong support for these two specimens as

Fig. 47. Holotype & (a) and paratype ? (b) of Ac/eros togo sp. n. in dorsal (left) and ventral (right) views, data in text.

representatives of a new species. This species is distinguished from its relatives by the following

combination of characters: forewing subapical spots are present, yellowish above and purplish beneath

(not white in the specimens of the type series), diffuse, nearly in line (spot by costa is not strongly offset

distad from others), other forewing spots are crisper, with sharper defined edges, the spot in cell CuAo-

1A+2A on ventral forewing is with equally sharp edges (not more diffuse and disappearing towards the

outer margin), forewing spot in cell CuA1-CuAz is closer to the spot in cell CuA2-1A+2A than in A. olaus.

Due to variability in phenotype, this rather cryptic species is confidently identified by DNA: in the

nuclear genome: aly164.2.2:C73A, aly173.7.6:A182T, aly8937.5.1:A305G, aly1260.26.1:A247G, aly24.4.2:

G63T and in the COI barcode: T38A, T91C, T376A, G380A, A514C, T571C.

Barcode sequence of the holotype: Sample NVG-22017G12, GenBank OR589638, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATAATAGGATCATCTTTAAGATTATTAATTCGTACAGAATTAGGTAACCCTGGATCCTTAATCGGAGATGATCAAATTTATAATACA

ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTCTTATATTAGGAGCTCCTGATATAGCTTTCCCCCGAA

TAAATAATATAAGATTTTGAATACTTCCCCCATCTTTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACTGGCTGAACTGTTTACCCCCCTCTTTCTTCTAATATTGC

ACATCAAGGATCATCAATTGATTTAGCTATTTTTTCTTTACATTTAGCCGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAAAAATATATCA

TTTGATCAATTACCTTTATTTATTTGATCCGTAGGTATTACTGCTTTACTTTTACTTTTATCTCTACCTGTTTTAGCAGGTGCTATCACAATACTTCTTACTGACCGAAACTTAAATACTT

CTTTTTTCGATCCTGCCGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ¢ deposited i in the Zoologische Staatssammlung Miinchen, Germany [ZSMC],

illustrated in Fig. 47a, bears six labels: 2" blue, last red, and others white [ 43390 ], [ Togo | Misahohe |

1893 | E. Baumann S. |, [| 363 | 7.XII.93 | A. olaus ], [ olaus | Plotz |, [ DNA sample ID: | NVG-22017G12

| c/o Nick V. Grishin ], and [ HOLOTYPE o@ | Acleros ([socleros) | togo Grishin |. Paratype: ° Liberia:

Monrovia, Firestone Plantation, Dec-1946, Harry A. Beatty leg. (NVG-22047H11) [CUIC] (Fig. 47b).

Type locality. Togo: Misahéhe.

Etymology. The name is given for the country with the type locality. The name is a noun in apposition.

Distribution. Western Africa, recorded from Togo and Liberia.

Taxonomic rearrangement of species currently in the genus Meza Hemming, 1939

The genus Meza Hemming, 1939 (type species Hesperia meza Hewitson, 1877) currently consists of 10

species. Genomic trees reveal that the genus is not monophyletic (Figs. 45, 46) and partitions according to

the three sections of the identification key provided by Evans (1937): (i) no secondary sexual characters;

(ii) male dorsal hindwing with a hair tuft that overlays bases of veins CuA; and CuAz2 and (i) hair tuft

enters a pouch either at the end of discal cell or along the median vein. The type species M. meza—

section (1), no tuft—belongs to the tribe Ceratrichiini Grishin, 2019 and other species (with tuft) belong to

two clades in the tribe Astictopterini Swinhoe, 1912. Section (11) consists of three species and is sister to

the genus Fresna Evans, 1937 (type species Hesperia netopha Hewitson, 1878). Although this clade is

prominent, it is at the tree level of a subgenus (Figs. 45, 46). We include these species in Fresna, forming

the following new combinations: Fresna larea (Neave, 1910), comb. nov., Fresna leucophaea (Holland,

1894), comb. nov., and Fresna mabea (Holland, 1894), comb. nov. All the remaining species are from

section (111) and are dispersed within the clade corresponding to the genus Paronymus Aurivillius, 1925

(type species Hesperia ligora Hewitson, 1876) (Figs. 45, 46). We assign them to this genus, forming new

combinations: Paronymus banda (Evans, 1937), comb. nov., Paronymus cybeutes (Holland, 1894),

comb. nov., Paronymus elba (Evans, 1937), comb. nov., Paronymus gardineri (Collins & Larsen, 2008),

comb. nov., Paronymus indusiate (Mabille, 1891), comb. nov., Paronymus mabillei (Holland, 1893),

comb. nov. As a result, Meza becomes monotypic to consist of only the type species VM. meza, while other

Species currently in Meza are transferred to Fresna or Paronymus.

Mesna Grishin, new subgenus

http://zoobank.org/A3 DDA72C-3 E34-42E8-82FF-45771 5 B8E65E

Type species. Parnara leucophaea Holland, 1894.

Definition. As discussed above, Meza Hemming, 1939 (type species Hesperia meza Hewitson, 1877) was

not monophyletic, and some of its species formed a clade sister to Fresna Evans, 1937 (type species

Hesperia netopha Hewitson, 1878) (Figs. 45, 46). To restore the monophyly, we placed these species in

Fresna. However, they are genetically and morphologically distinct from other Fresna and constitute a

new subgenus. Species of this new subgenus key to 44.B. in Evans (1937) and are distinguished from

similar-looking species (e.g., Meza and Paronymus) by the following characters: male dorsal hindwing

with a hair tuft that overlays bases of veins CuA; and CuA2 (does not enter a pouch either at the end of

discal cell or along the median vein as in Paronymus; Meza lacks the tuft) and uncus narrowly squared at

the tip in dorsal view, not terminating in a sharp point (as in Paronymus), and not bulb-shaped (as in

Meza). A combination of the following nuclear genomic base pairs is diagnostic: aly1249.14.7:T1966C,

aly 1249.14.7:C2004T, aly536.106.2:A3984G, aly1656.5.1:A135C, aly8937.7.1:A198C.

Etymology. The name indicates that these species started in the genus Me[za| and ended in [Fre]sna. The

name is a feminine noun in the nominative singular.

Species included. The type species (1.e., Parnara leucophaea Holland, 1894), Meza leucophaea bassa

Lindsey & L. Miller, 1965 (see below), Parnara larea Neave, 1910, and Parnara mabea Holland, 1894.

Parent taxon. Genus Fresna Evans, 1937.

Fresna (Mesna) bassa (Lindsey & L. Miller, 1965) is a species distinct

from Fresna (Mesna) leucophaea (Holland, 1894)

Genetic differentiation between Meza leucophaea bassa Lindsey & L. Miller, 1965 (type locality in

Liberia, holotype sequenced as NVG-20124H07) that we placed in the genus Fresna Evans, 1937 (type

species Hesperia netopha Hewitson, 1878) and Fresna leucophaea leucophaea (Holland, 1894) (type

locality in Gabon, syntypes sequenced as NVG-21099F07 and NVG-21099F08) is notable, e.g., COI

barcode differ by 3.3% (22 bp) and the two taxa form separate clades in genomic trees (Figs. 45, 46).

Therefore, we propose that Fresna (Mesna) bassa (Lindsey & L. Miller, 1965), stat. nov. is a species

distinct from Fresna (Mesna) leucophaea (Holland, 1894).

Paronymus volta (L. Miller, 1971) is a species distinct

from Paronymus cybeutes (Holland, 1894)

Genetic differentiation as measured by Fs/COI barcode difference between Meza cybeutes volta Miller,

1971 (type locality in Ghana, holotype sequenced as NVG-21043D12) that we placed in the genus

Paronymus Aurivillius, 1925 (type species Hesperia ligora Hewitson, 1876) and Paronymus leucophaea

leucophaea (Holland, 1894) (type locality in Gabon, syntype sequenced as NVG-21099G06) is:

0.43/3.8% (25 bp) and the two taxa form separate clades in genomic trees (Figs. 45, 46). Therefore, we

propose that Paronymus volta (L. Miller, 1971), stat. nov. is a species distinct from Paronymus cybeutes

(Holland, 1894). Paronymus cybeutes pallida (Holland, 1896) (type locality in Congo) does not differ

prominently from the nominotypical subspecies, and we retain it as a subspecies of P. cybeutes.

Ceratricula Larsen, 2013 is a Junior subjective synonym

of Paronymus Aurivillius, 1925

The genus Ceratricula Larsen, 2013 (type species Ceratrichia semilutea Mabille, 1891) forms a tight

clade within Paronymus Aurivillius, 1925 (type species Hesperia ligora Hewitson, 1876) that is a

confident sister to Paronymus xanthias (Mabille, 1891) (type locality in Nigeria) (Figs. 45, 46) rendering

Paronymus paraphyletic. To restore the monophyly, we propose that Ceratricula Larsen, 2013, syn. nov.

is a junior subjective synonym of Paronymus Aurivillius, 1925.

Paronymus punctata (Holland, 1896), new combination;

its type locality is Sierra Leone: Freetown

The name Ceratrichia punctata (type locality in “Tropical West Africa”) was published by Holland

(1896) in synonymy with Ceratrichia phocion (Fabricius, 1781) (type locality in South Africa) and

attributed to Mabille as a “MS. name”, with the holotype specimen (“another male ... has been designated

as the type’’) from the Staudinger collection, now in MFNB. A short description was provided: “primaries

more spotted than is quite usual.” Evans (1937) used the name “Ceratrichia punctata Holland” as valid,

attributing it to Holland’s publication and citing the same “type” specimen in Berlin. Therefore, under

Articles 11.6.1 and 50.7 of the ICZN Code (1999), the name Ceratrichia punctata Holland 1896 is

currently both available and valid and is based on the holotype in Berlin. N.V.G. found the holotype,

which bears a purple “Origin.” label, an identification label in Mabille’s handwriting, “C. punctata / Mab.

o”’, and an identification label in Holland’s handwriting, “Ceratrichia / phocion, / &”’, among several

others. The locality label on the holotype is “Frtn. / Pr.” meaning that it was collected by Preuss in

Freetown, Serra Leone. German botanist Paul Rudolph Preuss collected in Sierra Leone in 1886—1888

(Barnhart 1965), giving a possible range of dates when the holotype was captured.

Genomic sequencing of the holotype (NVG-18073A05) places it as sister to Paronymus semilutea

(Mabille, 1891) (type locality in Nigeria, syntype sequenced as NVG-21118G05) (Figs. 45, 46), being

distinct from it due to genetic differentiation, e.g., COI barcode difference of 2.1% (14 bp). Therefore, we

propose Paronymus punctata (Holland, 1896), comb. nov. The holotype of P. punctata is not conspecific

with the species Evans (1937) identified as C. punctata: e.g., the holotype has ventral forewing nearly

uniformly brown without pale areas by the inner margin characteristic of Evans’ C. punctata; smaller

forewing and ventral hindwing spots, and brownish tuft of hair-like scales by the base of dorsal hindwing.

Evans’ C. punctata lacks androconia and is a species of Ceratrichia Butler, 1870 (type species Papilio

nothus Fabricius, 1787); it does not have a name. This new species is described below.

Ceratrichia notata Grishin, new species

http://zoobank.org/3 BD674EC-B 100-4309-8 18 1-393 A29D4EE03

Definition and diagnosis. As shown above, Evans misidentified Paronymus punctata Holland, 1896,

comb. nov. The distinctive species he considered “Ceratrichia punctata” does not have a name and is

new. This new species keys to 31.A.(b)(b*)(a*) in Evans (1937) and is identified by a combination of

brown dorsal forewing with white dots, single (upper) dot in discal cell, ventrally with pale-yellow area

by inner margin; most of dorsal hindwing is yellow with costal third brown, ventrally pale yellow, not

white, broadly brown at the outer margin and with submarginal dots encircled with brown, such dot in the

discal cell, and (frequently replaced with brown spots) 3—4 additional dots around.

Type material. Holotype: & deposited in the African Butterfly Research Institute, Nairobi, Kenya

[ABRI], collected in Central African Republic: Zomea, Oct-1982, ABRI-2019-2412, and its photographs

can be found in Williams (2023a), as the male “Ceratrichia punctata’ (misidentification). Paratypes:

20h 299: 12 with the same data as the holotype but Sep-1996 and ABRI-2019-2413; others in BMNH:

1o¢ 19 from Cameroon and 1c from Angola.

Type locality. Central African Republic: Zomea.

Etymology. This species was previously misidentified as “punctata”, which means “dotted” in Latin. A

Latin synonym of “punctata” is “notata”, which is adopted as the name of this species. The name “notata”

can also be translated as “noted”, and this species is noted for its larger white dots and bright colors and

for the confusion about its name due to misidentification that genomic analysis of primary type specimens

helped to resolve. The name is a feminine adjective.

Distribution. Western Africa, recorded from Cameroon, Central African Republic, and Angola.

Paronymus indeterminabilis (Strand, 1912) and Paronymus congdoni (Larsen, 2013)

are Species distinct from Paronymus semilutea (Mabille, 1891)

Genomic trees reveal that sister taxa Ceratrichia indeterminabilis Strand, 1912 (type locality Equatorial

Guinea [not Cameroon!]|: Benito [river] area, Monte Alen, syntypes sequenced as NVG-18073A07 and

NVG-18073A08) and Ceratricula semilutea congdoni Larsen, 2013 (type locality in Uganda) prior to this

publication treated as subspecies of Ceratricula semilutea (Mabille, 1891) (type locality Nigeria: Lagos,

syntype sequenced as NVG-21118G05) that we placed in Paronymus Aurivillius, 1925 (type species

Hesperia ligora Hewitson, 1876) (see above), are not monophyletic with C. semilutea (Figs. 45, 46) and

are well differentiated from it genetically with COI barcode difference of 3.0% (20 bp) and 3.6% (24 bp),

respectively, and from each other of 3.3% (22 bp). Therefore, we propose to treat them as species-level

taxa: Paronymus indeterminabilis (Strand, 1912), stat. rest. and Paronymus congdoni (Larsen, 2013),

Stat. nov.

Sematlea corvinus (Mabille, 1890) is a species distinct

from Semalea sextilis (Plétz, 1886)

Genomic sequencing of Cobalus corvinus Mabille, 1890 (type locality in Sierra Leone, type sequenced as

NVG-18075A05) currently treated as a junior subjective synonym of Semalea sextilis (Plétz, 1886) (type

locality in Ghana) reveals that it is not monophyletic with it and instead originates deep in the radiation of

Semalea Holland, 1896 (type species Hesperia pulvina Plotz, 1879) (Figs. 45, 46). Therefore, we reinstate

Semalea corvinus (Mabille, 1890), stat. rest. as a species-level taxon.

Xanthodisca Aurivillius, 1925 is a junior subjective synonym

of Semalea Holland, 1896

Genomic trees reveal that Semalea Holland, 1896 (type species Hesperia pulvina Plotz, 1879) in

paraphyletic with respect to Xanthodisca Aurivillius, 1925 (type species Astictopterus vibius Hewitson,

1878) (Figs. 45, 46). Restoring monophyly, we propose that Xanthodisca Aurivillius, 1925, syn. nov. is a

junior subjective synonym of Semalea Holland, 1896 due to genetic similarity.

Semalea malawi Grishin, new species

http://zoobank.org/A 1A A303B-9ABF-4F7C-B84B-2ABD765583DF

(Figs. 45—46 part, 48)

Definition and diagnosis. The mitochondrial genome tree reveals that a specimen from Malawi identified

as Semalea vibius (Hewitson, 1878), comb. nov. (type locality in Gabon) is sister to both S. vibius and

Semalea rega (Mabille, 1889), comb. nov. (type locality in Sierra Leone) (Fig. 46), suggesting that it is a

third species distinct from them. We sequenced primary type specimens of all four names associated with

S. rega and confirmed their synonymy (Figs. 45, 46). Specimens from western Africa (Cameroon, Congo)

serve as references for S. vibius. Therefore, the third species is new. In the COI barcode, it differs from S.

vibius by 1.1% (7 bp), which is larger than the difference between S. vibius and S. rega of 0.6% (4 bp).

Despite this moderate difference in the barcode, Fst/Gmin of 0.35/0.008 for S. vibius and S. rega indicate

that they are distinct species, in agreement with phenotypic distinction. However, we could not compute

these statistics for the new species because it is known from a single specimen (at least two specimens are

needed). This new species is distinguished from its relatives by the lack of subapical spots on the

forewing, larger forewing orange patch that reaches closer to the outer margin, palpi beneath and cheeks

more orange than yellow in color, and largely brown ventral hindwing, which is unspotted, and sparsely

overscaled with orange. Due to variability in phenotype, confidently identified by DNA: in the nuclear

genome: aly281.6.2:A130G, aly281.6.2:C131T, aly1249.8.1:T514C, aly1603.31.1:A370C, aly37338.23.1:C264T,

aly54.4.1:T1461T (not A), aly6648.1.2:A161A (not C), aly5294.20.2:T630T (not C), aly386.8.2:A506A (not T),

aly393.3.1:A492A (not G) and in the COI barcode: T88C, T118C, T139A, T202C, T547T, T610T, T646T.

Fig. 48. Holotype of Semalea malawi sp. n. in dorsal (left) and ventral (right) views, data 1n text.

Barcode sequence of the holotype: Sample NVG-19043B12, GenBank OR589640, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATATTAGGAACATCTTTAAGTTTATTAATTCGAACTGAATTAGGTAATCCTGGCTCATTAATTGGAGATGATCAAATTTATAACACA

ATT GTAACAGCTCATGCATTTATTATAATTTTTTT TATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAA

TAAATAATATAAGATTTTGATTACTTCCCCCCTCCCTTACCTTATTAATCTCAAGAAGAATT GTAGAAAATGGAGCTGGAACTGGATGAACTGTCTATCCCCCCCTTTCATCTAATATTGC

TCACCAAGGTTCTTCTGTTGATTTAGCAATCTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTATCT

TTT GATCARCTACCTTTATTIGTTIGATCTIGTIGGTATTACTGCTIETACTTCTICTETCTITCTITACCTGTTTTAGCT GGAGCTATTACAATATTATTAACTGATCGTAATCTTAATACTT

CTTTTTTTGACCCTGCTGGAGGAGGAGACCCTATTCTTTATCAACATTTATTT

Type material. Holotype: & deposited in the American Museum of Natural History, New York, NY,

USA [AMNH], illustrated in Fig. 48, bears five labels: four white [ 11-viti-40. | & | Vizara | 2600’. |

Grishin ], [ {QR Code} | AMNH_IZC 00337937 |, and one red [ HOLOTYPE o& | Semalea malawi |

Grishin ].

Type locality. Malawi: ca. 9 mi E of Nkhata Bay, Vizara Rubber Plantation, elevation 2600’.

Etymology. The name is given for the country with the type locality. The name is a noun in apposition.

Distribution. Currently known only from the holotype collected in Malawi.

The type locality of Osmodes staudingeri Holland, 1896 is Cameroon: Efoulan

The type locality of Osmodes staudingeri Holland, 1896, currently treated as a junior subjective synonym

of Semalea rega (Mabille, 1889), comb. nov. (type locality in Sierra Leone) was given in the original

description as “Valley of the Ogové” (Holland 1896), which is in Gabon, frequently spelled as Ogooué

River Valley. This species was described from the female holotype in Holland’s collection, which is in

CMNH: “Type [not types] in my collection” and “I do not know the male of this species. The solitary

female in my collection ...,” which was illustrated (Holland 1896). N.V.G. found a female in CMNH with

the following five labels, white, but the 4" (without any text) red: [ Efulen, | Kamerun, | A. I. Good |

ID: | NVG-20125A08 | c/o Nick V. Grishin |. The female matches the original description perfectly and

agrees with the illustration rather closely. Provided that it carries its identification label (2"¢ label) in

Holland’s handwriting, it is the holotype of O. staudingeri. However, the locality label does not mention

“Valley of the Ogové,” but points to Cameroon: Efoulan (in current spelling). This is a more likely

locality because this species is not otherwise known from Gabon but recorded from Cameroon (Williams

2023b). Therefore, we hypothesize that the locality in the original description is erroneous, and the

locality label on the holotype points to its provenance. Hence, the type locality of O. staudingeri is

Cameroon: Efoulan, and genomic sequencing of the holotype confirms this taxon as a junior subjective

synonym of S. rega (syntype in MFNB sequenced as NVG-18073A03) (Figs. 45, 46).

Xanthoneura patmapana (Fruhstorfer, 1911) is a species distinct

from Xanthoneura corissa (Hewitson, 1876)

Two phenotypically different subspecies, Xanthoneura corissa corissa (Hewitson, 1876) (type locality in

Kalimantan) and Xanthoneura corissa patmapana (Fruhstorfer, 1911) (type locality in Java), are

genetically differentiated (Figs. 45,46) and differ by 4.1% (27 bp) in their barcodes. Therefore, we

propose treating Xanthoneura patmapana (Fruhstorfer, 1911), stat. nov. as a species distinct from

Xanthoneura corissa (Hewitson, 1876).

Lippina Grishin, new subgenus

http://zoobank.org/22B4014B-4B5D-45D4-8283-6C65583887B7

Type species. Carystus telesinus Mabille, 1878.

Definition. Genomic trees reveal that while Xanthoneura Eliot, 1978 (type species Hesperia corissa

Hewitson, 1876) is monophyletic (and we keep it as a single genus), it deeply splits into two clades: the

nominotypical and unnamed that represents a new subgenus. Members of this new subgenus key to

J.10.23. in Evans (1949) and are distinguished from their relatives by the 3% segment of palpi stout and

bent forward, ventral hindwing largely unmarked (or with a central spot), veins not yellower, forewing

with a spot in cell Mo-M3 right above the spot in cell M3-CuAj, these two spots together give an

appearance of a single larger spot; uncus in dorsal view much narrower than long, narrowing in the

middle, divided, arms small knob-like, not widely separated. A combination of the following nuclear

genomic base pairs is diagnostic: alyS77.16.2:T174C, aly577.16.2:TI198A, aly577.16.2:A216G, aly1591.7.3:

A333C, aly1222.40.2:A15G.

Etymology. The species of this subgenus are from [Phi|/ippin[es|+a. The name is a feminine noun in the

nominative singular.

Species included. The type species (1.e., Carystus telesinus Mabille, 1878) and Xanthoneura obscurior de

Jong & Treadaway, 2007.

Parent taxon. Genus Xanthoneura Eliot, 1978.

Perrotia Oberthiir, 1916 is a Junior subjective synonym of Galerga Mabille, 1898

Genomic trees reveal a tight clade of Malagasy species sister to a Malagasy genus Fulda Evans, 1937

(type species Hesperia coroller Boisduval, 1833) (Fig. 45, 46). Currently, these species are placed in two

genera: Perrotia Oberthiir, 1916 (type species Perrotia albiplaga Oberthitir, 1916) and Galerga Mabille,

1898 (type species Galerga hyposticta Mabille, 1898). However, the two genera are genetically close,

e.g., the COI barcode difference between their type species is 7.3% (48 bp), and not distinctly

differentiated from each other. Therefore, we propose to treat Perrotia Oberthiir, 1916, syn. nov. is a

junior subjective synonym of Galerga Mabille, 1898.

Galerga ariel (Mabille, 1878), new combination

Currently in Xanthodisca Aurivillius, 1925 (type species Astictopterus vibius Hewitson, 1878), Pamphila

ariel Mabille, 1878 (type locality in Madagascar) is not monophyletic with it and instead originates deep

within Galerga Mabille, 1898 (type species Galerga hyposticta Mabille, 1898) (Figs. 45, 46), where we

place it as Galerga ariel (Mabille, 1878), comb. nov.

Afrotropical species of Astictopterus C. Felder & R. Felder, 1890 belong

to [soteinon C. Felder & R. Felder, 1862

Genomic trees reveal that Afrotropical species currently placed in Astictopterus C. Felder & R. Felder,

1860 (type species Astictopterus jama C. Felder & R. Felder, 1860) are not monophyletic with it and

Tis

instead originate within /soteinon C. Felder & R. Felder, 1862 (type species Isoteinon lamprospilus C.

Felder & R. Felder, 1862) (Fig. 45, 46). Therefore, to restore monophyly, we transfer these species from

Astictopterus to Isoteinon, forming the following new combinations: /soteinon anomoeus (Pl6tz, 1879),

comb. nov. (type locality in Ghana), /soteinon bruno (Evans, 1937), comb. nov. (type locality in

Tanzania), [soteinon inornatus (Trimen, 1864), comb. nov. (type locality in South Africa), and /soteinon

punctulata (A. Butler, 1895), comb. nov. (type locality in Tanzania).

Mopala Evans, 1937 is a subgenus of Leona Evans, 1937

The monotypic genus Mopala Evans, 1937 (type species /smene ? orma P\6tz, 1879), which stands out by

the large white patch on ventral hindwing and otherwise unspotted wings, is genetically close to Leona

Evans, 1937 (type species Hesperia leonora Plotz, 1879) in our genomic trees (Fig. 45, 46), while they

both are distant from other genera that are their closest relatives. Male genitalia in both genera are similar

in the shape of uncus and valva, and all these species could be accommodated within one genus. Because

Mopala and Leona were described in the same work published on the same date, as the first revisers, we

give priority to Leona due to it being a larger genus, and propose that Mopala Evans, 1937 stat. nov. is a

subgenus of Leona Evans, 1937.

Ganda Grishin, new subgenus

http://zoobank.org/P9A4C7BA6-2C42-47E6-B619-ES54A20FF850E

Type species. Zophopetes ganda Evans, 1937.

Definition. Described by Evans (1937) in the genus Zophopetes Mabille, 1904 (type species Pamphila

dysmephila Trimen, 1868) and kept in it since, Z. ganda (type locality in Ivory Coast) is not monophyletic

with Zophopetes and instead is in the same clade with Leona Evans, 1937 (type species Hesperia leonora

Pl6tz, 1879) and its subgenus Mopala Evans, 1937 (type species Ismene ? orma Plétz, 1879): sister to the

subgenus Leona in the nuclear genome tree (Fig. 45) and sister to both Leona and Mopala, but less

confidently, in the mitochondrial genome tree (Fig. 46). In either case, it is closely related to them both

and yet genetically differentiated from them at approximately the same level as they are from each other.

Therefore, similarly to Mopala, the lineage with Z. ganda represents a subgenus of Leona. This new

subgenus keys to 53.A. in Evans (1937) and is distinguished from its relatives by males with a brand

(from the base of vein CuA; to near vein 1A+2A) and an apical spot on dorsal forewing (both absent in

Zophopetes), ventral hindwing uniformly pale-brown with small dark-brown-framed spots (not like Leona

and Mopala); upturned harpe, uncus in dorsal view narrower than in Zophopetes, especially in the middle,

with smaller knob-shaped arms. A combination of the following nuclear genomic base pairs is diagnostic:

aly1038.19.1:T165C, aly1405.10.1:T456C, aly925.11.3:A69G, aly587.17.1:T205A, aly2127.3.3:A24G,

aly 1838.61.1:T618T (not C), aly1838.61.1:T675T (not A), aly4305.26.4:C31C (not G), aly27.16.1:C354C (not

A), aly614.16.1:A1098A (not G).

Etymology. The name is a feminine noun in the nominative singular, a tautonym of the type species name.

Species included. Only the type species.

Parent taxon. Genus Leona Evans, 1937.

Balenga Grishin, new genus

http://zoobank. org/2 1 C6F5FF-4E85-4D88-AD3B-DO10BIFIIF7B

Type species. Proteides balenge Holland, 1891.

Definition. Currently, Gretnini Grishin, 2019 is a monotypic tribe consisting of a single genus Gretna

Evans, 1937 (type species Hesperia cylinda Hewitson, 1876). Inspection of genomic trees reveals that

Grenta balenge (Holland, 1891) (type locality in Gabon) is strongly differentiated genetically from the

rest of the genus (e.g., COI barcode difference of 10.9%, 72 bp), at least to the same extent as /sma

Distant, 1886 (type species /sma obscura Distant, 1886) from Jambrix Watson, 1893 (type species

Nisoniades salsala F. Moore, 1866) or Hyarotis F. Moore, 1881 (type species Papilio adrastus Stoll,

1780) from Quedara Swinhoe, 1919 (type species Quedara comoplea Swinhoe, 1919) and is at the tree

level corresponding to genera. Therefore, the lineage with G. balenge represents a genus-level taxon (Fig.

49). This new genus keys to 57.B. in Evans (1937) and is distinguished from its relatives by the subapical

forewing spot in cell Rs-M; being offset distad from others, uncus with processes at its base directed

sideways (one on each side, no processes in Gretna), and deeper separation between harpe and ampulla

that is more expanded than in Gretna. A combination of the following COI barcode base pairs is

diagnostic: T206C, A494T, A520C, A562C, A586T.

Etymology. The name is a feminine noun in the nominative singular, formed from the type species name.

Species included. Only the type species.

Parent taxon. Tribe Gretnini Grishin, 2019.

Gretna (Gretna) bugoma|21101C12|Cameroonl|old

{Gretna (Gretna) carmen|19043D09|Congo|1910

57 Gretna (Gretna) waga|21101D02|Cameroonl|old

Gretna (Gretna) capra [not carmen]|19043D08|Kenya|1933

Gretna (Gretna) cylinda|21101D07|Liberia|1958

Gretna (Zarida) lacida]21101D06|Cameroon|old

Gretna (Zarida) zaremba|21101D03|Cameroon|old

Balenga balenge zowa [not Grenta]|20124H02|HT|Liberia|1958

Balenga balenge balenge[not Grenta]|21101D09|Cameroonl|old

Isma protoclea purpurascens|17091D04|Sarawak|1966

Isma iapis|7774|Malaya|1989

Isma bononia|18014E03|Thailand|1899

Isma cronus|21105E10|Javal|old

Isma umbrosa|18101F07|Borneo|old

Isma guttulifera|18074E10|ST|Borneolold

Idmon latifascia|18101B04|Borneo|old

Idmon obliquans|21104H07|Borneolold

Idmon distanti|7806|Malaysia|1990

lambrix salsala|19067B04|Malaysia|1992

lambrix stellifer|19067B05|Malaysia|1992

Gretna (Gretna) bugoma|21101C12|Cameroonl|old b

Gretna (Gretna) carmen|19043D09|Congo|1910

, Gretna (Gretna) waga|21101D02|Cameroon|old

Gretna (Gretna) capra [not carmen]|19043D08|Kenya|1933

Gretna (Gretna) cylinda|21101D07|Liberia|1958

Gretna (Zarida) lacida|21101D06|Cameroonljold

Gretna (Zarida) zaremba|21101D03|Cameroon|old

;alenga balenge zowa [not Grenta]|20124H02|HT|Liberia|1958

Balenga balenge balenge [not Grenta]|21101D09|Cameroon|old

Isma protoclea purpurascens|17091D04|Sarawak|1966

Isma iapis|7774|Malaya|1989

Isma bononia|18014E03|Thailand|1899

Isma cronus|21105E10|Javal|old

Isma umbrosa|18101F07|Borneolold

Isma guttulifera|18074E10|ST|Borneolold

,o{dmon latifascia|18101B04|Borneoljold

Idmon obliquans|21104H07|Borneolold

Idmon distanti|7806|Malaysia|1990

lambrix salsala|19067B04|Malaysia|1992

lambrix stellifer|19067B05|Malaysia|1992

Hyarotis biseriata|18094B12|HT|Philippines|old Hyarotis biseriata|18094B12|HT|Philippines|old

Hyarotis adrastus|22048B03|India:Sikkim|1894 Hyarotis adrastus|22048B03|India:Sikkim|1894

Quedara basiflava|21105E07|India:Keralaljold — Quedara basiflava|21105E07|India:Keralaljold

Quedara Quedara monteithi|17091D02|Thailand|1899 oes Quedara monteithi|17091D02|Thailand|1899

0.02

Zarida

subgen. n.

Fig. 49. Phylogenetic trees of selected Gretnini species and ingroups inferred from protein-coding regions of a) the nuclear

(autosomes) and b) the mitochondrial genomes. Different genera are shown in different colors: Gretna (blue with subgenus

Zarida subgen. n. in violet and Gretna capra stat. nov. with Gretna carmen in orange), Balenga gen. n., [sma (cyan), Idmon

(magenta), Jambrix (green), Hyarotis (olive), and Quedara (brown).

Zarida Grishin, new subgenus

http://zoobank.org/699B2792-5716-45FF-B4D9-477760251BD8

Type species. Hesperia lacida Hewitson, 1876.

Definition. Within a smaller genus Gretna Evans, 1937 (type species Hesperia cylinda Hewitson, 1876)

due to removal of Balenga balenge Holland, 1891, comb. nov. (type locality in Gabon), we note the

genetic differentiation of a clade sister to that with the type species (Fig. 49). This clade diverges from

other Gretna at least at the tree level corresponding to subgenera (if not genera), i.e., approximately the

same as /sma Distant, 1886 (type species /sma obscura Distant, 1886) from /dmon Nicéville, 1895 (type

species Baoris unicolor Distant, 1886, a junior homonym, available name for this species is Jambrix

distanti Shepard, 1937) (Fig. 49), and we regard it as representing a subgenus. This new subgenus keys to

53.A.(a)(b') in Evans (1937) and is distinguished from its relatives by an undivided and much narrower

uncus, almost spike-shaped in dorsal view; better developed (and hyaline) spot in the middle of dorsal

hindwing, prominent spot in forewing cell CuA2-1A+2A, and clearly defined whitish bands or area on

ventral hindwing. A combination of the following COI barcode base pairs is diagnostic: T56C, T154C,

T379A, T553A, T556A.

Etymology. The name is a feminine noun in the nominative singular and is a fusion of species names in

this subgenus: Zar[emba]+|lac]ida.

Species included. The type species (i.e., Hesperia lacida Hewitson, 1876) and Telesto zaremba Plotz,

1884.

Parent taxon. Genus Gretna Evans, 1937.

Gretna capra Evans, 1937 is a species distinct from Gretna carmen Evans, 1937

Originally proposed as a subspecies, Gretna carmen capra Evans, 1937 (type locality in Kenya) is not

monophyletic with Gretna carmen Evans, 1937 (type locality in Cameroon) in genomic trees (Fig. 49)

and is strongly differentiated from it genetically, e.g., COI barcode difference of 3.6% (24 bp). Therefore,

we propose that Gretna capra Evans, 1937, stat. nov. is a species distinct from Gretna carmen Evans,

1937, as hinted by Larsen (1991).

Milena Evans, 1912 is a genus distinct from Caltoris Swinhoe, 1893

Genomic trees reveal that Caltoris Swinhoe, 1893 (type species Hesperia kumara F. Moore, 1878) as

currently circumscribed is not monophyletic, and phylogenetic positions of some species differ between

trees not being strongly supported in any of them (Fig. 50). One of such lineages is Caltoris plebeia

(Nicéville, 1887) (type locality in India): it is sister to the clade of Caltoris with its type species in the Z

chromosome tree (with weak support: 46% partitions), and sister to Prusiana Evans, 1937 (type species

Pamphila prusias C. Felder, 1861) in the nuclear genome tree from autosomes (58% of partitions) and

mitogenome (70% of partitions), indicating complex evolutionary history of this lineage. Recognizing the

uniqueness of C. plebeia, it has been chosen as the type species of the available genus-group name Milena

Evans, 1912, which is currently regarded as a synonym of Caltoris. Presently, we have decided to keep

Prusiana as a genus (instead of placing it as a subgenus in Caltoris) due to its genetic differentiation and

phenotypic differences. Therefore, to ensure monophyly of all the taxa, we propose that Milena Evans,

1912, stat. rest. is a genus distinct from Caltoris Swinhoe, 1893.

Tulsia Grishin, new genus

http://zoobank.org/52B76DE3-029E-4623-B87F-578013E5C53F

Type species. Parnara tulsi Nicéville, 1884.

Definition. Genomic trees reveal that the lineage of Caltoris tulsi (Nicéville, 1884) (type locality in India)

originates in rapid radiation and is not strongly grouped with any other single genus. Complemented with

its strong genetic differentiation from others (Fig. 50), it represents a genus-level taxon. This new genus

keys to M.7.12. in Evans (1949) and is distinguished from its relatives by forewing without tuft of scales

beneath and spots in discal cell, ventral hindwing in its basal half and ventral forewing along costal

margin overscaled with pale purplish (not ocherous) scales; uncus rounded at its distal end, only slightly

knobbed on the sides, ampulla expanded and pointed dorsad (not rounded at its apex). A combination of

the following nuclear genomic base pairs is diagnostic: aly2643.5.1:T192C, aly2613.4.2:G2377C, aly1877.

13.1:A892T, aly1877.13.1:T938C, aly1877.13.1:A1195T.

Etymology. The name is a feminine noun in the nominative singular formed from the type species name.

Species included. Only the type species.

Parent taxon. Tribe Baorini Doherty, 1886.

Afrogegenes Jong & Coutsis, 2017 and Torbenlarsenia Kemal & Kogcak, 2020

are subgenera of Gegenes Hiibner, 1819

Nuclear genome trees point to a strongly supported clade that is sister to Borbo Evans, 1949 (type species

Hesperia borbonica Boisduval, 1833) and includes type species of three genera: Gegenes Hiibner, 1819

a Iton semamora|7393|Myanmar|2001 b : Iton semamora|7393|Myanmar|2001

Polytremis lubricans|7396|Myanmar|2001 is Polytremis lubricans|7396|Myanmar|2001

a5 Gegenes (Gegenes) nostrodamus|17119G03|Greece|1963 Gegenes 77) Gegenes (Gegenes) nostrodamus|17119G03|Greece|1963

Gegenes (Gegenes) pumilio|7764|Greece|1990 Gegenes (Gegenes) pumilio|7764|Greece|1990

TT Gegenes (Afrogegenes) hottentota|18064D02|Kenya|1960 Afrogegenes Gan Gegenes (Afrogegenes) hottentota|18064D02|Kenya|1960

18 Gegenes (Afrogegenes) letterstedti|18073H05|South Africajold Tet Gatien cubeenth Gegenes (Afrogegenes) letterstedti|18073H05|South Africajold

ne A hares Gegenes (Havea) havei|21102D03|Madagascar|old Ws mee Gegenes (Havea) havei|21102D03|Madagascar|old

Too ©Gegenes (Flanga) perobscura [was Torbenlarsenia]|18019G03|Uganda|1954 Flanga subgen.n. __-—>5—— Gegenes (Flanga) perobscura [was Torbenlarsenia]|18019G03|Uganda|1954

Gegenes (Flanga) detecta|18102F08|Kenya|1960 Gegenes (Flanga) detecta|18102F08|Kenya|1960

88 a8 Gegenes (Torbenlarsenia) fallax}21102C08|/Cameroonlold 88 aT Gegenes (Torbenlarsenia) fallax]21102C08|Cameroon|old

Gegenes (Torbenlarsenia) holtzi]21102C12|Angola|old

Gegenes (Torbenlarsenia) sirena|21102D01|Angolaljold

16 Gegenes (Torbenlarsenia) micans|21102D02|Kenya|1958

Gegenes (Torbenlarsenia) fanta]21102C11|Malawilold

Gegenes (Torbenlarsenia) holtzi]21102C12|Angolalold

Gegenes (Torbenlarsenia) sirena|21102D01|Angolalold

By] Be Gegenes (Torbenlarsenia) micans|21102D02|Kenya|1958

Gegenes (Torbenlarsenia) fanta|21102C11|Malawilold

x; x Borbo Boronia 130 AGH amt np ee Tormeniarsenia Borbo borbonica|18054G08|Namibia|1993

orbo lugens|181 11|Kenya|1 Borbo lugens|18102F11|Kenya|1966

ort 36 Borbo ferruginea|21102D06|Kenyalold oT; Borbo ferruginea|21102D06|Kenyalold

100 Borbo gemella [not Torbenlarsenia}|21102D07|Madagascar|old ton 100 Borbo gemella [not Torbenlarsenia]|21102D07|Madagascar|old

Borbo impar ceramica|22016H12|LT|Seram Isl.|1884 Borbo impar ceramica|22016H12|LT|Seram Is!.|1884

joPorbo ratek|17119G06|Madagascar|1988 700 Borbo ratek|17119G06|Madagascar|1988

Se etapa lye ea[20 Peyote TATE aa

_ Brusa allardi21 10881 2langolalold. y 100 BPs ca alamieiaeoeteangoelaa ee

é : rusa allardi ngola|o

sa . :

. F— Chiov Gunestteiosntolieesee Cahors crummeslisiosnioperaioe

98 Caltoris philippina|18103A01|Philippines|1913 ae Caltoris philippina|18103A01|Philippines|1913

vn 100 eons FumeraligiO3A0e|inaia, Sikkiisjold ' aa Caltoris cahira]18097A11|India:Sikkim|old

) al : 1 i Caltoris kumara|18103A02|India:Sikkimlold

78 Caltoris aurociliata|21106H08|Northern Indialold Caltoris aurociliata|21106HO8|Northern Indialold

saa Frisina Rochniszosabos| ctsboc|io4 ere__[yq———~ rusiana prusiasgo4abtolceleben 1a

46 58 Prusiana kuehni|22048D09|Celebes|1940

i i j lena P : |

100 Mienteks are] rot Caliorellod i 1erossumatcajotd Seic i Milena plebeia [was Caltoris]|7389|Myanmar|2001

—— B ‘gana|18102HO06|India:Sikkimlold ' Tulsia tulsi [not Caltoris]|21116F03|Sumatra|old

saoris paga 8102HO06 a: SIKKIM | Ol¢ - Baoris pagana|18102H06|India:Sikkim|old

100——— {30 " Baoris aH A pitt via aint ale gris ] B pti ees 21106HO1 India Sikkim old

| 3 eechii|791 >hina:Sichuan|1982 [ > ic ech 1912/China:Sict 111982

Le eia|17091G11|Phillipines|1914 — 3 Sate oh LS OOT ET IPHlancetaNts

7 ae ris penicillata 21106HO5|India Sikkim|old LSS Baoris sehicillata 21106HOS\India Sikkimlold

re i poophiog smenselieid2e nichine sehuamtard soe ok Pelopidas assamensil18089F Olinda, Naga Hills|1988

38 i

2 Pelopidas jansonis|18102609|Japanjol a St ea ae

Too Pelopidas conjuncta|22048E05|Timor|1929 16 Pel RI ited P

; . 100 elopidas conjuncta|22048E05|Timor|1929

2 Pelopidas mathias|18099C09|Myanmar|2001 Pelopidas i i

00 Pelopidas agna|18102G02|Myanmar|2000 92 oreaae WM petra nL WL A Poe

Pelopidas lyelli|18102G09|Australia:Qld|1980 woo elopidas agna| Mysore

‘ A : Pelopidas lyelli]18102G09|Australia:Qld|1980

joo Zenonia (Zenonia) zeno|18096F07|Tanzanialold Zenonia (Zenonia) zeno|18096F07|Tanzanialold

100 Zenonia (Zenonia) crasta|]21102C02|Uganda|1952 Zenonia aoe i i

’ : : : 100 Zenonia (Zenonia) crasta|21102C02|Uganda|1952

100 Zenonia (Zenonia) anax|21102C05|Malawilold Zenonial;00 Z ia (Z : 21102 Malawilol

Zenonia (Zenonoida) discreta|19043E04|India|1963 ; rented ceneuie) apekieddocnuolmaan ag

100 P P Zenonoida Zenonia (Zenonoida) discreta|19043E04|India|1963

Zenonia (Zenonoida) eltola|7372|Myanmar|2003 100 ' F

100 700 -Zinaida nascens|18011A03|Chinalold Zenonia (Zenonoida) eltola|7372|Myanmar|2003

76 Zinaida caerulescens|18103A06|China:Sichuan|1930 100 700 rind orplmeauniee Mianare- vgs bere lb ey

Zinaida pellucida|18064C09|Japan|1963 76 Zinaida caerulescens|18103A06|China:Sichuan|1930

ae F inal Sy 9 Zinaida pellucida|18064CO9|Japan|1963

Zinaida zina|18103A10|China:Sichuan|old esidaeel China:Sich ld

Zinaida gigantea|21037A07|HT|China:Sichuan|1990 Zinaida Zinaida zina|18103A10|China:Sichuan|o!

7 Parnara guttatus|21105G11|China:Zhejiang|old Zinaida gigantea|21037A07|HT|China:Sichuan|1990

~-[h— Parmara poutier|7781iMadagascar)1990 pe ne ee ee en ate ne

Parnara amalia|18019D03/Australia:QIdjold 7 :

—————— on | | oe Parnara amalia|18019D03|Australia:Qid|old

Cc Iton semamora|7393|Myanmar|2001 d Iton semamora|7393|Myanmar|2001

Polytremis lubricans|7396|Myanmar|2001 Polytremis lubricans|7396|Myanmar|2001

ron Gegenes (Gegenes) nostrodamus|17119G03|Greece|1963 Too Gegenes (Gegenes) nostrodamus|17119G03|Greece|1963

Gegenes (Gegenes) pumilio|7764|Greece|1990 Gegenes (Gegenes) pumilio|7764|Greece|1990

+00 Gegenes (Afrogegenes) hottentota|18064D02|Kenya|1960 <a0 Gegenes (Afrogegenes) hottentota|18064D02|Kenya|1960

ed edoor {roe Gegenes (Torbenlarsenia) fallax}21102C08|Cameroon|old 10g | 2° 0 Gegenes (Havea) havei|21102D03|Madagascar|old

et 4 100 Gegenes (Torbenlarsenia) holtzi|21102C12|Angola|old Gegenes (Flanga) perobscura [was Torbenlarsenia]|18019G03|Uganda|1954

ato Gegenes (Torbenlarsenia) sirena|21102D01|Angolalold Gegenes (Flanga) detecta|18102F08|Kenya|1960

ee Gegenes (Torbenlarsenia) micans|21102D02|Kenya|1958 34 ri Gegenes (Torbenlarsenia) fallax|21102C08|Cameroon|old

86 Gegenes (Torbenlarsenia) fanta]21102C11|Malawilold an Gegenes (Torbenlarsenia) holtzi]21102C12|Angola|old

Gegenes (Havea) havei|21102D03|Madagascar|old 5 700 Gegenes (Torbenlarsenia) sirena|21102D01|Angola|old

100 To) Gegenes (Flanga) perobscura [was Torbenlarsenia]|18019G03|Uganda|1954 ‘fa Gegenes (Torbenlarsenia) micans|21102D02|Kenya|1958

Gegenes (Flanga) detecta|18102F08|Kenya|1960 Gegenes (Torbenlarsenia) fanta]21102C11|Malawilold

a 300 Borbo borbonica|18054G08|Namibia|1993 Borbo impar ceramica|22016H12|LT|Seram Is!.|1884

Borbo lugens|18102F11|Kenya|1966 100 AOD Borbo ferruginea|21102D06|Kenya|old

100 Borbo cinnara|18102F07|Taiwan|1980 * 100 Borbo gemella [not Torbenlarsenia]|21102D07|Madagascar|old

56 err Borbo ferruginea|21102D06|Kenyal|old 99 100 Borbo cinnara|18102F07|Taiwan|1980

100 100 Borbo gemella [not Torbenlarsenia]|21102D07|Madagascar|old 300 Borbo lugens|18102F11|Kenya|1966

Borbo impar ceramica|22016H12|LT|Seram Is!.|1884 ay Borbo borbonica|18054G08|Namibia|1993

;oPorbo ratek|17119G06|Madagascar|1988 i00 Borbo ratek|17119G06|Madagascar|1988

Borbo fatuellus|18102F09|Uganda|1958 Borbo fatuellus|18102F09|Uganda|1958

300 Pseudoborbo bevani|18099C06|Myanmar|2001 Caltoris cormasa|18038H09|Malaysia|2018

Al Brusa allardi|21102B12|Angolalold Dad pers Caltoris brunnea|18102H10|Javalold

Baoris pagana|18102H06|India:Sikkimjold 100 Caltoris philippina|18103A01|Philippines|1913

— Baoris farri|21106HO1|India:S zs 6a TT Caltoris cahira]18097A11|India:Sikkimjold

4 Baoris leechii|7912|China:Sichuan|1982 Caltoris kumara|18103A02|India:Sikkim|old

—— Baoris penicillata|21106HO05|India:Sikkim|old $3 Milena plebeia [was Caltoris]|7389|Myanmar|2001

100 Be Pelopidas assamensis|18089F04|India,Naga Hills|1988 un 500 Prusiana prusias|22048D10|Celebes|1896

T00 Pelopidas sinensis|18102G10|China:Sichuan|old " Prusiana kuehni|22048D09|Celebes|1940

7 Pelopidas mathias|18099C09|Myanmar|2001 Pr Tulsia tulsi [not Caltoris]|21116F03|Sumatra|old

a Pelopidas iyeni|8102G09|austratia ‘bid! 980 = ice Hey allardile1102B12|Angolajold.

De fe te Pelopidas jansonis|18102G08|Japan|old “4 7B l : — Baoris pagana|18102H06|India:Sikkim|old

a Pelopidas conjuncta|22048E05|Timor|1929 ot : — — Baoris farri]21106HO1|India:Sikkimlold

Pelopidas thrax|7768|Greece|1983 | t Baoris leechii|7912|China:Sichuan|1982

Tulsia tulsi [not Caltoris]|21116F03|Sumatra|old [[bewiars Baoris oceia|17091G11|Phillipines|1914

rns Caltoris cormasa|18038H09|Malaysia|2018 100 —— Baoris penicillata]21106H05|India:Sikkimjold

ty oer pales est ede herb oa ; Wins Pelopidas assamensis|18089F04|India,Naga Hills|1988

Caltoris kumara|18103A02|India:Sikkim|old Pelopidas thrax|7768|Greece|1983

“ Caltoris aurociliata|21106HO8|Northern Indialold 98 _ Pelopidas agna|18102G02|Myanmar|2000

00 wae peesaehed DAEDRIC enciae ae 100 Pelopidas mathias|18099C09|Myanmar|2001

eS piisiane prusiasi22048D10|Celebes] 1896 ss ee elopliies cunjunctal22p4SEO5[timer1929

I I C elopidas conjuncta imor

7o0 Znonia (Zenonia) zeno|18096F07|Tanzanialold <oZenonia (Zenonia) zeno|18096F07|Tanzanialold

7Stnis enone) ansn 2 tezcoe|elowible enone eee (Gerona) aney}e4v6scos Malawiol

( l I | 100 enonia (Zenonia) anax alawilo

Darotes anonblday hols iaeinvcaneooose 7 Zenonia (Zenonoida) discreta|19043E04|India|1963

Zinaida ‘geconel 1801103|Chinalald a rl eae a BOT IAOSIChesiols oa

Mee ° , 85 inaida nascens inalo

Zinaida caerulescens|18103A06|China:Sichuan|1930 100 — Zinaida caerulescens|18103A06|China:Sichuan|1930

einginaida pollucida|18b64C08|Japan{io63 81 Zinaida zina|18103A10|China:Sichuan|old

zinaide al TeIGaTAOT HTIChi a fh 1990 oo Zinaida gigantea|21037A07|HT|China:Sichuan|1990

inaida gigantea| |HT|China:Sichuan| Zinaida pellucida|18064C09|Japan|1963

rr er een a a ey EO

ig f : ~4 78 arnara poutieri adagascar

Parnara amalia|18019D03|Australia:QIdjold Parnara amalia|18019D03|Australia:Qld|old

0.02 —— 003

Fig. 50. Phylogenetic trees of selected Baorini species inferred from protein-coding regions of a,b) the nuclear genome

(autosomes), b) proportionally rescaled to bring leaves to the same level, c) the Z chromosome, and d) the mitochondrial

genome. Parnara 1s genetically removed from the rest, and the corresponding tree branches were truncated (as indicated by

dots) to save space. The translucent vertical lime bar in (b) denotes the level approximately corresponding to genera. Shown by

branches they refer to, names of genera are in bold italics, and subgenera are in italics: Gegenes (blue with Havea subgen. n.

red and Flanga subgen. n. aquamarine), Borbo (olive), Baoris (gray), Tulsia gen. n. (magenta), Caltoris (violet), Milena stat.

rest. (bright green), Prusiana (brown), Zenonia (cyan with subgenus Zenonoida stat. nov. orange), and Zinaida (purple).

(type species Papilio pumilio Hoffmansegg, 1804), Afrogegenes Jong & Coutsis, 2017 (type species

Hesperia hottentota Latreille, 1824), and Torbenlarsenia Kemal & Kogak, 2020 (type species Hesperia

holtzi Plotz, 1882) in addition to several species currently in Borbo Evans, 1949 (type species Hesperia

borbonica Boisduval, 1833) (Fig. 50). However, within this clade, strongly supported major subclades are

absent, and 7orbenlarsenia as currently circumscribed (Fan et al. 2016) is not monophyletic. Moreover,

Torbenlarsenia gemella (Mabille, 1884) (type locality in Madagascar) is not in this clade but belongs to

Borbo, where we transfer it as Borbo gemella (Mabille, 1884), stat. rev. This whole clade with Gegenes

is at the genus level in the tree and splits into five confident subclades, three of which represent named

genus-group taxa: we propose to treat Afrogegenes Jong & Coutsis, 2017, stat. rev. and Torbenlarsenia

Kemal & Kocak, 2020, stat. rev. as subgenera of Gegenes Hiibner, 1819. The remaining two subclades

do not have names and are described as new subgenera below. Finally, to restore the monophyly of

Borbo, we transfer several species to the subgenus 7orbenlarsenia, forming new combinations: Gegenes

(Torbenlarsenia) cottrelli (Larsen, 2013), comb. nov., Gegenes (Torbenlarsenia) fallax (Gaede, 1916),

comb. nov., Gegenes (Torbenlarsenia) fanta (Evans, 1937), comb. nov., Gegenes (Torbenlarsenia)

micans (Holland, 1896), comb. nov., and Gegenes (Torbenlarsenia) sirena (Evans, 1937), comb. nov.

Flanga Grishin, new subgenus

http://zoobank.org/894F0986-7046-4A95-8D78-73 1C61C881A0

Type species. Parnara perobscura H. H. Druce, 1912.

Definition. As discussed above and shown in the trees (Fig. 50), the newly expanded genus Gegenes

Hiibner, 1819 (type species Papilio pumilio Hoffmansegg, 1804) can be partitioned into five subgenera.

The species previously called Torbenlarsenia perobscura (H. H. Druce, 1912) (type locality in Ghana) is

not monophyletic with Hesperia holtzi Plétz, 1882 (type locality in Angola), which is the type species of

Torbenlarsenia Kemal & Kogak, 2020, and belongs to a distinct clade that we define as one of the five

subgenera. It does not have a name. This new subgenus keys to 68.B.(b)(a!)(a7)(a°) in Evans (1937) and is

distinguished from its relatives by long, finger-like flanges at the base of uncus and thinner, more

terminally rounded tooth of harpe projecting anteriad. A combination of the following nuclear genomic

base pairs is diagnostic: aly151.39.1:A351T, aly1139.20.2:A245C, aly1412.8.1:G430C, aly1412.8.1:C431A,

aly 1349.7.9:G58T.

Etymology. The name is a feminine noun in the nominative singular and refers to long flanges from the

base of uncus that identify this subgenus.

Species included. The type species (1.e., Parnara perobscura H. H. Druce, 1912) and Pamphila detecta

Trimen, 1893.

Parent taxon. Genus Gegenes Hiibner, 1819.

Havea Grishin, new subgenus

http://zoobank.org/48 16F043-591A-46E9-B19C-5C9761CD7AD9

Type species. Hesperia havei Boisduval, 1833.

Definition. As discussed above and shown in the trees (Fig. 50), the newly expanded genus Gegenes

Hiibner, 1819 (type species Papilio pumilio Hoffmansegg, 1804) can be partitioned into five subgenera.

The lineage with the species currently called Borbo havei (Boisduval, 1833) (type locality in Madagascar)

corresponds to the last one (others discussed above). This new subgenus keys to 68.B.(b)(b')(c’) in Evans

(1937) and is distinguished from its relatives by narrower uncus terminally rounded in dorsal view with

approximately parallel sides (not concave, and not gradually narrowing distad) and ampulla expanded

distad and rounded, nearly reaching the distal end of harpe, which is with a sharp, tooth-like process

directed anterodorsad at its base. A combination of the following nuclear genomic base pairs is

diagnostic: aly1952.2.12:C46T, aly1952.2.12:T48A, aly310.6.1:G1542C, aly4196.3.1:T1023C, aly4196.3.1:

G1039T, aly127.59.2:T289T (not C), aly6209.2.1:T1095T (not G), aly813.4.5:A855A (not C), aly275211.12.

5:A60A (not G), aly7600.1.6:T103T (not A).

Etymology. The name is a feminine noun in the nominative singular formed from the type species name.

Species included. Only the type species.

Parent taxon. Genus Gegenes Hibner, 1819.

Zenonoida Fan & Chiba, 2016 is a subgenus of Zenonia Evans, 1935

Genomic trees reveal that genetic differentiation between Zenonia Evans, 1935 (type species Pamphila

zeno Trimen, 1864) and Zenonoida Fan & Chiba, 2016 (type species Hesperia eltola Hewitson, 1869) is

smaller than that within their sister genus Zinaida Evans, 1937 (type species Parnara nascens Leech,

1893) and places the former two at the subgenus tree level (Fig. 50). COI barcodes of their type species

differ by 8.8% (58 bp). Furthermore, these genera are phenotypically close, and neither of them includes a

large number of species. Therefore, we propose that Zenonoida Fan & Chiba, 2016, stat. nov. is a

subgenus of Zenonia Evans, 1935.

On the distribution of Euphyes vestris (Boisduval, 1852)

and Euphyes kiowah (Reakirt, 1866)

On the basis of genetic differences, Euphyes kiowah (Reakirt, 1866) (type locality in the USA: Colorado,

Rocky Mountains) was regarded by Zhang et al. (2022b) as a species distinct from Euphyes vestris

(Boisduval, 1852) (type locality in

USA: California, Plumas Co.). Here, we

investigate the distribution of these two

Species using genomic sequencing and

analysis. Specimens from across the

range were selected for sequencing

(Fig. 51), and genomic trees are shown

in Fig. 52. Both autosome and Z

chromosome trees confirm prominent

genetic differentiation between the two

species (EF. vestris and E. kiowah). In

the US, Euphyes kiowah is confined to

the south-central area, confirmed from

Colorado, Arizona, New Mexico, and

Texas (excluding northeastern, eastern, re ee

and coastal regions) (Fig. 51 squares), oe

and EF. vestris occurs everywhere else VLE @ - harbisoni

(Fig. 51 circles). Interestingly, the Euchist Rowal

entire central Texas (Edwards Plateau 3 mi - kiowah

Bi - chamuli

region) is inhabited by E. kiowah, but

pa 2 : f Fig. 51. A map of sequenced specimens: Euphyes vestris (circles, purple

E. vestris is found immediately to the | and shades of blue) and Euphyes kiowah (squares, shades of red) with their

south of it in more coastal regions. The subspecies: E. vestris osceola (purple), E. vestris vestris (darker blue), E.

vestris harbisoni (paler blue), E. vestris metacomet (sky blue), E. kiowah

eastern boundary between these two kiowah (red), and E. kiowah chamuli (maroon).

parapatric species is relatively straight

in the northwest-to-southeast direction and likely goes through northeastern Colorado, Oklahoma, and

Texas panhandles and towards the Texas coast, where the boundary turns southwest to circumvent coastal

areas. Studies of specimens along this boundary may bring insights into the speciation process and

isolation mechanisms of these two species. On the western side, E. kiowah and E. vestris are separated by

the Great Basin, in which neither species seems to be present. As a result, we see that the distribution of

E. vestris engulfs that of E. kiowah, the latter being restricted to more arid areas.

10 Euphyes vestris. osceola|22101H12|USA:CA,Mendocino ies Euphyes vestris Decree Orc Lasnecrce tapae Co.|1962

a Euphyes vestris osceola|22102A04|USA:CA,Sonoma Co.|1959 osceola Euphyes vestris osceola|22102A01|USA:CA,Mendocino Co.|1953

Euphyes vestris osceola}PAO410|USA:CA,Sonoma Co.|2017 ee yes vestris osceola| Gta TAA ipa wg g ese Co.|1982

7 Euphyes vestris osceola|3248|USA:CA,Sonoma Co.|1971 Besa Euphyes vestris osceola|3 tea ,Sonoma Pee

EG Euphyes vestris osceola|22102A01|USA:CA,Mendocino Co.|1953 ie Euphyes vestris osceola}|PAO410|USA:CA,Sonoma Co.|2017

7 ph sd po vestris ae PO ee yaa etatoneae ie Co.J1953 Euphyes vestris pee be oe pL rat a A Co.|1959

Euphyes vestris vestris|221 meornat :CA, Siskiyou pag Utes es foes vestris vestris|15102A11|USA:OR, Yamhill Co.|1977

9B uphyes epee ONE) EAT SL oe 0.|2005 1 uphyes vestris vestris]1710 PO oneanal Thurston Co.|1985 :

Euphyes vestris vestris|2208 OOF USAY V,Washoe eo ae 94,0 B Euphyes vestris vestris|22087D06|Canada:British Columbia|1962

Euphyes vestris eel -A0444|USA:CA,Plumas Co.|2017 Oy 4s Euphyes vestris retard aeatct dt (MIO Ces Co.|2001

Euphyes vestris Leyte ep rare ATPL Co.|1997 i 7 Euphyes vestris vestris|22087D03|USA:OR, Klamath Co.|2007

Euphyes vestris rh ab |USA:CA, Sierra Co./1947 0) Euphyes vestris vestris|22102B12|USA:CA, Sierra Co.|1947

! . vestris vestris|22 6 700e|Ganada-Fritish rt pth lene S 7) Euphyes vestris ee ee Ec ad A ay ere rag Ah

vestris Euphyes vestris vastly eacil SA:OR,Klamath Co.|200 ty Euphyés vestris vestris]17108B05|USA:WA, Kittitas Ce See ya

Euphyes vestris vestris|22102B08|USA:OR, Josephine Co.|1975 7 — Euphyes vestris vestris|22087D05|USA:WA, Kittitas Co.|1996

E. vestris AEE aa ben WA, Kittitas ee Rte Euphyes vestris vestris|22102B08|USA: HCH ra wot Co.|1975

Euphyes vestris vestris|17108B05|USA:WA Kittitas Co.,|198 - Euphyes vestris vestris|22087C12|USA:CA,Plumas Co.|1997

Eup Fee ue Meer nee, JUSA:WA, Thurston Co.|1985 — Euphyés vestris vestris|PAO444|USA:CA, Plumas Baie aes

Euphyes vestris ver ciaerr DO4|USA:OR, Benton Co.|2001 he — 30 Euphyes vestris aa aNd yr ete be Co.|1960

Euphyes vestris vestris]15102A11|USA:OR, Yamhill Co.|1977 2 & Euphyes vestris a TUE etal SA:CA,San Diego Co.|1963

. Vestris harbisoni|2: or |USA:CA,San Diego Co.|1980 ie) a Pues vestris vestris|22087D01|USA:CA, Siskiyou Co,|2005,

Euphyes vestris harbisoni/eco TIN peat ata iego Co.|1963 rh) D775 44 Euphyés vestris harbisoni|22094D0/7|USA:CA,San Diego Co.|1939

harbisoni ME yes vestris Fen aul eas tea USA:CA,San Diégo Co.|1939 > S v7, Euphyes vestris harbisoni|150 BvCaT Moots Diego Co.|1981

. vestris harbisoni|15 PF bik SA:CA,San Diego Co.|1982 & Euphyes vestris I As Semen ate Diego Co.|1982

Euphyes vestris harbisoni|[15102B02|PT|USA:CA,San Diego Co.|1982 ~ a Euphyes vestris harbisoni|22094D09|PT|USA:CA,San Diego Co.|1980

b Eupiyes vestris metacomet| feodeanis anada:Manitoba|1962 = el vestris Fe nae 7E12|Canada:Nova Scotia|]1971

2 uBnyes vestris metacomet|22064H Bao Fall River_Co.|1988 fo} 70 Euphyes vestris metacomet|20059E0 Senate Co.|2009

0 Mphiyes vestris Mapes ats aS fen earls Co.|1964 3 Euphyes vestris metacome yeaa USA:ME,Hancock Co.|1978

. vestris metacomet|22087E04|USA:SD,Rennington Co.|1981 oO ones vestris metacomet|21032H03|USA:ME,Hancock Co.|1978

Euphyes vestris metacomet|21032H03|USA:ME,Hancock Co.|1978 ~ q uphyes vestris metacomet|21049C07|USA:ME, Piscataquis Co.|1985

> uphyes vestris metacomet|21049C07|USA:ME, Piscataquis Co.|1985 i) BAe! err} Eupaees vestris eeu feecenos Canada: Saskatchewan|1962

Euphyes vestris metacomet|22087F01|USA:ME, Lincoln Ge eaes € 6 Euphyes vestriS metacomet|22087E10|Canada: Heat ;

: Euphyes vestris Lar gto ang EOA ES ME,Hancock Co.|1978 Euphyes vestris metacomet|22087E11|Canada:Ontario|1989

Se ej Euphyes vestris metacomet|22064H07|USA:NE, Sioux Co.|2004 4 Euphyes vestris Te aC Oe ige: SA:MN,Lake Co.|1985

w~ gj 0 Euphyes vestris metacomet|22087F09 Penee ou e. Co.|1973 1) Euphyes vestris ede Ea ee A:SD,Fall River Co.|1988

® Euphyes vestris metacomet|22064H11]USA:NE, Brown Co.|1987 2 Euphyes vestris metacomet]|2208 mente L,Collier Co.|1989

§ eupn ies vestris metacomet| aay pi aulig Co.|197 5 Euphyes vestris metacomet|22087F0 el incoln Sa eo as

>) 0 2 uphyes vestris metacomet|22064H10|USA:NE, Sioux Co.|1982 7 Euphyes vestris metacomet|22087F07|USA:MN,Koochiching Co.|1988

ra E. v. metacomet|22087E08|Canada:Saskatchewan|1962 Fi uphyes vestris metacomet|22087F08|USA:IA,Dickonson Co.|1970

o E. vestris metacomet|22087E12|Canada:Nova Scotia]1971 Euphyes vestris metacomet|3252|USA:OH, Paulin SREY

tS | (Ko 5 Euphyes vestris metacomet|22087E03|USA:SD,Fall River Co.|1983 7 upiyes vestris metacomet (=os aoe 12|LT|USA:LA, Orleans Pa.|old

& Y Euphyes vestris metacomet PTE ER MA ese tye BS 0 rT) E. vestris metacomet ae gO ida onigomery Co.|1999

7 Euphyes vestris metacomet Beene unity 7G12|LT|USA:LA,Orleans Pa 0 Euphyes vestris metacomet|22087E01|USA:NE,Dawes Co.|1984

n Euphyés vestris metacomet|2 eh SA:NY,Hamilton Co.[2009 a Euphyes vestris metacomet|220 Lorene dents Co.|1980

Euphyes vestris metacomet|22058C06|USA:IN,Perry Co.|2021 A Euphyes vestris metacomet|22087E05|USA:NE, Souix Co.|1964

9 Euphyes vestris metacomet|21 Rr pet Rae ape Co.|1989 Euphyes vestris metacomet|21032H02|USA:NJ,Sussex es Sd

ae : E. vestris metacomet|22087E09|Canada:Manitoba|1996 3 Euphyes vestris metacomet|22058C06|USA:IN,Perry Co.|2021

7 0° Euphyes vestris metacomet|22087F03|USA:AL,Cullman Sree on 5 Euphyes vestris metacomet|22087E03|USA:SD,Fall River Co.|1983

q 7) Euphyes vestris metacomet Sud ree ean eee Co.|1961 ; Euphyes vestris metacomet|22064HO7|USA:NE, Sioux Co.|2004

~W uphyes vestris metacomet|22087F Suen euneed a has p Euphyes vestris metacomet|22087E06|USA:ND,Slope Co.|1961

he u Tee vestris metacomet|17108B04|USA:KS, Barber Co.|2002 K Euphyes vestris metacomet|22087E07|USA:NE,Souix Co.|1964

~~ uphyes vestris Rear eae ry sar te Co.|1989 : — E. vestris metacomet|22087E09|Canada:Manitoba|1996

” E. vestris metacomet|22087F1 ai SA:TX,San Patricio Co.|1968 : Euphyes vestris Ste con eN epee au aU emus Veh Micke

® Euphyes vestris Pea aati :TX, Jefferson oo Euphyes vestris metacomet|21049C06|USA:MA, Middlesex Co.|1989

Euphyes vestris metacomet|21049C11|USA:LA, Tangipahoa Pa.|1992 Euphyes véstris metacomet|22064H11|USA:NE,Brown Co.|1987

phy i gip phy

> Euphyes vestris iene pete py aera yd ean eon Co.|1971 i Euphyes vestris metacomet|3925| See eenonicny eke bg

Een es vestris metacomet|3925 TEAS ary oe ad Co.|2015 E. vestris meron ea er oh henpy Co.|2006

uphyes vestris metacomet|4200|USA:TX,Dallas Co.|201 66 eas vestris sterol y era) SA:TX,San Particio Co.|1968

Euphyes vestris metacomet|4327|USA:IN, Newton Seater rT) uphyes vestris metacomet|17108B04|USA:KS, Barber Co.|2002

Euphyes vestris metacomet|4614|USA:FL,Sumter ae T5444 SHpryGS vestris metacomet eA ape ag Co.|2015

E. vestris metacomet(22087F07|USA:MN,k oer Co.|1988 Md iphyes vestris metacomet|/3251|USA:TX, Jefferson an

Euphyes vestris metacomet|7699|USA:TX,San Particio Co.|1968 5q Euphyés vestris metacomet|4327|USA:IN,Newton Co.|2015

E. vestris metacomet (=rurea)|15096D01|NT|USA:IL,Mercer eon iae! 60.35 E. vestris De eae eer ees Pa.|1992

Euphyes vestris metacomet|21049C10(USA:LA,St Tammany Pa.|1997 "7 Euphyes vestris metacomet|4 LaF Sumter Co.|2015

bh LES Euphyes vestris metacomet|22087E01|USA:NE,Dawes Co.]1984 E. vestris metacomet (=rurea)|15096D01|NT|IL,Mercer Co.|1967

Ms ua

3 - E. vestris metacomet|22087G02|USA:TX,Hemphill Co.|2006 <= E. vestris metacomet|21049C10|USA:LA,St Tammany Pa.|1997

3 Euphyes kiowah kiowah|3199|USA:TX,Pecos eos 5 ’ & Euphyes kiowah kiowah|3201|USA:CO,El Paso ile

; la A iowah Baers oc ae JUSA:TX, Travis Co.|1993 Euphyes kiowah kiowah|22087D09|USA:TX,Culberson Co.|2000

0 uphyes kiowah kiowah], ee Th ar Co.|2002 Te) op i 7} Euphyes kiowah kiowah|22087G06|USA:TX,Edwards Co.|1973

Euphyes kiowah kiowah|2 ead RA A:TX,Kinney Co.[1997 he] 7 ale ad kiowah pripeoallh Rit) ee :TX,Blanco Co.|2017

fajne se; — Euphyes kiowah hlowanle 087G06(USA:TX, Edwards Co.|1973 < Euphyes kiowah kiowah|220 AGO USAL TX Real Co.|2002

i co Ta Euphyes kiowah kiOwah|22087G01|USA:TX,Real aes O = be kiowah kiowah|8743|USA:TX,Randall Co.|2017

ors uphyes kiowah kiowah|8380|USA:TX,Blanco Co.|2017 y uphyes kiowah kiowah]31 BSN eeEe Rice {1975

ela kiowah kiowah|22087D10|USA:OK,Cimarron Co.|1988 16 Euphyes kiowah kiowah|7581|USA:TX,Brewster Co.|1971

(o Fag pig rT Euphyes kKiowah Wnt tesed re hh ieee a ape Co.|2019 d Euphyes kiowah kiowah|22087G07|USA:TX, Travis Co.|1993

hd 0 Euphyes kiowah povenie tne 2|USA::CO, Jefferson Co.|2022 Euphyes kiowah a US EE CaS UC:

Euphyes kiowah pet RE A UST eS Co.|1971 0 Euphyes kiowah kiowah|22087D08|USA:NM, Santa Fe Co.|1989

2 Euphyes kiowah pwn. oe USA:TX,Brewster Co.|1961 ors Euphyes kiowah kiowah|PAO1422|USA:CO, Jefferson Co.|2019

a} y er ithe iowah kiowah|22087D0 Ae EE Co.|2000 Euphyes kiowah kiowah|22064C12|USA::CO Jefferson Co.|2022

< 7) uphyes kiowah led EEA A:NM, Otero Co.|1977 Euphyes kiowah cf aol ceeett SE Co.]1992

= Euphyes kiowah kiowah/15102B03/USA:NM, Otero Co.|1986 {Ls Euphyes kiowah kiowah|2208 COs Wont e avalde 0.|2002

“ 12 Eupayes kiowah kiowah|2 AE anal tay bla Co.|1986 oF Euphyes kiowah kiowah|22087D10|USA:OK,Cimarron Se eee

= ° ae Euphyes kiowah kiowah|22087D1 Dita ne econne Co.|1981 0 Euphyes kiowah chamuli rae Wie betel oe pe 972

TH Euphyes kiowah kiowah|22087D0. af era ee Fe Co.|1989 114 Euphyes kiowah kiowah ery, SA:NM, Otero Bouse

Supe iowah kiowah|22087D07|USA:NM, Grant sr he Euphyes kiowah kiowah]15102B03|USA:NM, Otero Co.|1986

=. kiowah kiowah a ts A sa LT|NM, Sandoval Co. Euphyes kiowah kiowah|15102A09/USA:CO, Boulder Co pues

0 Euphyes kiowah kiowah|320 Det ee 8 a err: E. kiowah kiowah (=timmaculatus)|150 eens ere Co.|old

76 Euphyes kiowah kiowah|22056HO7|Mexico:NL|1977 Euphyes kiowah ane eae ee ai eee Co.|1986

18 Euphyes kiowah kiowah|21049C09|Mexico:NL ; ’ euonyes kiowah kiowah|22087D07|USA:NM,Grant Co.|1981

—— Euphyes kiowah aw alt eae ed Lt 0 Euphyes kiowah kiowah|]22087D11|USA:AZ,Coconino Co.|1981

% Euphyes kiowah chamuli|22087C10 Palin TZ 0.003 Euphyes kiowah kiowah|21049CO9/|Mexico:NL

chamuli i> Euphyes kiowah chamuli|21049C08|Mexico:Chia|1973 oo Euphyes kiowah chamuli|18025F07|HT|Mexico:Chia|1965

“D4 Euphyes kiowah mau alee 56D03|Mexico:Chia|]1987 4 Euphyes kiowah chamuli[21 soe eon eure na i

0.004 Euphyes kiowah chamuli|18025F07|HT|Mexico:Chia|1965 Euphyes kiowah chamuli|22056D03|Mexico:Chia|1987

Fig. 52. Phylogenetic trees of Euphyes vestris (purple and shades of blue) and Euphyes kiowah (red) inferred from protein-

coding regions of a) the nuclear genome (autosomes) and b) the Z chromosome. Different subspecies are shown in different

shades of colors and labeled in smaller font by their clades or regions (if not monophyletic) in the tree.

Euphyes vestris osceola (Lintner, 1878) is a valid subspecies

Currently placed as a junior subjective synonym of Euphyes vestris vestris (Boisduval, 1852) (type

locality in the USA: California, Plumas Co.), Pamphila osceola Lintner, 1878 (type locality in the USA:

California, Mendocino Co.) shows genetic differentiation from it and forms a distinct clade in genomic

trees (Fig. 52). Due to this genetic differentiation, coastal north-central California populations of E. vestris

are best treated as a separate subspecies, even more distant genetically from the nominotypical subspecies

than southern Californian Euphyes vestris harbisoni J. Brown & McGuire, 1983 (type locality in USA:

California, San Diego Co.) (Fig. 52). Therefore, in agreement with Emmel et al. (1998), we consider

Euphyes vestris osceola (Lintner, 1878), stat. rev. to be a valid subspecies.

Vernia verna sequoyah (H. Freeman, 1942) is a valid subspecies

Polites verna sequoyah H. Freeman, 1942 (type locality USA: Arkansas, Little Rock) was placed by

Evans (1955) as a junior subjective synonym of Pamphila verna W. H. Edwards, 1862 (type locality in

Vernia verna verna (=pottawattomie)|15101C10|ST|USA:IN|old

wWernia verna verna|15096D02|NT|USA:IL,Mercer Co.|1971

fernia verna verna|SAMN18587413|USA:KY,Oldham Co.

Vernia verna verna|5015|USA:PA,Indiana Co.|1977

Vernia verna verna|18014H01|USA:OH,Summit Co.|2012

yernia verna sequoyah|15104D01|HT|USA:AR, Pulaski Co.|1941

\ernia verna sequoyah|5016|PT|USA:AR, Little Rock|1941

Vernia verna sequoyah|11019|USA:TX,San Jacinto Co.|2018

Vernia dares|18115C04|Mexico:Chia|1972

Vernia dares|22035A08|Panama|1975

7 Vernia verna verna|15096D02|NT|USA:IL,Mercer Co.|1971 b

go Vernia verna verna|5015|USA:PA, Indiana Co.|1977

Vernia verna verna|18014HO1|USA:OH,Summit Co.|2012

53 Vernia verna sequoyah|15104D01|HT|USA:AR, Pulaski Co.|1941

94 Vernia verna sequoyah|5016|PT|USA:AR, Little Rock|1941

Vernia verna sequoyah|11019|USA:TX,San Jacinto Co.|2018

[700 Vernia dares|18115C04|Mexico:Chia|1972

Vernia dares|22035A08|Panama|1975

Fig. 53. Phylogenetic trees inferred from protein-coding regions in: a) the Z chromosome and b) the mitochondrial genome

with Vernia verna verna (blue) and V. verna sequoyah (red). Primary type specimens are labeled in magenta. The sequence of

SAMN18587413 is taken from the alignment provided in Kawahara et al. (2023).

USA: Mercer Co.), the type species of and currently in the genus Vernia Grishin, 2019. The genomic tree

reveals that sequenced specimens of Vernia verna partition into two clades (Fig. 53). The clades are

characterized by close genetic similarity of specimens within each clade and a certain level of genetic

differentiation between the clades. Therefore, populations assigned to these clades can be treated as two

distinct subspecies. The neotype of V. verna and a syntype of Pamphila pottawattomie Worthington, 1880

from “N. Ind.” (type locality in USA: IL, Cook Co., and IN, Lake Co.) belong to one clade, and the

holotype of P. v. sequoyah belongs to the other. We propose that the two clades represent two subspecies

and reinstate Vernia verna sequoyah (H. Freeman, 1942), stat. rest. as a valid subspecies. Moreover, due

to genetic differentiation, future studies of additional specimens may determine that it is a species-level

taxon.

Lerodea dysaules Godman, 1900 is a valid species distinct from

Lerodea arabus (W. H. Edwards, 1882)

Originally proposed as a species and treated (with some reservations) as such by Evans (1955), Lerodea

dysaules Godman, 1900 (type locality Mexico: Guerrero, Venta de Zopilote) was later synonymized with

Lerodea arabus (W. H. Edwards, 1882) (type locality USA: Arizona, Pima Co., Sabino Canyon), because

no appreciable differences in genitalia were observed, and wing pattern differences given by Evans (1955)

do not hold up in a larger series of specimens (Warren and Mielke 2005). Genomic sequencing of L.

arabus from across its range reveals a deep split into two clades (Fig. 54a, b), unexpected from

phenotypic assessment. The two clades are most strongly differentiated genetically with Fst/Gmin statistics

0.70/0.00 and COI barcode difference of 8.2% (54 bp), typical for species from different subgenera and

remarkably large for close relatives. Therefore, the two clades represent two distinct species.

The distribution of ZL. arabus as recorded on iNaturalist (2023) is disjoint, showing a cluster of

observations in southeastern Arizona and the major range from Sinaloa — Durango — Coahuila — Nuevo

Leon —south Texas southwards (Fig. 54c). These two disjoint areas in the distribution correspond

perfectly to the two distinct species revealed by genomic sequencing (plus specimens from both clades in

Sonora, Mexico where no iNaturalist observations existed) (Fig. 54). Sequenced specimens from near the

type locality of ZL. arabus provide the name for the southeastern Arizona and Sonora (except

southernmost) cluster (Fig. 54 blue). The type locality of Lerodea dysaules falls well within the major

range, and the sequenced specimen from Guerrero belongs to the second species along with other

Specimens across the major range (Fig. 54 red), providing an available name for this species. Therefore,

we reinstate Lerodea dysaules Godman, 1900, stat. rest. as a species-level taxon. In conclusion, L.

arabus is the northwestern species, and L. dysaules is the southeastern species. The two species may meet

in southern Sonora, Mexico, and the westernmost record of L. dysaules is from Alamos, Sonora

(sequenced as NVG-21056A02) (Fig. 54 red). Curiously, genomic sequencing suggests that populations

from Mexico Baja California Sur are L. arabus (Fig. 54).

As for the phenotypic assessment, both species are variable in wing patterns, and if identification

is possible, it should be done within each pattern form, comparing specimens with similar patterns

between species. Generally, ventral overscaling in L. dysaules is more mottled in appearance, especially

in a form with a well-developed brown discal patch on the ventral hindwing; this patch is smaller, not

extending towards the apex but turning towards mid-costa and is bordered by more diffuse small pale

spots (if the spots are present at all), these spots are also diffuse and frequently connected into a band even

if the central brown patch is absent. In L. arabus, pale ventral overscaling is more uniform, without

apparent mottling, the hindwing brown patch (if expressed) is larger and frequently extending towards the

apex (at least the area between the patch and the apex is darker than the central submarginal area), giving

the patch a more triangular appearance; if postdiscal small pale spots are expressed, their edges are better

defined, and the spots are more contrasty on the background, better separated from each other, especially

in specimens lacking the patch, and the spot in cell SctRi-RS may be particularly prominent. To aid in

the identification of these species, we provide COI barcodes of specimens from near the type localities:

Lerodea arabus from USA: AZ, Pima Co. [LACM], sample NVG-22094F10, GenBank OR578721:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCATTAAGTCTTTTAATTCGAACAGAATTAGGTAATCCTGGATCTT TAAT TGGAGATGATCAAATTTACAATACT

ATTGTGACAGCTCACGCTTTTATTATAATTTTTTTCATGGTAATACCTATTATAATTGGTGGATTTGGTAATTGATTAGTTCCTCTAATATTAGGTGCCCCAGATATAGCTTTCCCACGAA

TAAATAATATAAGATTTTGAATACTGCCACCTTCCTTAATATTATTAATTTCAAGTAGAATTGTAGAAAATGGT GCAGGAACAGGTTGAACTGTATATCCTCCTCTTTCTTCTAATATTGC

CCACCAAGGAGCCTCAGTTGACTTAGCGATTTTTTCATTACATTTAGCAGGTATTTCATCTATTTTAGGAGCTATTAACTTTATTACTACTATTATTAATATACGAATTAAAAATTTATCA

TTTGATCAAATACCTTTATTTGTTTGATCAGTAGGAATTACAGCATTATTATTACTTTTATCTCTACCTGTTTTAGCAGGTGCTATTACCATACTTTTAACTGACCGAAATTTAAACACTT

CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Lerodea dysaules from Mexico: Guerrero [MGCL], sample NVG-21085D09, GenBank OR578722:

AACTTTATACTTTATTTTTGGAATTTGAGCAGGAATAT TAGGAACATCTT TAAGTCTTTTAATTCGAACAGAATTAGGCAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT

ATTGTAACAGCCCATGCCTTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGTAATTGACTAGTTCCTTTAATATTAGGAGCACCTGACATAGCATTCCCACGAA

TAAATAATATAAGATTTTGAATACTACCACCTTCTCTAATATTATTAATCTCAAGTAGAATTGTAGAAAATGGTGCAGGTACAGGTT GAACAGTATATCCCCCTCTTTCATCTAATATTGC

ACATCAAGGAGCCTCAGTTGACCTTGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCCATTTTAGGAGCTATTAATTTTATTACTACTATTATTAACATACGAATTAAAAATTTATCA

TTCGATCAAATACCTTTATTTGTCTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTCTTAGCAGGAGCTATTACTATACTTTTAACCGATCGAAACCTTAATACTT

CATTCTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Lerodea arabus|21015D01|M

L. arab ial S

“Y

ror)

ane

a ‘ us|22094F10|U Pima Co.|1950 a

Lerodea arabus|22094F1 Saag td - Co.|1920 = ‘

Lerodea arabus|]22102A0 AERICO: BS [1959 4

L. arabus|2210 Foebatal Z,Santa Cruz Co.|1964 ,

b ~, Lerodea arabus|21056A03|Mexico:BC$|1990 ied a Hla

arapus erodea arabus|22103B08|USA:AZ, Pima Co.|1966 ) Pnoenix | ;

0 Lerodea arabus|20039D07|Mexico:Son|1998 ‘

Lerodea arabus|20039D09/|Mexico:BCS|1974 ban

Lerodea arabus|22094F11]USA:AZ,Pima Co.|1950 | ucson

Lerodea arabus|21015C12{Mexico:BCS|1961 |

102A0 Tate ane BC 4 28

056A 84 /~]

iz]

"~~

:TX, Hidalgo Co.|2015 Ore ene eee a

:TX,Starr Co.|2

2|Mexico:Oax]1

3|Mexico:0ax|199

Lerodea peeve peal

coo

=o*

=xmwn

OpY

Lerodea 7 braeled ded AM

Lerodea

V).

Lerodea oP fear pie

Lerodea dysaules

Lerodea dySaules|

DO8 Pept 003

100 Lerodea eufala|1 A edd alee ak Ley 4

Lerodea pitalnnoorith: allas Co.|2015 aE 4

100 <0, Lerodea gracia|19019D05|Ecuador|1988 Y Bees

100 Lerodea Gracia eoeben 0 i thes

100 erodea emba|1 eru

507 ~Lerod ba|19093C09|Peru|1999

Cavaed Eorodes Gctosti JP

erodea erythrostictus

0007 Cine. Lerodea etythrostictus|

Lerodea arabus|22094

b & arabus|22103B07|U

erodea arabus|210

Lerodea arabus]2105

rodea arabus

. arabus|2209

perodea arabus

erodea arabus

arabus erodes arabus

019D03|Brazil:DF|1991 ee. |

JUSA:AZ, Yuma Co.|1920 rOA M@nterrey

:AZ,Santa Cruz Co.|1964 ese,

1|Mexico:Son|1961 iste a

exica BCS 1 “

SOV

ord

Tete)

of §

=—

oe |

‘e)

20343 =9ON6=Non IN

CLPDSDD0OL 250503509

bad

ie]

Ke)

|_|

im |

n3.

{o)

oOo

o-f900D>

pape

RAAT

ASAGNOIG

= f

(2)

°o

exico:B

exico:Son|

Mexico:NL|2000 , |

Mexico:Son|199 } |

Mexico:Tam|2008 Oe ee

price uel eas

: X,Hidal 0 Co.|20

Lerodea arabus

Lerodea arabus|

Lerodea dysaules

2erodea dysaules

erodea dysaules

SPoNWoSN

i?)

foe)

DANANPOCHD=O@ .To)

ADHPLPRGAVORE

Or>

ooo

Opn

exico: onl e

‘terodea dysaules

Lerodea dysaules

isPerodea dysaules

erodea dysaules

Lerodea dysaules|53

rodea erythrosti if:D

erodea erythrosti 08{Brazil:B

jor odes Staragorg 1X Dall a 1

erodea eufala :

100 rodea gracia|19019D05 Ecuador|1988 m - Lerodea dysaules stat. rest. 4

erodea gracia|19019D07 Seabee 0 As 2 ia

Lerodea emba|19093C09|Peru|1999 yl

Lerodea emba|20017B05|Peru|1998

Mexico:Sin

Mexico: Tam}

NNONVCNHHNDMNNDNPNNnpp

Aon

ooo

conor:

exico:Oax

.Starr Co,

03)Brazi

=2]nLr

°°.

O25

2 = §

5 m - Lerodea arabus Sorte hy ae

Pies poe?

Fig. 54. Lerodea arabus (blue) and Lerodea dysaules stat. rest. (red): phylogenetic trees inferred from protein-coding regions

in: a) the nuclear genome (autosomes) and b) the mitochondrial genome; c) a distribution map made from iNaturalist (2023)

observations: some points in the iNaturalist map L. arabus were re-colored in Photoshop and the two points corresponding to

sequenced specimens from Mexico: Sonora were added (CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/),

other points do not refer to sequenced specimens, records were not checked, and some may be misidentifications.

[No genus] ositbius Draudt, 1924 is an unavailable name

The name “osibius” was published by Draudt (1921-1924) below a specimen illustration on the plate

113B entitled “AGRIAS-ERYNNIS”, row c image 4 from the left, out of 7. No other mention of the name

is found in this work. The species illustrated first (1.e., top left: row a image [1]) on plate 113B was placed

in the genus Agrias, and the species illustrated last (1.e., bottom right: row c image [7], current name

Hesperia colorado (Scudder, 1874)) was placed by Draudt (1923b) in the genus Erynnis. The species

illustrated next to last (row c, images [5] and [6], current name 7uresis complanula (Herrich-Schaffer,

1869), misidentified as “/ucasi’’) was placed by Draudt (1923a) in the genus Turesis. Only two genera are

mentioned in the title of this plate (Agrias and Erynnis), but at least three are illustrated. Therefore, it

remains unclear which genus “osibius” was placed in (Agrias, Turesis [not mentioned on the plate],

Erynnis, or some other genus). Mielke (1993) listed “osibius” (as “osybius”) in combination with the

genus Turesis Godman, 1901 (type species Hesperia lucas Fabricius, 1793) and treated it as a valid

species (Mielke 2004; Mielke 2005). However, the name “osibius” by Draudt is unavailable because it

was not proposed “in unambiguous combination with a generic name” as demonstrated above (fails ICZN

Code Art. 11.9.3) and therefore cannot be used as a valid name for any species. Finally, we were not able

to unambiguously determine the identity of the specimen illustrated by Draudt (1921-1924) (among

others, it might have been Rhinthon Godman, 1900 or Niconiades Hubner, [1821]), but it does not seem to

belong to Turesis due to details in its wing pattern, such as a postdiscal arc of increasing in size pale spots

on ventral hindwing, that are not characteristic of Turesis.

ACKNOWLEDGMENTS

This study is dedicated to the memory of Paul A. Opler, our close collaborator on genomic projects. We

are most grateful to Paul and his wife Evi for participating in these projects, sharing knowledge,

discussions, insights, critiques, and numerous specimens they collected for genomic research, which we

used in this and future studies. We acknowledge Ping Chen and Ming Tang for their excellent technical

assistance. We are grateful to David Grimaldi and Courtney Richenbacher (AMNH: American Museum

of Natural History, New York, NY, USA), Jason Weintraub (ANSP: The Academy of Natural Sciences of

Drexel University, Philadelphia, PA, USA), Blanca Huertas, David Lees, and Geoff Martin (BMNH:

Natural History Museum, London, UK), Chris Grinter, Denise Montelongo, David Bettman, Vince Lee,

and the late Norm Penny (CAS: California Academy of Sciences, San Francisco, CA, USA), Jim Fetzner,

Bob Androw, Vanessa Verdecia, Cat Giles, and the late John Rawlins (CMNH: Carnegie Museum of

Natural History, Pittsburgh, PA, USA), the late Paul Opler, Chuck Harp, and the late Boris Kondratieff

(CSUC: Colorado State University Collection, Fort Collins, CO, USA), Jason Dombroskie (CUIC:

Cornell University Insect Collection, Ithaca, New York, USA), Crystal Maier and Rebekah Baquiran

(FMNH: Field Museum of Natural History, Chicago, IL, USA), Weiping Xie and Giar-Ann Kung

(LACM: Los Angeles County Museum of Natural History, Los Angeles, CA, USA), Théo Léger, Viola

Richter, and Wolfram Mey (MFNB: Museum fiir Naturkunde, Berlin, Germany), Andrei Sourakov,

Andrew D. Warren, Debbie Matthews-Lott, Riley J. Gott, and Keith R. Willmott (MGCL: McGuire

Center for Lepidoptera and Biodiversity, Gainesville, FL, USA), Rodolphe Rougerie (MNHP: Muséum

National d'Histoire Naturelle, Paris, France), Matthias Nuss and Manuela Bartel (MTD: Museum fiir

Tierkunde, Dresden, Germany), Gerardo Lamas (MUSM: Museo de Historia Natural, Lima, Peru), Larry

F. Gall (PMNH: Peabody Museum of Natural History, Yale University, New Haven, CT, USA), Martin

Wiemers and Christian Kutzscher (SDEI: Senckenberg Deutsches Entomologisches Institut, Miincheberg,

Germany), Wolfgang A. Nassig (SMF: Natural History Museum, Frankfurt, Germany), Edward G. Riley,

Karen Wright, and John Oswald (TAMU: Texas A&M University Insect Collection, College Station, TX,

USA), Alex Wild (TMMC: University of Texas Biodiversity Center, Austin, TX, USA), Jeff Smith and

Lynn Kimsey (UCDC: Bohart Museum of Entomology, University of California, Davis, CA, USA),

Robert K. Robbins, John M. Burns, and Brian Harris (USNM: National Museum of Natural History,

Smithsonian Institution, Washington, DC, USA), Jonathan P. Pelham (UWBM: Burke Museum of

Natural History and Culture, Seattle, WA, USA), and Axel Hausmann, Andreas Segerer, and Ulf

Buchsbaum (ZSMC: Zoologische Staatssammlung Miinchen, Germany), for granting access to the

collections under their care, sampling specimens, and stimulating discussions; to Brian Banker, Gian C.

Bozano, Jim P. Brock, Ernst Brockmann, Jack S. Carter, Bill R. Dempwolf, Mike Fisher, Robb

Hannawacker, Bernard Hermier, James McDermott, the late James A. Scott, Kojiro Shiraiwa, Steve M.

Spomer, and Mark Walker for specimens and leg samples, to Gerardo Lamas and Jonathan P. Pelham for

discussions, advice, helpful suggestions, patiently answering numerous questions, and sharing their

research files, and to Bernard Hermier and Gerardo Lamas for critical review of the manuscript and many

helpful corrections. We are indebted to the California Department of Fish and Game for collecting permit

SC13645, Texas Parks and Wildlife Department (Natural Resources Program Director David H. Riskind)

for the research permit 08-02Rev, to U. S. National Park Service for the research permits: Big Bend

(Raymond Skiles) for BIBE-2004-SCI-0011 and Yellowstone (Erik Oberg and Annie Carlson) for YELL-

2017-SCI-7076, and to the National Environment & Planning Agency of Jamaica for the permission to

collect specimens. Please note that photographs from iNaturalist (2023) reproduced in this work and

Commons License 4.0 (https://creativecommons.org/licenses/by/4.0/), which means in particular that

when using the images you must give appropriate credit and provide a link to the license. We

acknowledge the Texas Advanced Computing Center (TACC) at The University of Texas at Austin for

providing HPC resources. This study was supported in part by the HHMI Investigator funds and by grants

from the National Institutes of Health GM127390 and the Welch Foundation I-1505 to N.V.G.

LITERATURE CITED

Bachtrog, D., K. Thornton, A. Clark, and P. Andolfatto. 2006. Extensive introgression of mitochondrial

DNA relative to nuclear genes in the Drosophila yakuba species group. Evolution 60(2): 292-302.

Barnhart, J. H. 1965. Biographical Notes Upon Botanists, vol. 3. G. K. Hall and Co.; Boston, MA. 545 pp

Boyle, J. H., M. Espeland, S. Safian, R. Ducarme, A. J. Gardiner, J. W. Coleman, A. Heath, S. Fisher, S.

C. Collins, D. J. Martins, kK. Aduse-Poku, M. Libert, E. Dankowicz, A. Y. Kawahara, D. J.

Lohman, and N. E. Pierce. 2023. Phylogeny of the Poritiinae (Lepidoptera: Lycaenidae), butterflies

with ant associations and unusual lichenivorous diets. Systematic Entomology 48(3): 422-433.

Boyle, J. H., Z. A. Kaliszewska, M. Espeland, T. R. Suderman, J. Fleming, A. Heath, and N. E. Pierce.

2015. Phylogeny of the Aphnaeinae: myrmecophilous African butterflies with carnivorous and

herbivorous life histories. Systematic Entomology 40(1): 169-182.

Burns, J. M. 2020. Taxonomic status of a Florida differentiate in the Erynnis brizo species group: classical

evidence (Lepidoptera: Hesperiidae: Pyrginae). Proceedings of the Entomological Society of

Washington 122(1): 25-41.

Burns, J. M., D. H. Janzen, M. Hajibabaei, W. Hallwachs, and P. D. Hebert. 2008. DNA barcodes and

cryptic species of skipper butterflies in the genus Perichares in Area de Conservacion Guanacaste,

Costa Rica. Proceedings of the National Academy of Sciences of the United States of America

105(17): 6350-6355.

Calhoun, J. V. 1997. Updated list of the butterflies and skippers of Florida (Lepidoptera: Papilionoidea and

Hesperioidea). Holarctic Lepidoptera 4: 39-50.

Carneiro, E., O. H. H. Mielke, and M. M. Casagrade. 2013. Thorax and abdomen morphology of some

Neotropical Hesperiidae (Lepidoptera). Insecta Mundi 0327: 1-47.

Casagrade, M. M., and O. H. H. Mielke. 1979. Eurema (Eurema) furtadoi sp. n. de Mato Grosso, Brasil

(Lepidoptera, Pieridae). Dusenia (Curitiba) 11(3): 137-142.

Chermock, R. L. 1950. A Generic Revision of the Limenitini of the World. The American Midland Naturalist

43(3): 513-569.

Chiba, H. 2009. A revision of the subfamily Coeliadinae (Lepidoptera: Hesperiidae). Bulletin of the

Kitakyushu Museum of Natural History and Human History, Series A (Natural History) 7: 1-102.

Chou, I. (Editor) 1994. Monographia Rhopalocerorum Sinensium [in Chinese]. Henan Scientific and

Technological Publishing House; Zhengzhou, China. viii + 854 pp.

Cong, Q., D. Borek, Z. Otwinowski, and N. V. Grishin. 2015. Tiger swallowtail genome reveals

mechanisms for speciation and caterpillar chemical defense. Cell Reports 10(6): 910—919.

Cong, Q., J. Shen, D. Borek, R. K. Robbins, P. A. Opler, Z. Otwinowski, and N. V. Grishin. 2017a. When

COI barcodes deceive: complete genomes reveal introgression in hairstreaks. Proceedings of the Royal

Society B: Biological Sciences 284(1848): 20161735.

Cong, Q., J. Shen, D. Borek, R. K. Robbins, Z. Otwinowski, and N. V. Grishin. 2016. Complete genomes

of hairstreak butterflies, their speciation, and nucleo-mitochondrial incongruence. Scientific Reports 6:

24863.

Cong, Q., J. Shen, W. Li, D. Borek, Z. Otwinowski, and N. V. Grishin. 2017b. The first complete genomes

of metalmarks and the classification of butterfly families. Genomics 109: 485—493.

Cong, Q., J. Shen, J. Zhang, W. Li, L. N. Kinch, J. V. Calhoun, A. D. Warren, and N. V. Grishin. 2021.

Genomics reveals the origins of historical specimens. Molecular Biology and Evolution 38(5): 2166—

2176.

Cong, Q., J. Zhang, and N. V. Grishin. 2019a. Genomic determinants of speciation. bioRxiv BIORXIV/

2019/837666.

Cong, Q., J. Zhang, J. Shen, X. Cao, C. Brevignon, and N. V. Grishin. 2020. Speciation in North American

Junonia from a genomic perspective. Systematic Entomology 45(4): 803-837.

Cong, Q., J. Zhang, J. Shen, and N. V. Grishin. 2019b. Fifty new genera of Hesperiidae (Lepidoptera).

Insecta Mundi 0731: 1—56.

Davey, J. W., M. Chouteau, S. L. Barker, L. Maroja, S. W. Baxter, F. Simpson, R. M. Merrill, M. Joron,

J. Mallet, K. K. Dasmahapatra, and C. D. Jiggins. 2016. Major improvements to the Heliconius

melpomene genome assembly used to confirm 10 chromosome fusion events in 6 million years of

butterfly evolution. G3 (Bethesda) 6(3): 695-708.

Dhungel, B., and N. Wahlberg. 2018. Molecular systematics of the subfamily Limenitidinae (Lepidoptera:

Nymphalidae). PeerJ 6: e4311.

Draudt, M. W. K. 1921-1924. B. Grypocera, breitképfige Tagfalter. Jn: Seitz, A. (Ed.). Die Gross-

Schmetterlinge der Erde. Alfred Kernen; Stuttgart, pp. 833-1011, 1046-1139, pls 113B, 160-193.

Draudt, M. W. K. 1922. B. Grypocera, breitképfige Tagfalter. In: Seitz, A. (Ed.). Die Gross-Schmetterlinge

der Erde. Alfred Kernen; Stuttgart, pp. 873-880.

Draudt, M. W. K. 1923a. B. Grypocera, breitképfige Tagfalter. Jn: Seitz, A. (Ed.). Die Gross-Schmetterlinge

der Erde. Alfred Kernen; Stuttgart, pp. 953-992.

Draudt, M. W. K. 1923b. B. Grypocera, breitkopfige Tagfalter. Jn: Seitz, A. (Ed.). Die Gross-Schmetterlinge

der Erde. Alfred Kernen; Stuttgart, pp. 913-952.

Eliot, J. N. 1973. The higher classification of the Lycaenidae (Lepidoptera): a tentative Arrangement. Bulletin

of the British Museum of Natural History (Entomology) 28(6): 373-505.

Emmel, J. F., T. C. Emmel, and S. O. Mattoon. 1998. The types of California butterflies named by Jean

Alphonse Boisduval: Designation of lectotypes and a neotype, and fixation of type localities. Jn:

Emmel, T. C. (Ed.). Systematics of Western North American Butterflies. Mariposa Press; Gainesville,

pp. 3-76.

Evans, W. H. 1937. A catalogue of the African Hesperiidae indicating the classification and nomenclature

adopted in the British Museum. The Trustees of the British Museum (Natural History); London. xii +

212 pp., 30 pls.

Evans, W. H. 1949. A catalogue of the Hesperiidae from Europe, Asia, and Australia in the British Museum

(Natural History). The Trustees of the British Museum (Natural History); London. xix + 502 pp., 53

pls.

Evans, W. H. 1952. A catalogue of the American Hesperiidae indicating the classification and nomenclature

adopted in the British Museum (Natural History). Part II. Pyrginae. Section I. The Trustees of the

British Museum (Natural History); London. v + 178 pp., pls. 10—25.

Evans, W. H. 1955. A catalogue of the American Hesperiidae indicating the classification and nomenclature

adopted in the British Museum (Natural History). Part IV. Hesperiinae and Megathyminae. The

Trustees of the British Museum (Natural History); London. v + 499 pp., pls. 54-88.

Fan, X., H. Chiba, Z. Huang, W. Fei, M. Wang, and S. Safian. 2016. Clarification of the phylogenetic

framework of the tribe Baorini (Lepidoptera: Hesperiidae: Hesperiinae) inferred from multiple gene

sequences. PLoS One 11(7): e0156861.

Glassberg, J. 2023. Description of a new subspecies of common sootywing, ‘white-tufted’ common

sootywing, Pholisora catullus albicirrus new subspecies. American Butterflies 31(3): 36-39.

Godman, F. D. 1907. Notes on the American species of Hesperiidae described by Plétz. Annals and Magazine

of Natural History (7)20(16): 132-155.

Hall, J. P., K. R. Willmott, and D. H. Ahrenholz. 2023. A review of the Argyrogrammana amalfreda group

fauna of the western Amazon (Lepidoptera: Riodinidae: Symmachiin1). Tropical Lepidoptera Research

33(Suppl. 1): 61-85.

Hall, J. P. W. 2002. A phylogenetic revision of Calydna and relatives (Lepidoptera: Riodinidae). Insect

Systematics & Evolution 33: 185-237.

Hall, J. P. W. 2003. Phylogenetic reassessment of the five forewing radial-veined tribes of Riodininae

(Lepidoptera: Riodinidae). Systematic Entomology 28(1): 23-38.

Hall, J. P. W., and K. R. Willmott. 1996. Notes on the genus Argyrogrammana, part 2, with one new species

(Lepidoptera: Riodinidae). Tropical Lepidoptera 7: 71—80.

Heath, A. 1997. A review of African genera of the tribe Aphnaeini (Lepidoptera: Lycaenidae).

Metamorphosis 8(Suppl. 2): 1-60.

Heath, A., E. L. Pringle, and S.-P. Quek. 2023. Chrysoritis Butler (Papilionoidea: Lycaenidae: Aphnaeinae)

— Part III: An integrative taxonomic revision. Metamorphosis 33: 11-28.

Hebert, P. D., A. Cywinska, S. L. Ball, and J. R. deWaard. 2003. Biological identifications through DNA

barcodes. Proceedings of the Royal Society B: Biological Sciences 270(1512): 313-321.

Henning, S. F., and G. A. Henning. 1996. A review of the genus Axiocerces Hiibner (Lepidoptera:

Lycaenidae), with descriptions of nine new species and three new subspecies. Metamorphosis 7(Suppl.

1): 1-48.

Herrich-Schaffer, G. A. W. 1869. Prodromus systematis lepidopterorum. Versuch einer systematischen

Anordnung der Schmetterlinge. Correspondenz-Blatt des zoologisch-mineralogischen Vereines in

Regensburg 23(12): 184-204.

Holland, W. J. 1896. A preliminary revision and synonymic catalogue of the Hesperiidae of Africa and the

adjacent islands, with descriptions of some apparently new species. Proceedings of The Zoological

Society of London 1896: 2—107.

Howarth, T. G. 1966. Revisional notes on the genus Antanartia (Lepidoptera: Nymphalidae). Bulletin of the

British Museum of Natural History 18: 21-43.

ICZN [International Commission on Zoological Nomenclature]. 1999. International code of zoological

nomenclature. Fourth edition. International Trust for Zoological Nomenclature; London. xxx + 306

iNaturalist. 2023. A Community for Naturalists — iNaturalist. Available from https://www.inaturalist.org.

Accessed 25-Aug-2022.

Jiang, D., S. Klaus, Y. P. Zhang, D. M. Hillis, and J. T. Li. 2019. Asymmetric biotic interchange across the

Bering land bridge between Eurasia and North America. National Science Review 6(4): 739-745.

Kaur, M., J. S. Kirti, and A. K. Sidhu. 2022. Taxonomic study of the Genus Gandaca Moore (Lepidoptera:

Pieridae) from India. Ecology, Environment and Conservation Journal 28(May Suppl. Issue): S$572—

S578.

Kawahara, A. Y. 2009. Phylogeny of snout butterflies (Lepidoptera: Nymphalidae: Libytheinae): combining

evidence from the morphology of extant, fossil, and recently extinct taxa. Cladistics 25: 263-278.

Kawahara, A. Y., C. Storer, A. P. S. Carvalho, D. M. Plotkin, F. L. Condamine, M. P. Braga, E. A. Ellis,

R. A. St Laurent, X. Li, V. Barve, L. Cai, C. Earl, P. B. Frandsen, H. L. Owens, W. A. Valencia-

Montoya, K. Aduse-Poku, E. F. A. Toussaint, K. M. Dexter, T. Doleck, A. Markee, R. Messcher,

Y. L. Nguyen, J. A. T. Badon, H. A. Benitez, M. F. Braby, P. A. C. Buenavente, W. P. Chan, S. C.

Collins, R. A. Rabideau Childers, E. Dankowicz, R. Eastwood, Z. F. Fric, R. J. Gott, J. P. W.

Hall, W. Hallwachs, N. B. Hardy, R. L. H. Sipe, A. Heath, J. D. Hinolan, N. T. Homziak, Y. F.

Hsu, Y. Inayoshi, M. G. A. Itliong, D. H. Janzen, I. J. Kitching, K. Kunte, G. Lamas, M. J.

Landis, E. A. Larsen, T. B. Larsen, J. V. Leong, V. Lukhtanov, C. A. Maier, J. I. Martinez, D. J.

Martins, K. Maruyama, S. C. Maunsell, N. O. Mega, A. Monastyrskii, A. B. B. Morais, C. J.

Muller, M. A. K. Naive, G. Nielsen, P. S. Padron, D. Peggie, H. P. Romanowski, S. Safian, M.

Saito, S. Schroder, V. Shirey, D. Soltis, P. Soltis, A. Sourakov, G. Talavera, R. Vila, P. Vlasanek,

H. Wang, A. D. Warren, K. R. Willmott, M. Yago, W. Jetz, M. A. Jarzyna, J. W. Breinholt, M.

Espeland, L. Ries, R. P. Guralnick, N. E. Pierce, and D. J. Lohman. 2023. A global phylogeny of

butterflies reveals their evolutionary history, ancestral hosts and biogeographic origins. Nature

Ecology & Evolution 7(6): 903-913.

Klots, A. B. 1929. A revision of the genus Eurema Hiibner (Lepidoptera, Pieridae). Part II: New World

species, taxonomy and synonymy. Entomologica americana 9(3): 99-163.

Klots, A. B. 1933. A generic classification of the Pieridae (Lepidoptera) together with a study of the male

genitalia. Entomologica Americana 12: 139-242.

Kocak, A. O. 1996. Giiney bati asya Polyommatinae taksonlarinin listesi ve baz1 nomenklatiir notlar1

(Lepidoptera, Lycaenidae). Centre for Entomological Studies Ankara Miscellaneous Papers 30/33(1—

32).

Kocak, A. O., and S. Seven. 1997. Negros Papilionoidea, Hesperioidea faunas: ve taksonomisi tizerine

arastirmalar (Lepidoptera) (Filipin entomolojik ekspedisyonu sonuclari-IV). Priamus 9(2/3): 57-114.

Lamas, G. 2004. Pieridae, pp. 99-117. In: Lamas, G. (Ed.). Checklist: Part 4A. Hesperioidea - Papilionoidea.

In: Heppner, J. B. (Ed.), Atlas of Neotropical Lepidoptera. Volume 5A. Association for Tropical

Lepidoptera; Scientific Publishers; Gainesville.

Larsen, T. B. 1991. The Butterflies of Kenya and their Natural History. Oxford University Press; Oxford. 490

Lees, D. C., C. Kremen, and H. Raharitsimba. 2003. Classification, diversity and endemism of the

butterflies (Papilionoidea and Hesperioidea): a revised species checklist. Jn: Goodman, S. M. and J. P.

Benstead (Eds.). The Natural History of Madagascar. University of Chicago Press; Chicago, pp. 762—

793.

Li, W., Q. Cong, J. Shen, J. Zhang, W. Hallwachs, D. H. Janzen, and N. V. Grishin. 2019. Genomes of

skipper butterflies reveal extensive convergence of wing patterns. Proceedings of the National

Academy of Sciences of the United States of America 116(13): 6232-6237.

Llorente, J. E., S. Nieves, and A. Flores. 2023. Exochorion in the tribe Nymphalini (Lepidoptera:

Nymphalidae): the genus Hypanartia Hiibner, [1821] and comparison with related genera. Zootaxa

5330(2): 151-200.

Lukhtanoy, V. A., A. Sourakov, and E. Zakharov. 2016. DNA barcodes as a tool in biodiversity research:

testing pre-existing taxonomic hypotheses in Delphic Apollo butterflies (Lepidoptera, Papilionidae).

Systematics and Biodiversity 14: 599-613.

Mielke, O. H. H. 1993. Sobre os tipos de Hesperiidae (Lepidoptera) neotropicais descritos por M. Draudt.

Revista Brasileira de Entomologica 37: 611-638.

Mielke, O. H. H. 2004. Hesperioidea. /n: Lamas, G. (Ed.). Checklist: Part 4A. Hesperioidea - Papilionoidea.

Association for Tropical Lepidoptera; Scientific Publishers; Gainesville.

Mielke, O. H. H. 2005. Catalogue of the American Hesperioidea: Hesperiidae (Lepidoptera). Sociedade

Brasileira de Zoologia; Curitiba, Parana, Brazil. xiii + 1536 pp.

Miller, J. S. 1987. Phylogenetic studies in the Papilioninae (Lepidoptera, Papilionidae). Bulletin of the

American Museum of Natural History 186(4): 365-512.

Miller, L. D. 1974. Revision of the Euptychiini (Satyridae) 2. Cy/lopsis R. Felder. Bulletin of the Allyn

Museum 20: 1-98.

Nguyen, L. T., H. A. Schmidt, A. von Haeseler, and B. Q. Minh. 2015. IQ-TREE: a fast and effective

stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and

Evolution 32(1): 268-274.

Opler, P. A., and A. D. Warren. 2002. Butterflies of North America. 2. Scientific names list for butterfly

species of North America, north of Mexico. Colorado State University, C. P. Gillette Museum of

Arthropod Diversity; Fort Collins. [2] + 79 pp.

Overlaet, F. G. 1940. Formes nouvelles ou peu connues de Nymphalides africains. Revue de Zoologie et de

Botanique Africaine 33: 150-172.

Pelham, J. P. 2008. Catalogue of the Butterflies of the United States and Canada. Journal of Research on the

Lepidoptera 40: 1-658.

Penz, C. M., and D. Peggie. 2003. Phylogenetic relationships among Heliconiinae genera based on

morphology (Lepidoptera: Nymphalidae). Systematic Entomology 28(4): 451-479.

Plétz, C. 1882. Einige Hesperiinen-Gattungen und deren Arten. Berliner entomologische Zeitschrift 26(1):

71-82.

Pollock, D. D., W. B. Watt, V. K. Rashbrook, and E. V. Iyengar. 1998. Molecular phylogeny for Colias

butterflies and their relatives (Lepidoptera: Pieridae). Annals of the Entomological Society of America

91(5): 524-531.

Rambaut, A. 2018. FigTree, version 1.4.4 http://tree.bio.ed.ac.uk/software/figtree/.

Riley, N. D. 1925. The species usually referred to the Genus Cigaritis Boisd. (Lycaenidae). Novitates

Zoologicae 32: 70—95.

Robbins, R. K., Q. Cong, J. Zhang, J. Shen, R. C. Busby, C. Faynel, M. Duarte, A. R. P. Martins, C.

Prieto, G. Lamas, and N. V. Grishin. 2022. Genomics-based higher classification of the species-rich

hairstreaks (Lepidoptera: Lycaenidae: Eumaeini). Systematic Entomology 47(3): 445-469.

Shen, J., Q. Cong, D. Borek, Z. Otwinowski, and N. V. Grishin. 2017. Complete genome of Achalarus

lyciades, the first representative of the Eudaminae subfamily of skippers. Current Genomics 18(4):

366-374.

Shen, J., Q. Cong, L. N. Kinch, D. Borek, Z. Otwinowski, and N. V. Grishin. 2016. Complete genome of

Pieris rapae, a resilient alien, a cabbage pest, and a source of anti-cancer proteins. F1000Research 5:

2631.

Simonsen, T. J. 2006. Fritillary phylogeny, classification and larval hostplants: reconstructed mainly on the

basis of male and female genitalic morphology (Lepidoptera: Nymphalidae: Argynnini). Biological

Journal of the Linnean Society 89: 627-673.

Sohn, J.-C., C. C. Labandeira, D. R. Davis, and C. Mitter. 2012. An annotated catalog of fossil and

subfossil Lepidoptera (Insecta: Holometabola) of the world. Zootaxa 3286(1): 1-132.

Stempffer, H. 1967. The genera of the African Lycaenidae (Lepidoptera: Rhopalocera). Bulletin of the British

Museum (Natural History) Entomology Suppl. 10: 3-322.

Stichel, H. 1910. Fam. Riodinidae. Allgemeines - Subfam. Riodininae. Genera Insectorum 112A: 1-238.

Stradomsky, B. V. 2016. A molecular phylogeny of subfamily Polyommatinae (Lepidoptera: Lycaenidae).

Caucasian Entomological Bulletin 12(1): 145-156.

Talavera, G., Z. A. Kaliszewska, A. Heath, and N. E. Pierce. 2020. Recent diversification of Chrysoritis

butterflies in the South African Cape (Lepidoptera: Lycaenidae). Molecular Phylogenetics and

Evolution 148: 106817:1—10.

Talavera, G., V. A. Lukhtanov, N. E. Pierce, and R. Vila. 2012. Establishing criteria for higher-level

classification using molecular data: the systematics of Polyommatus blue butterflies (Lepidoptera,

Lycaenidae). Cladistics 29: 166-192.

Tite, G. E. 1963. A synonymic list of the genus Nacaduba and allied genera (Lepidoptera: Lycaenidae).

Bulletin of the British Museum (Natural History) Entomology 13(4): 69-116.

Tite, G. E., and C. G. C. Dickson. 1973. The genus A/oides and allied genera (Lepidoptera: Lycaenidae).

Bulletin of the British Museum (Natural History) Entomology 29(5): 227-280.

Toussaint, E. F. A., H. Chiba, M. Yago, K. M. Dexter, A. D. Warren, C. Storer, D. J. Lohman, and A. Y.

Kawahara. 2021. Afrotropics on the wing: phylogenomics and historical biogeography of awl and

policeman skippers. Systematic Entomology 46(1): 172-185.

Turner, T., and V. Turland. 2017. Discovering Jamaican butterflies and their relationships around the

Caribbean. Caribbean Wildlife Publications; Safety Harbor, FL. 492

Wahlberg, N. 2019. The higher classification of Nymphalidae. <http://www.nymphalidae.net/Nymphalidae/

Classification/Higher_class.htm> Accessed on 16 Aug 2023.

Wahlberg, N., J. Maresova, L. Murillo-Ramos, S. Collins, and L.-W. Wu. 2020. The phylogenetic

positions of Bhagadatta Moore, 1898, Kumothales Overlaet, 1940 and Harmilla Aurivillius, 1892

(Lepidoptera, Nymphalidae, Limenitidinae) based on molecular data. Nota Lepidopterologica 43: 167—

171.

Wahlberg, N., and D. Rubinoff. 2011. Vagility across Vanessa (Lepidoptera: Nymphalidae): mobility in

butterfly species does not inhibit the formation and persistence of isolated sister taxa. Systematic

Entomology 36: 362-370.

Warren, A. D., K. J. Davis, E. M. Stangeland, J. P. Pelham, K. R. Willmott, and N. V. Grishin. 2023.

Illustrated Lists of American Butterflies. [23-VI-2023] <https://www.butterfliesofamerica.com/>.

Warren, A. D., and O. H. H. Mielke. 2005. Synonymic notes on North and Central American Lerodea

Scudder, 1872 and Corticea Evans, 1955 (Lepidoptera, Hesperiidae, Hesperiinae). Revista Brasileira

de Zoologia 22(1): 285-291.

Williams, M. 2023a. Afrotropical butterflies: 05laa Genus Ceratrichia Butler, 1870, updated 29 December

2020, <http://www.lepsocafrica.org/?p=publications&s=atb>, accessed on 20 August 2023.

Williams, M. 2023b. Afrotropical butterflies: 070 Genus Xanthodisca Aurivillius, [1925], updated 9 Feb

2021, <http://www.lepsocafrica.org/?p=publications&s=atb>, accessed on 20 August 2023.

Williams, M. 2023c. Afrotropical butterflies: 286 Genus Chrysoritis Butler, [1897], updated 7 May 2023,

<http://www.lepsocafrica.org/?p=publications&s=atb>, accessed on 20 August 2023.

Willmott, K. R. 2003. Cladistic analysis of the Neotropical butterfly genus Adelpha (Lepidoptera:

Nymphalidae), with comments on the subtribal classification of Limenitidini. Systematic Entomology

28(3): 279-322.

Willmott, K. R., J. P. W. Hall, and G. Lamas. 2001. Systematics of Hypanartia (Lepidoptera: Nymphalidae:

Nymphalinae), with a test for geographical speciation mechanisms in the Andes. Systematic

Entomology 26(4): 369-399.

Zhang, J., Q. Cong, J. M. Burns, and N. V. Grishin. 2022a. Checking the checkered taxonomy of Pl6tz's

checkered skippers (Hesperiidae: Pyrgini). The Taxonomic Report of the International Lepidoptera

Survey 10(5): 1-31.

Zhang, J., Q. Cong, and N. V. Grishin. 2023a. Thirteen new species of butterflies (Lepidoptera:

Hesperiidae) from Texas. Insecta Mundi 0969: 1-58.

Zhang, J., Q. Cong, J. Shen, E. Brockmann, and N. V. Grishin. 2019a. Genomes reveal drastic and

recurrent phenotypic divergence in firetip skipper butterflies (Hesperiidae: Pyrrhopyginae).

Proceedings of the Royal Society B: Biological Sciences 286(1903): 20190609.

Zhang, J., Q. Cong, J. Shen, and N. V. Grishin. 2022b. Taxonomic changes suggested by the genomic

analysis of Hesperiidae (Lepidoptera). Insecta Mundi 0921: 1-135.

Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2019b. Changes to North American butterfly

names. The Taxonomic Report of the International Lepidoptera Survey 8(2): 1-11.

Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2019c. Genomics of a complete butterfly

continent. bioRxiv BIORXIV/2019/829887.

Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2020. Genomic evidence suggests further

changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8(7): 1-

AO.

Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2021. Genomics-guided refinement of

butterfly taxonomy. The Taxonomic Report of the International Lepidoptera Survey 9(3): 1—54.

Zhang, J., Q. Cong, J. Shen, L. Song, and N. V. Grishin. 2022c. Genomic DNA sequencing reveals two

new North American species of Staphylus (Hesperiidae: Pyrginae: Carcharodini). The Taxonomic

Report of the International Lepidoptera Survey 10(4): 1-13.

Zhang, J., Q. Cong, J. Shen, L. Song, and N. V. Grishin. 2023b. A taxonomic list of the Old World genera

in the subfamily Hesperiinae (Hesperiidae) arranged into tribes. The Taxonomic Report of the

International Lepidoptera Survey 11(2): 1-6.

Zhang, J., Q. Cong, J. Shen, L. Song, P. A. Opler, and N. V. Grishin. 2023c. Additional taxonomic

refinements suggested by genomic analysis of butterflies. The Taxonomic Report of the International

Lepidoptera Survey 11(1): 1-25.

Zhang, J., Q. Cong, L. Song, J. Shen, T. Léger, G. Lamas, O. H. H. Mielke, and N. V. Grishin. 2023d.

Resolving inconsistencies between Plétz’s descriptions and presumed type specimens of some

Hesperiidae (Lepidoptera). Deutsche Entomologische Zeitschrift 70(1): 159-174.

Zhang, J., D. R. Dolibaina, Q. Cong, J. Shen, L. Song, C. G. C. Mielke, M. M. Casagrade, O. H. H.

Mielke, and N. V. Grishin. 2023e. Taxonomic notes on Neotropical Hesperiidae (Lepidoptera).

Zootaxa 5271(1): 091-114.

Zhang, J., J. Shen, Q. Cong, and N. V. Grishin. 2019d. Genomic analysis of the tribe Emesidini

(Lepidoptera: Riodinidae). Zootaxa 4668(4): 475—488.