Volume 11 Number 6 13 December 2023

The Taxonomic Report

OF THE INTERNATIONAL LEPIDOPTERA SURVEY

ISSN 2643-4776 (print) / ISSN 2643-4806 (online)

Genomic analysis reveals new species and subspecies of butterflies

Jing Zhang'”*, Qian Cong'*, Jinhui Shen'”, Leina Song'”, and Nick V. Grishin'”

Departments of 'Biophysics, 7Biochemistry, and 7Eugene McDermott Center For Human Growth & Development,

University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390-9050, USA;

“Corresponding author: grishin@chop.swmed.edu

ABSTRACT. Large-scale genomic sequencing of butterfly taxa reveals new findings that are presented here. While

we focus on detecting species by comparative genomics and define subspecies as groups of populations genetically

differentiated from each other but not as strongly as species (1.e., subspecies as “species in the making”), we report other

adjustments to butterfly classification. As a result, 4 subgenera, 11 species, and 6 subspecies are proposed as new. New

subgenera are: Rapis Grishin, subgen. n. (type species Papilio rapae Linnaeus, 1758, genus Pieris Schrank, 1801) in Pieridae

Swainson, 1820 and Callitera Grishin, subgen. n. (type species Eurygona? pulcherrima Herrich-Schaffer, [1853], genus /sapis

E. Doubleday, 1847), Matizada Grishin, subgen. n. (type species Themone poecila H. Bates, 1868, genus /sapis E. Doubleday,

1847), and Parapanara Grishin, subgen. n. (type species Lyropteryx diadocis Stichel, 1910, genus Paraphthonia Stichel,

1910) in Riodinidae Grote, 1895 (1827). New species are (type localities in parenthesis): Chlosyne pardelina Grishin, sp. n.

(USA: Texas, Duval Co.) in Nymphalidae Rafinesque, 1815; Erythia paracheles Grishin, sp. n. (Panama: Canal Zone), Erythia

borrosa Grishin, sp. n. (Panama: Panama), and Cremna telarania Grishin, sp. n. (Bolivia: La Paz) in Riodinidae; and

Euriphellus colombiensis Grishin, sp. n. (Colombia: Rio Dagua), Euriphellus ecuadoricus Grishin, sp. n. (Ecuador: Canelos),

Urbanus (Urbanus) cubanus Grishin, sp. n. (Cuba: Havana), Gorgythion guyanus Grishin, sp. n. (Guyana: Essequibo), Lon co

Grishin, sp. n. (Mexico: Guerrero), Lon ma Grishin, sp. n. (Panama: Chiriqui), and Lon chia Grishin, sp. n. (Mexico: Chiapas)

in Hesperiidae Latreille, 1809. New subspecies are (type localities in parenthesis): Chlosyne definita dolosa Grishin, ssp. n.

(Mexico: Chihuahua) in Nymphalidae and Limochores mystic nino Grishin, ssp. n. (USA: Arizona, Coconino Co.), Hesperia

pahaska hannawackeri Grishin, ssp. n. (USA: Utah, San Juan Co.), Pseudocopaeodes eunus ash Grishin, ssp. n. (USA:

Nevada, Nye Co.), Ochlodes napa kaibab Grishin, ssp. n. (USA: Arizona, Coconino Co.), and Lon melane sur Grishin, ssp. n.

(Mexico: Baja California Sur) in Hesperiidae. Furthermore, we confirm 1 genus, resurrect 2 subgenera, change the rank of 3

genera to subgenera, synonymize 3 genera, 1 species, and 1 subspecies, and present evidence to support 17 taxa (1 confirmed)

as species instead of subspecies or synonyms. Namely, we confirm Perpheres Hirowatari, 1992 as a valid genus, not a junior

subjective synonym of Danis [Fabricius], 1807 (Lycaenidae); treat Sinopieris H. Huang, 1995 and Artogeia Verity, 1947 as

subgenera (not genera or synonyms) of Pieris Schrank, 1801 (Pieridae); regard these genera as subgenera: Serradinga G.

Henning & S Henning, 1996 of Dingana van Son, 1955 (Nymphalidae), Necyria Westwood, 1851 of Lyropteryx Westwood,

1851 (Riodinidae), and Nothodanis Hirowatari, 1992 of Danis [Fabricius], 1807 (Lycaenidae); and propose that the following

are junior subjective synonyms, not genera, species, or subspecies: Eugrumia Della Bruna, Gallo, Lucarelli & Sbordoni, 2000

of Sinerebia Nakatani, 2017 in Nymphalidae: Satyrini: Ypthimina Reuter, 1896, new placement (not Erebiina Tutt, 1896),

Pistoria Hemming, 1964 of Caleta Fruhstorfer, 1922 and Upolampes Bethune-Baker, 1908 of Thaumaina Bethune-Baker,

1908 in Lycaenidae, and Synargis orestessa Hubner, [1819] of Synargis soranus (Stoll, 1781) and Mesosemia eumene furia

Stichel, 1910 of Ectosemia erinnya (Stichel, 1910) in Riodinidae. The following taxa are species, not subspecies or synonyms:

Pontia edusa (Fabricius, 1777) (not Pontia daplidice (Linnaeus, 1758)) and Pontia johnstonii (Crowley, 1887) (not Pontia

helice (Linnaeus, 1764)) in Pieridae; Chlosyne anastasia (Hemming, 1934) (not Chlosyne definita (E. Aaron, [1885])) and

Chlosyne bollii (W. H. Edwards, 1878) (not Chlosyne theona (Meénétriés, 1855)) in Nymphalidae; Ectosemia attavus (J. Zikan,

1952) (not Ectosemia eumene (Cramer, 1776)), Cremna dentata (Stichel, 1910) (not Cremna radiata (Godman & Salvin,

1886)), Cremna pupillata Stichel, 1915 (not Cremna alector (Geyer, 1837)), Lasaia peninsularis Clench, 1972 (not Lasaia

sula Staudinger, 1888), and Synargis arche (Hewitson, 1865) (not Synargis orestessa Hubner, [1819]) in Riodinidae; and

Quadrus (Zera) difficilis (Weeks, 1901) (confirmed as not Quadrus (Zera) zera (A. Butler, 1870)), Gorgythion marginata

Schaus, 1902 (not Gorgythion begga (Prittwitz, 1868)), Pardaleodes murcia (Pl6tz, 1883) (not Pardaleodes incerta (Snellen,

1872)), Pardaleodes pusiella Mabille, 1877 (not Pardaleodes sator (Westwood, 1852)), Ochlodes napa (W. H. Edwards, 1865)

and Ochlodes santacruza J. Scott, 1981 (not Ochlodes sylvanoides (Boisduval, 1852)), and Lon vitellina (Herrich-Schaffer,

1869) and Lon poa (Evans, 1955) (not Lon melane (W. H. Edwards, 1869)) in Hesperiidae. In addition, we propose new genus-

Species combinations: Ectosemia nesti (Hewitson, 1858) (not Semomesia Westwood, 1851), Ectosemia acuta (Hewitson, 1873)

and Ectosemia eurythmia (Stichel, 1915) (not Mesosemia Hubner, [1819]), Eugelasia satyroides (Lathy, 1926), Eugelasia

modesta (H. Bates, 1868) and Pelolasia leucophryna (Schaus, 1913) (not Euselasia Hubner, 1819), Lyropteryx melaniae

(Stichel, 1930) (not Melanis Hubner, [1819]), /sapis pulcherrima (Herrich-Schaffer, [1853]) and /sapis poecila (H. Bates,

1868) (not Themone Westwood, 1851), Paraphthonia diadocis (Stichel, 1910) (not Lyropteryx Westwood, 1851), Tarucus

clathratus W. Holland, 1891 (not Castalius Hubner, [1819]), and Vidius tanna (de Jong, 1983) (not Cobalopsis Godman,

1900); new species-subspecies combination Ochlodes santacruza catalina J. Emmel & T. Emmel, 1998 (not Ochlodes

sylvanoides (Boisduval, 1852)); and transfer junior subjective synonyms between taxa: Parnassius smintheus var. niger W. G.

Wright, 1905 of Parnassius smintheus smintheus E. Doubleday, 1847 (not of Parnassius smintheus behrii W. H. Edwards,

1870), Goniurus proteoides Plotz, 1881 of Urbanus proteus domingo (Scudder, 1872) (not of Urbanus proteus proteus

(Linnaeus, 1758)), Bolla subgisela Strand, 1921 of Staphylus melangon epicaste Mabille, 1903 (not of Bolla eusebius (Plotz,

1884)), Gorgythion beggoides Schaus, 1902 of Gorgythion begga begga (Prittwitz, 1868) (not of Gorgythion plautia

(Moschler, 1877)), and Pamphila milo W. H. Edwards, 1883 of Ochlodes agricola verus (W. H. Edwards, 1881) (not of

Ochlodes agricola nemorum (Boisduval, 1852)). Furthermore, by finding an additional specimen, we confirm Semalea malawi

Grishin, 2023 as a species-level taxon using genomic analysis; we conclude that populations of Hesperia pahaska Leussler,

1938 in most of New Mexico and the White Mountains, Arizona are the nominal subspecies, not H. pahaska williamsi Lindsey,

1940; and report a natural hybrid between Chlosyne bollii (W. H. Edwards, [1878]) and Chlosyne chinatiensis (Tinkham,

1944). Lectotypes are designated for 6 names: Erebia atramentaria Bang-Haas, 1927 (type locality in China: Gansu) in

Nymphalidae; Mesosemia eumene erinnya Stichel, 1910 (type locality in Peru: Pozuzo) and Mesosemia eumene furia Stichel,

1910 (type locality Bolivia: La Paz, Farinas) in Riodinidae; and Goniurus proteoides Pl6tz, 1881 (type locality in the Antilles),

Hesperia erratica Plotz, 1883 (type locality likely in the USA, not Guatemala, as deduced by genomic comparison),

confirming this name as a junior subjective synonym of Lon zabulon (Boisduval & Le Conte, [1837]), and Lerodea? rupilius

Schaus, 1913 (type locality Mexico: Jalisco, Guadalajara, not Costa Rica: Guapiles), not a nomen dubium, but a subspecies of

Atrytonopsis edwardsi W. Barnes & McDunnough, 1916, in Hesperiidae. A neotype is designated for Cobalus vitellina

Herrich-Schaffer, 1869 (type locality becomes Mexico: Oaxaca). Hesperia amanda Pl6tz, 1883 is regarded as a nomen dubium,

not a junior subjective synonym of Ochlodes sylvanoides napa (W. H. Edwards, 1865).

Additional keywords: taxonomy, subspecies, classification, genomics, phylogeny, biodiversity.

ZooBank registration: http://zoobank.org/4594F1CA-9EE8-4A 80-A0CA-792676139D20

INTRODUCTION AND METHODS

This work extends our studies that stem from genomic sequencing of butterflies and employs similar

principles and methods (Cong et al. 2019a, b, 2020, 2021; Li et al. 2019; Zhang et al. 2019a—d, 2020,

2021, 2022b, c, 2023b—d; Robbins et al. 2022). The objective is to enhance the classification of butterflies

by analyzing genomic data. The chosen method involves screening various specimens of butterfly taxa

across the world. The focus is on species found in the United States, with specimens collected from their

entire geographical range. These specimens are primarily sourced from museum and private collections

(see the acknowledgments section for details), with ages ranging from approximately 250 years to

recently collected. Whenever feasible, we sequence the DNA of primary type specimens to establish an

unbiased reference for their names (Zhang et al. 2022a). DNA extraction typically utilizes the legs of

Specimens, and our non-destructive protocol preserves these legs. The DNA is fragmented unless the

specimen's DNA is already short due to age and is then sequenced using the Illumina next-generation

sequencing platform with 150 bp reads. Our approach does not rely on the amplification of specific genes

or regions; instead, we sequence every extracted DNA segment. Consequently, the protocol is effective

even with very old specimens, whose DNA may be fragmented into 30—50 bp segments.

Sequence data, specifically segments that are 150 base pairs or shorter, from each specimen are

employed to construct exons of protein-coding genes. This construction is guided by a reference genome

from the species most closely related according to phylogeny. These protein-coding genes serve as the

basis for inferring the phylogenic trees. Three separate trees are generated using IQtree v1.6.12, utilizing

the GIR+GAMMA model (Nguyen et al. 2015): one tree is derived from autosomes in the nuclear

genome, another from the gene predicted to be located in the Z chromosome, and the third from the

mitochondrial genome. To reduce the computational workload, a random selection of 100,000 codons is

made, representing approximately 2% of the total dataset, for use in constructing the nuclear trees

(300,000 base pairs). Statistical support for the tree branches is determined based on 100 replicates, each

composed of 10,000 codons randomly sampled from the complete set of codons. Trees are constructed for

each replicate, and the statistical support value, ranging from 0 to 100, corresponds to the number of

replicates with a bipartition identical to that in the 100,000-codon tree. For further methodological details,

refer to our earlier publications (Li et al. 2019; Zhang et al. 2022b).

The phylogenetic trees were visualized, rotated, and colored using FigTree (Rambaut 2018). We

superimposed the current taxonomic classification onto these trees to identify taxa that are not

monophyletic and to pinpoint clades corresponding to taxa that lack names. Genomic trees often unveil

"levels," representing specific points in time when diversification occurred independently in multiple

lineages (Zhang et al. 2021). These instances of "synchronized" diversification arise from geological

events that affect major lineages simultaneously. They present an opportunity to align taxonomic ranks

(such as tribe, subtribe, genus, or subgenus) with the levels observed in genomic trees. This approach

results in a more objective and internally consistent classification that takes into account both genetic

differentiation and paleontological history. In making classification decisions, we heavily rely on genomic

trees, with morphological considerations as supplementary evidence to justify the outcomes. This

preference stems from the fact that genomes provide a comprehensive view of an organism,

encompassing more information than the morphology of adult specimens traditionally used in butterfly

classification. Genomes carry encoded data about life histories, habitat preferences, mating behavior, and

dietary sources. While we may not yet have the means to extract and predict phenotypic traits from this

genetic information, we can employ its genetic equivalent, derived from an aggregate of random codons

from all protein-coding genes. This allows us to deduce a taxonomic classification that is rooted in

phylogeny and sound from an evolutionary perspective.

The taxa we define are monophyletic and correspond to prominent clades. By “prominent,” we

refer to branches within the tree with strong statistical support, typically with 100% agreement among

replicates, and are usually longer than neighboring branches. The length of a branch is directly

proportional to the number of base-pair substitutions that have occurred along that branch. Not only do

longer branches receive high statistical support, but their larger number of base-pair substitutions is likely

to result in more noticeable phenotypic changes. These changes might be reflected in various

morphological characteristics, which may not necessarily manifest in adults but could be apparent in

immature stages or other aspects of the phenotype. However, it is important to note that the relationship

between the number of genetic changes and visually significant phenotypic differences is highly non-

linear (Zhang et al. 2019a). This means there can be short tree branches that correspond to visually

distinguishable taxa. Each case needs to be evaluated individually. Nonetheless, it remains unclear

whether a significant phenotypic change in the appearance of adults, brought about by a small number of

genetic changes, such as a single genomic segment inversion, justifies the erection of a distinct taxon for

that lineage. This is especially true if all other characteristics, like those of caterpillars, remain quite

similar to the relatives of this lineage. Importantly, our taxonomic proposals consider the current

classification, and we use currently recognized names and their respective taxonomic ranks as reference

points for defining levels within the trees and establishing new taxa.

While we address a number of higher classification issues in this work, such as altering some

genera, proposing new subgenera, and transferring species between genera to restore monophyly, the

focus is on the species and subspecies levels. Species are delineated by a combination of criteria that

include genetic differentiation in the Z chromosome measured by Fst (0.20 usually corresponds to

distinct species) and gene exchange Gmin (<0.05 for distinct species) (Cong et al. 2019a), COI barcode

difference (typically >2% for distinct species) (Hebert et al. 2003) and its correlation with phenotypic

differences (Lukhtanov et al. 2016), and the prominence of species-level clades (Zhang et al. 2022c).

However, COI barcodes (together with mitochondria) frequently introgress between species (Bachtrog et

al. 2006; Cong et al. 2017a), and some distinct species may possess highly similar or identical barcodes

(Burns et al. 2008; Zhang et al. 2023a). See the “Species, subspecies, and genomics” section in Zhang et

al. (2022a) for further discussion.

Traditionally, subspecies are defined as groups of populations from different geographical areas

that possess recognizable phenotypic differences (e.g., 70% of individuals can be identified by phenotype

without knowing their locality) but can successfully interbreed (Mayr 1982; Monroe 1982). In practice,

the “successfully interbreed” criterion is difficult to assess, and typically, wing pattern difference in

butterflies from different localities is the sole criterion for subspecies definition. It nearly always remains

unknown whether these wing pattern differences are genetically encoded or are a consequence of

environmental factors. Working with genomic sequences allows us to compare populations in their

genotypes. New subspecies names are proposed in this work for genetically differentiated populations that

form distinct clades in at least one of the genomic trees, but their genetic differentiation is lower than that

we use to delineate species. Thus, our subspecies are “species in the making:” differentiated populations,

but to a lesser extent than species. After we delineate subspecies in the genomic trees, we inspect the wing

patterns of these specimens and figure out wing pattern characters that may statistically diagnose these

subspecies. As for most subspecies, these phenotypic diagnoses are statistical, 1.e., they may apply to

~70% of specimens, and exceptions should be expected. However, because our subspecies are delineated

as Clades in the genomic trees, DNA-based characters that support these clades are expected to be much

stronger than wing pattern characters and to hold for nearly all specimens. Therefore, we also provide

DNA-based diagnoses for all newly described subspecies.

Sections of this work are arranged in taxonomic order deduced from genome-scale phylogeny

complemented by phenotypic considerations. For the new taxa, in addition to brief phenotypic diagnoses

sometimes accompanied by references that discuss and illustrate morphological characters in greater

detail, we provide diagnostic DNA characters in the nuclear genome and (when meaningful) in the COI

barcode. DNA characters are found in nuclear protein-coding regions using our previously developed

procedure (see SI Appendix to Li et al. 2019). The logic behind the character selection was described in

Cong et al. (2019b) and is aimed at finding more robust characters likely to stand when additional

Specimens and species are sequenced.

The character states are given in species diagnoses as abbreviations for one of the four reference

genomes: Pieris rapae (Linnaeus, 1758) (pra) (Shen et al. 2016), Heliconius melpomene (Linnaeus, 1758)

(hm) (Davey et al. 2016), Calephelis nemesis (W. H. Edwards, 1871) (cne) (Cong et al. 2017b), or

Cecropterus lyciades (Geyer, 1832) (aly, because this species was formerly in the genus Achalarus

Scudder, 1872) (Shen et al. 2017). E.g., aly728.44.1:G672C means position 672 in exon | of gene 44

from scaffold 728 of the Cecropterus lyciades (Geyer, 1832) reference genome (Shen et al. 2017) is C,

changed from G in the ancestor. When characters are given for the sister clade of the diagnosed taxon, the

following notation is used: aly5294.20.2:A548A (not C), which means that position 548 in exon 2 of gene

20 on scaffold 5294 is occupied by the ancestral base pair A, which was changed to C in the sister clade

(so it is not C in the diagnosed taxon). The same notation is used for COI barcode characters but without a

prefix ending with ‘:’. The sequences of exons from the reference genome with the positions used as

character states highlighted in green are in the supplemental file deposited at < https://osf.io/akhmg/ >.

This link to the DNA sequences accessible from this publication ensures that DNA characters given in the

diagnoses can be readily associated with actual sequences.

Whole genome shotgun datasets we obtained and used in this work are available from the NCBI

database < https://www.ncbi.nlm.nih.gov/ > as BioProject PRJNA1051313 and BioSample entries of the

project contain the locality and other collection data of the sequenced specimens shown in the trees. For

each specimen in tree figures, the following information is provided (separated by “|”): taxon name with

comments in square brackets, DNA sample code, type status, general locality, and year of collection

(“old” if not dated and likely collected 100—150 years ago). Type status abbreviations are: HT holotype,

LT lectotype, ST syntype, T type (could be ST, LT, paralectotype, or HT, status not investigated), PT

paratype; and if a synonym name is given (in parenthesis, preceded by “=”, and in addition by “t” for

unavailable names), type status refers to the synonym. COI barcode sequences reported here have been

deposited in GenBank with accessions OR837724—OR837745 and OR939283—OR939284. Abbreviations

or acronyms for collections are listed in the acknowledgments section.

Family Papilionidae Latreille, [1802]

Parnassius smintheus var. niger W. G. Wright, 1905 is a junior subjective synonym

of Parnassius smintheus smintheus E. Doubleday, 1847 and not

of Parnassius smintheus behrii W. H. Edwards, 1870

Genomic analysis of the holotype of Parnassius smintheus var. niger W. G. Wright, 1905 (type locality

USA: California, Sierra Co. Donner Summit, but no locality label on the holotype, sequenced as NVG-

22098G08) (Fig. 1 red, highlighted yellow) currently treated as a junior subjective synonym of

Parnassius smintheus behrii W. H. Edwards, 1870 (type locality USA: California, Tioga Pass) is not

monophyletic with it (Fig. 1 magenta) and is instead in the clade with more eastern subspecies of

Parnassius smintheus E. Doubleday, 1847 (type locality in “Rocky Mountains,” possibly Canada:

Alberta, vicinity of Rock Lake) (Fig. | blue, olive and cyan). While the affinity of P. smintheus var. niger

to these eastern subspecies and not to P. s. behrii or northern and western subspecies (P. s. sternitzkyi

McDunnough, 1937, P. s. olympianna Burdick, 1941 and P. s. yukonensis Eisner, 1969) is confident, it 1s

more challenging to assign it to one of the eastern taxa using the specimens we sequenced. Tentatively, in

accord with the nuclear genome tree (Fig. 1), we place P. smintheus var. niger as a junior subjective

synonym of Parnassius smintheus smintheus E. Doubleday, 1847, and hypothesize that its type locality

may have been incorrect. Sequencing of additional specimens across the range, including those from

around the Donner Pass area in Sierra Co., California, is needed to determine its locality and synonymy

more precisely. Our current genomic analysis reveals that Parnassius smintheus maximus Bryk & Eisner,

1937 (type locality in USA: Montana, Fergus Co.) is closely related to the nominotypical P. smintheus

(Fig. 1 blue), and it is possible that P. smintheus var. niger is synonymous with the former taxon, or all

Parnassius smintheus olympianna (=guppyi)|20094C03|HT|Canada:British Columbia|1962

Parnassius smintheus olympianna (=guppyi)|22022E12|Canada:British Columbia|1978

100 Parnassius smintheus olympianna|19083G06|USA:WA,Challam Co.|1970

56 Parnassius smintheus olympianna|19083G07|USA:WA,Challam Co.|1970

Parnassius smintheus olympianna|22022E11|USA:WA,Challam Co.|1979

Parnassius smintheus behrii]19083G11|USA:CA,Mono Co.|1961

Parnassius smintheus behrii|19083G12|USA:CA, Alpine Co.|1961

160 Parnassius smintheus behrii]22061C08|USA:CA,Alpine Co.|2015

Viera Parnassius smintheus behrii]21077A03|USA:CA, Alpine Co.|1990

100 L Parnassius smintheus behrii]22061C07|USA:CA,Alpine Co.|2020

Parnassius smintheus behrii|6662|USA:CA,Alpine Co.|2015

Parnassius smintheus behrii|20125E02|NT|USA:CA, Tioga Pass|1916

Parnassius smintheus behrii|21077A04|USA:CA, Tuolumne Co.|1991

Parnassius smintheus yukonensis|19083G09|Canada:British Columbia|1972

on ee Parnassius smintheus yukonensis|21058B07|Canada:Yukon|1984

uA Parnassius smintheus yukonensis|22104C02|PT|Canada:Yukon|1968

1 100 Parnassius smintheus yukonensis|22104C01|PT|Canada:Yukon|1968

Parnassius smintheus yukonensis|16107A10|Canada:Yukon|2016

Parnassius smintheus yukonensis|16107A12|Canada:Yukon|2016

Parnassius smintheus yukonensis|16107B01|Canada:Yukon|2016

Parnassius smintheus magnus|22098G09|LT|Canada:British Columbia|old

Parnassius smintheus magnus (=xanthus)|21018C09|ST|USA:ID,Latah Co.|old

Parnassius smintheus smintheus|19083G08|Canada:Alberta|2003

Parnassius smintheus smintheus (=niger) [not behrii]|22098GO08|HT|"USA:CA, Sierra Co."|old

90 7 Parnassius smintheus maximus|20067C02|USA:MT,Madison Co.|2004

Parnassius smintheus maximus|22075D06|USA:MT,Carbon Co.|1985

nae] = Parnassius smintheus maximus|20067C04|USA:MT,Gallatin Co.|1957

Parnassius smintheus maximus|22075D03|USA:MT,Fergus Co.|1982

Si deeat Parnassius smintheus maximus|22075D02|USA:MT,Fergus Co.|no date

88 Parnassius smintheus maximus|22075D04|USA:MT,Fergus Co.|1982

100 Parnassius smintheus maximus|22075D05|USA:MT,Carbon Co.|1985

Parnassius smintheus sayii|6542|USA:CO,Park Co.|2016

Parnassius smintheus sayii|6501|USA:CO, Teller Co.|2016

Parnassius smintheus sayii (=montanus)|21018D02|ST|USA:CO,Park Co.|old

“168 Parnassius smintheus sayii|20125E04|NT|USA:CO, Elbert Co.|old

Parnassius smintheus sayii (=rotgeri)|21128G09|?ST|USA:CO,Mt. Evans|old

700 Parnassius smintheus pseudorotgeri|19011HO2|USA:CO,Gunnison Co.|1962

: Parnassius smintheus pseudorotgeri|20039F11|USA:UT,San Juan Co.|2019

Parnassius smintheus pseudorotgeri|19011H01|USA:CO,Gunnison Co.|1962

100 Parnassius smintheus pseudorotgeri|M14|USA:CO,Hinsdale Co.|2018

Parnassius smintheus pseudorotgeri|19083G10|USA:CO,Hinsdale Co.|1979

= Parnassius smintheus pseudorotgeri|M15|USA:CO,Hinsdale Co.|2018

0.002 Parnassius smintheus pseudorotgeri|19011G11|USA:CO,Hinsdale Co.|1962

Fig. 1. The phylogenetic tree of the Parnassius smintheus subspecies inferred from protein-coding regions of the nuclear

genome (autosomes): 3,763,728 bp positions and ultra-fast bootstrap (Minh et al. 2013) were used for this tree. The holotype of

P. smintheus var. niger is shown in red and highlighted in yellow, and P. smintheus behrii is colored in magenta.

three are synonyms. Before sequencing the lectotype of P. smintheus smintheus that is expected to shed

light on the situation, we avoid replacing the name P. smintheus maximus with P. smintheus niger.

Family Pieridae Swainson, 1820

Pontia edusa (Fabricius, 1777) is confirmed as a species distinct

from Pontia daplidice (Linnaeus, 1758)

Although it cannot be readily identified by external appearance, Pontia edusa (Fabricius, 1777) (type

locality in Germany) is most strongly differentiated genetically from Pontia daplidice (Linnaeus, 1758)

(type locality in South Europe and Africa), with Fst/Gmin/COI barcode difference of 0.85/0.000/8.2% (54

bp) (Fig. 2). This difference is significantly more than usual for close relatives and is more in line with the

difference between species in different subgenera. Therefore, we confirm that Pontia edusa (Fabricius,

1777) is a species distinct from Pontia daplidice (Linnaeus, 1758). Finally, we note a curious

incongruence between the nuclear (Fig. 2a) and mitochondrial (Fig. 2b) genome trees. As expected from

their phenotypes, Pontia glauconome (Klug, 1829) (type locality in Egypt) is sister to both P. daplidice

and P. edusa in the nuclear genome tree. However, P. edusa gets within the P. glauconome clade in the

mitochondrial genome tree, likely due to mitochondrial introgression.

,gPontia daplidice|15117F12|Spain|1989 b mitochondrial

idgontia daplidice|20035A07|France|2018

Pontia daplidice|22095A06|Israel|1981

Pontia edusa|20058G08|Russia:South Ural|2020

Pontia edusa|22095A07|Kazakhstan|1970

ggontia daplidice|15117F12|Spain|1989

idgontia daplidice|20035A07|France|2018

Pontia daplidice|22095A06|Israel|1981

Bontia edusa|20058G08|Russia: eee Ural|2020

Pontia edusa|22095A05|India|1962

sePontia edusa|22095A07|Kazakhstan|1970

Pontia glauconome|20058G07|Sudan|2020

Pontia johnstonii [not helice]|22095A11|Kenya|1986

iT pentia helice|22095A10|South Africa|1981

0.02 Pontia helice|22095A12|South Africa|1981

a. nuclear

- Pontia edusa|22095A05|India|1962

Pontia glauconome|20058G07|Sudan|2020

Pontia johnstonii [not helice]|22095A11|Kenya|1986

» Pontia helice|22095A10|South Africa|1981

0,008 **Pontia helice|22095A12|South Africa|1981

Fig. 2. Phylogenetic trees of selected Pontia species inferred from protein-coding regions of a) the nuclear (autosomes) and b)

the mitochondrial genomes. Different species are shown in different colors: P. daplidice (blue), P. edusa (red), P. johnstonii

(magenta), P. helice (green), and P. glauconome (black).

Pontia johnstonii (Crowley, 1887) is a species distinct

from Pontia helice (Linnaeus, 1764)

Synchloe johnstonii Crowley, 1887 (type locality Tanzania: Kilimanjaro) currently treated as a subspecies

of Papilio helice Linnaeus, 1764 (type locality South Africa: Tulbagh) in the genus Pontia [Fabricius],

1807 (type species Papilio daplidice Linnaeus, 1758) is genetically differentiated from it at the level

characteristic of distinct species (Fig. 2), e.g., COI barcodes differ by 3.8% (25 bp), and is phenotypically

distinguished by nearly black framing around olive overscaling of veins on hindwing. Therefore, we

propose that Pontia johnstonii (Crowley, 1887), stat. rest. is a species distinct from Pontia helice

(Linnaeus, 1764).

Sinopieris H. Huang, 1995 and Artogeia Verity, 1947 are subgenera of Pieris Schrank, 1801

At times treated as a distinct genus or placed in Pontia [Fabricius], 1807 (type species Papilio daplidice

Linnaeus, 1758), Sinopieris H. Huang, 1995 (type species Sinopieris gongaensis H. Huang, 1995)

originates within Pieris Schrank, 1801 (type species Papilio brassicae Linnaeus, 1758) according to our

genomic trees (Fig. 3). Therefore, Sinopieris belongs to Pieris. However, due to the visual distinction of

some of these species resulting in their confusion with Pontia, instead of synonymizing Sinopieris with

Pieris, we propose to treat the former as a subgenus of the latter. We note that Pieris extensa Poujade,

1888 (type locality in China) belongs to the subgenus Sinopieris (Fig. 3). Then, to restore the monophyly

of the subgenus Pieris, we propose to treat Artogeia Verity, 1947 stat. rev. (type species Papilio napi

Linnaeus, 1758), which is sister to Sinopieris (Fig. 3), as another subgenus of Pieris.

Rapis Grishin, new subgenus

http://zoobank. org/CDE5789D-03D6-4AEF-8974-8F 1C57995DD5

Type species. Papilio rapae Linnaeus, 1758.

Definition. Genomic phylogeny of the genus Pieris Schrank, 1801 (type species Papilio brassicae

Linnaeus, 1758) reveals several prominent clades that could be regarded as subgenera, including the

nominotypical (Fig. 3 violet) and Artogeia Verity, 1947 (type species Papilio napi Linnaeus, 1758) (Fig.

3 blue). Although Sinopieris H. Huang, 1995 (type species Sinopieris gongaensis H. Huang, 1995) (Fig. 3

red) is not supported by a very prominent branch, this group of species is confidently monophyletic,

originates around the same time as other subgenera and is phenotypically distinct. The remaining fourth

clade (Fig. 3 green) is prominent and cannot be confidently included in other subgenera: it is sister to the

subgenus Pieris in the genomic tree, but only with 88% support (not above 95%). Therefore, this green

clade represents the fourth subgenus, and it does not have a name. This new subgenus constitutes the P.

rapae group of Robbins and Henson (1986), who described and illustrated diagnostic characters for it. In

brief, species in the new subgenus are distinguished from the nominotypical subgenus by shorter (less

than half the size) and onion-shaped, rather than elongated, androconia and from Artogeia and Sinopieris

by the lack of posterior process on signum (Robbins and Henson 1986) and, additionally, by the lack of

overscaling along ventral hindwing veins. In DNA, a combination of the following characters is

diagnostic in the nuclear genome: pra6360.8.e1:T87A, pra590.15.e1:A181C, pra82.57.e2:G168T, pra82.57.

e2:T177C, pra283.114.e1:A531T and in COI barcode: T163A, A205T, T421T, G512G, C533C, T535T,

TS89C, C64 1C.

Etymology. The name is a fusion of the type species name with its genus name: Rap[ae] + [Pier]is. The

name is a feminine noun in the nominative singular.

Species included. The type species (1.e., Papilio rapae Linnaeus, 1758), Papilio canidia Linnaeus, 1768,

Pieris krueperi Staudinger, 1860, Pontia mannii J. Mayer, 1851, and Pieris tadjika Grum-Grshimailo,

1888 (Robbins and Henson 1986), including their closest relatives sometimes regarded as distinct species.

Parent taxon. Genus Pieris Schrank, 1801.

Pieris (Rapis) rapae|7230|Sweden|1971

76 Pieris (Rapis) mannii|16103E12|Greece|1992

OU Pieris (Rapis) canidia]15112F06|Hong Kong|1982

100 Pieris (Rapis) tadjika|16103G03|Pamirlold

Pieris (Rapis) krueperi|16103E10|Greece|1992

To) Pieris (Pieris) brassicae|16103C06|Sweden|1983

003 Too Pieris (Pieris) deota|18096HO9|Uzbekistan|old

Pieris (Pieris) brassicoides|16103D07|Ethiopia|1956

700 Pieris (Artogeia) marginalis|15116B10|USA:WA,Mason Co.|1983

68 Pieris (Artogeia) virginiensis|6138|USA:WV,Pendleton Co.|2016

Pieris (Artogeia) oleracea|16105B04|USA:MI,St. Joseph Co.|1984

Pieris (Artogeia) dulcinea|16103G12|Russia:Primorskyi Krai|1981

10 4 Pieris (Artogeia) erutae|16103H08|India|1979

Pieris (Artogeia) melete|16104A01|Japan|1984

Pieris (Artogeia) nesis|16105D05|Japan|1971

Pieris (Artogeia) narina|16104A08|Kazakhstan|1963

' Pieris (Artogeia) segonzaci|16104C01|Marokko|1961

on Pieris (Artogeia) napi]16105D07|Norway|1987

100 Pieris (Artogeia) ochsenheimeri|18097F11|Uzbekistan|old

100 Pieris (Artogeia) ergane|16103H03|Albania|1991

Pieris (Sinopieris) extensa|16103H10|Chinalold

Pieris (Sinopieris) davidis]16103G09|Tibet|1911

Pieris (Sinopieris) dubernardi|16103G10|China:Yunnan|1914

Pieris (Sinopieris) venata|16103G08|no data|old

4 100 Talbotia naganum cisseis|16103D11|China|]1946

Pontia daplidice|15117F12|Spain|1989

gs 90” -Pontia callidice|15117HO3|Russia,Altai Mts.|2001

20 Pontia santamarta|19078C07|Colombia|1977

100 Pontia chloridice|7722|Kazakhstan|1966

Pontia sisymbrii|17066FO6|USA:CA, Tulare Co.|2009

90 Pontia shawii|19068G05|N Kashmirlold

06 Ganyra josephina|17116G12|Mexico:Tam|1974

86 Ascia monuste|4148|USA:TX,Jefferson Co.|2015

Leptophobia eleone|19078B12|Venezuela|1982

Fig. 3. The phylogenetic tree of selected Pierini species inferred from protein-coding regions of the nuclear genomes

(autosomes). Different subgenera of Pieris are shown in different colors: Rapis subgen. n. (blue), Pieris (violet), Artogeia

(blue), and Sinopieris (red). Note the several-fold difference in substitution rates reflected in branch lengths, e.g., low in some

Pontia and high in Ascia Scopoli, 1777.

Family Nymphalidae Rafinesque, 1815

Eugrumia Della Bruna, Gallo, Lucarelli & Sbordoni, 2000 is a junior subjective

synonym of Sinerebia Nakatani, 2017, which is a sister genus of Paralasa Moore, 1893

(Satyrini: Ypthimina)

Entirely dark-brown butterfly Erebia atramentaria Bang-Haas, 1927 (type locality China: Gansu

Province, Qinling Mountains, Datong River, syntype sequenced as NVG-22126F02) visually similar to a

better-known Erebia magdalena Strecker, 1880 (type locality in USA: Colorado, Clear Creek Co.) has

been kept in its original genus Erebia Dalman, 1816 (type species Papilio ligea Linnaeus, 1758), the type

genus of the subtribe Erebiina Tutt, 1896, since its description until it was designated the type species of

Sinerebia Nakatani, 2017, a genus sometimes synonymized with Erebia. Genomic phylogeny places a

syntype of Sinerebia atramentaria as a close sister to Eugrumia herse (Grum-Grshimailo, 1891) (type

locality in China), which is the type species of the genus Eugrumia Della Bruna, Gallo, Lucarelli &

Sbordoni, 2000 in the subtribe Ypthimina Reuter, 1896, not Erebiina (Fig. 4 red), with the COI barcode

difference of only 0.8—1.2% (5—8 bp), despite the remarkable difference in their wing patterns. Therefore,

we confidently propose that Eugrumia syn. nov. is a junior subjective synonym of Sinerebia Nakatani,

2017. Sinerebia is sister to Paralasa Moore, 1893 (type species Erebia kalinda Moore, 1865) (Fig. 4), and

some of Sinerebia species were previously included in Paralasa, which is supported by the genetic

similarity between the two genera, e.g., COI barcodes of their type species differ by 6.1% (40 bp). This

small difference is more characteristic of subgenera than genera. However, pending further studies, we

keep Sinerebia and Paralasa as distinct genera due to much closer relationships among species within

each genus than between these genera (Fig. 4).

We suspect that the absence of wing patterns in Sinerebia atramentaria hindered its taxonomic

classification until it was revealed by genomic sequencing. Finally, to define the taxonomic identity of

this species objectively, N.V.G. hereby designates a syntype in the MTD collection, a male with the

following five printed labels, the 4 yellow, and others white: [ Kansu sept.occ. | Hsining | Nanshan mont.

| Tatung | 3500m. Juli}, [| Staudinger | Ankauf 1948 |, [ 711], [ atramentaria O. Bang-Haas, 1927 |

a Erebia (Erebia) ligea|19099C04|France|1975 b Erebia (Erebia) ligea|19099C04|France|1975

Erebia (Erebia) epistygne|19099C07|Spain|1990 : . Erebia (Erebia) alberganus|19099C05|France|1981

nuclear Erebia (Erebia) alberganus|19099C05|France|1981 mitochondrial Erebia (Erebia) epiphron|19099C09|Spain|1982

Erebia (Erebia) medusa|19099C06|Albania|1991

°Erebia (Erebia) triarius|19099C11|France|1980

Erebia (Erebia) pronoe|19099C10|France|1980

Erebia (Erebia) epiphron|19099C09|Spain|1982

Erebia (Erebia) aethiops|19099C12|Austria|1978

Erebia reer} rossii]16106E05|Canada: Yukon|2016

‘Frei (Magda) disa]16106E08|Canada:Yukon|2016

rebia (Magda) mancinus|16106F06|Canada:Yukon|2016

rebia (Magda) mackinleyensis|16106E11|Canada:Yukon|2016

rebia (Magda) magdalena|6549|USA:CO,Park Co.|2016

rebia (Magda) fasciata]16106F02|Canada:Yukon|2016

rebia (Magda) erinnyn|22021H02|Russia: Buryatia|2002

Erebia (Magda) discoidalis|7999|USA:WI, Oneida Co.|1988

Erebia (Boeberia) parmenio|19115C10|Russia:Siberia|old

Erebia (Atercoloratus) aliniJ22126E11|?ST|China|1937

Maniola jurtina|20035B06|France:Var|2018

Cercyonis pegala texana|4506|USA:TX,Wise Co.|2015

Sinerebia herse [=Eugrumia]|19115D07|Chinal|old

Sinerebia atramentaria [not Erebia]|22126F02|LT|China:Gansulold

, Paralasa jordana|19115D08|Turalold

+, Paralasa manioides|20095A12|PT|Afghanistan|1963

*Paralasa mani (=lorimeri)|20129E04|T|Pakistan|1924|

Paralasa asura|20095A09|PT|Afghanistan|1960

Paralasa shakti|20095A10|HT|Afghanistan|1960

Paralasa danorum|21019G08|HT|Afganistan|1948

Paralasa maracandica|19115D09|Uzbekistan|old

Paralasa hades|19115D10|Tajikistan|1971

Paralasa kalinda]|SAMN18673646|India:Himachal

Strabena smithii]19115C11|Madagascar|1988

Ypthima huebneri|19115E04|Myanmar|2002

Melampias huebneri|19115C12|South Africa|1949

Stygionympha vigilans|19115E01|South Africa|1945

Proterebia phegea|19114D03]|Russia, Altailold

Callerebia scanda|19115D03|Indialold

Physcaeneura panda|19115D01|South Africa|1968

Physcaeneura leda|19115D02|Kenya|1950

100

Callerebiina

0.03

ooErebia (Erebia) medusa|19099C06|Albania|1991 FO8

109

Erebia (Erebia) triarius|19099C11|France|1980

aT Erebia (Erebia) pronoe|19099C10|France|1980

Erebia (Erebia) aethiops|19099C12|Austria|1978

Erebia (Erebia) epistygne|19099C07|Spain|1990

Erebia (Magda) rossii|16106E05|Canada:Yukon|2016

8 Erebia (Magda) disa|16106E08|Canada:Yukon|2016

8 Erebia (Magda) mancinus|16106F06|Canada: Yukon|2016

100 ipyepia (Magda) mackinleyensis|16106E11|Canada:Yukon|2016

g&rebia (Magda) fasciata|16106F02|Canada:Yukon|2016

okrebia (Magda) magdalena|6549|USA:CO,Park Co.|2016

eo Erebia (Magda) erinnyn|22021HO2|Russia: Buryatia|2002

60 Erebia (Magda) discoidalis|7999|USA:WI,Oneida Co.|1988

Erebia (Boeberia) parmenio|19115C10|Russia:Siberia|old

Erebia (Atercoloratus) alini|22126E11|?ST|China|1937

a Maniola jurtina|20035B06|France:Var|2018

~ Cercyonis pegala texana|4506|USA:TX,Wise Co.|2015

jopoinerebia herse [=Eugrumia]|19115D07|China|old

Sinerebia atramentaria [not Erebia]|22126F02|LT|China:Gansulold

33, Paralasa hades|19115D10|Tajikistan|1971

Paralasa jordana|19115D08|Turalold

aan jaParalasa asura|20095A09|PT|Afghanistan|1960

to *“Paralasa manioides|20095A12|PT|Afghanistan|1963

55 §7,,Paralasa danorum|21019G08|HT |Afganistan|1948

Paralasa shakti|20095A10|HT|Afghanistan|1960

Paralasa mani (=lorimeri)|20129E04|T|Pakistan|1924|

a Paralasa maracandica|19115D09|Uzbekistan|old

Paralasa kalinda|SAMN18673646|India:Himachal

Fa Strabena smithii]19115C11|Madagascar|1988

ae Ypthima huebneri|19115E04|Myanmar|2002

ary Melampias huebneri|19115C12|South Africa|1949

Stygionympha vigilans|19115E01|South Africa|1945

700 Proterebia phegea|19114D03|Russia,Altailold

AS Callerebia scanda|19115D03|Indialold

Physcaeneura panda|19115D01|South Africa|1968

003 Physcaeneura leda|19115D02|Kenya|1950

Fig. 4. Phylogenetic trees of selected Satyrini Boisduval, [1833] (1820) inferred from protein-coding regions of a) the nuclear

(autosomes) and b) the mitochondrial genomes. Different subtribes are colored differently: Erebiina (purple with Erebia

labeled in purple), Ypthimina (blue with Sinerebia colored and labeled in red and Paralasa labeled in blue), and Callerebiina

Grishin, 2021 (olive). The sequence of SAMN18673646 is taken from the alignment provided in Kawahara et al. (2023).

SYNTYPUS | Y. Nekrutenko det. 11.09.2000 ], and [ DNA sample ID: | NVG-22126F02 | c/o Nick V.

Grishin | as the lectotype of Erebia atramentaria Bang-Haas, 1927. The lectotype has noticeable areas on

wings with scales partially rubbed off and a small nick by the apex of the left forewing.

Serradinga G. Henning & S Henning, 1996 is a subgenus of Dingana van Son, 1955

Genomic sequencing of type species of genera Serradinga G. Henning & S Henning, 1996 (Leptoneura

bowkeri Trimen, 1870) and Dingana van Son, 1955 (Leptoneura dingana Trimen, 1873) reveals that they

are closely related to each other (Fig. 5 red and blue), e.g., their COI barcodes differ by 5.8% (38 bp),

which is typical for closely related congeners. Therefore, we propose to treat Serradinga G. Henning & S

Henning, 1996 as a subgenus of Dingana van Son, 1955.

a 4e Dingana (Dingana) dingana|22088H01|S Africa|1949 bins Dingana (Dingana) dingana|22088H01|South Africa|1949

Dingana (Serradinga) bowkeri|19098E09|S Africa|1952 Dingana (Serradinga) bowkeri|19098E09|South Africa|1952

Paralethe dendrophilus|19098E03|South Africa|1978 Torynesis mintha|19098E12|South Africa|1934

Aeropetes tulbaghia|19098E01|South Africa|1977 Dira clytus|19098E02|South Africa|1954

> arsocera cassina|19098E10|South Africa|1945 Paralethe dendrophilus|19098E03|South Africa|1978

Tarsocera cassus|19098E11|South Africa|1945 Aeropetes tulbaghia|19098E01|South Africa|1977

Dira clytus|19098E02|South Africa|1954 ool arsocera Cassina|19098E10|South Africa|1945

Torynesis mintha|19098E12|South Africa|1934 — 002 Tarsocera cassus|19098E11|South Africa|1945

Fig. 5. Phylogenetic trees of the type species of available genus-group names in the tribe Dirini Verity, 1953 inferred from

protein-coding regions of a) the Z chromosome and b) the mitochondrial genome. The genus Dingana is colored blue, with its

subgenus Serradinga in red.

Chlosyne pardelina Grishin, new species

http://zoobank.org/4BB18B88-5D3 1-42AF-B99C-5B7D74DDCDI1F

(Figs. 6 part, 7)

Definition and diagnosis. Genomic sequencing of specimens identified as Chlosyne endeis (Godman &

Salvin, 1894) (type locality in Mexico: Nayarit) reveals that they are either not monophyletic (in nuclear

trees) or prominently separated into two clades (in the mitochondrial genome) (Fig. 6). Fs/COI barcode

difference between the specimens in two clades are 0.38/1.5% (10 bp), typical for closely related but

distinct species of Chlosyne Butler, 1870. Therefore, the specimens we sequenced belong to one of the

two distinct species. We identify specimens from Nayarit, Mexico, the state with the type locality of C.

endeis as that species. Specimens from south Texas (USA) and eastern Mexico are not C. endeis and

belong to a different species. This species was at times regarded as a subspecies of C. endeis under the

name “pardelina,” which was attributed either to Higgins (Lamas 2004) or to Scott (Pelham 2008).

However, neither Higgins (1960) nor Scott (1986) made the name available. Higgins proposed “form

pardelina forma nov.” for “male specimens of endeis ..., in which the ground-colour is yellow” (Higgins

1960). However, according to Articles 45.6.1 and 45.6.4.1 of the ICZN Code (ICZN [International

Commission on Zoological Nomenclature] 1999), this name is infrasubspecific because it was applied to

an infrasubspecific entity and not “adopted” before 1985, and therefore is unavailable. The glossary of the

ICZN Code defines “infrasubspecific entity” as “... Specimen(s) within a species differing from other

Specimens in consequence of intrapopulation variability (e.g., opposite sexes, ...,” and Higgins applied

the name to male specimens. Scott did not establish this name either because he merely applied it (not

even referencing Higgins) to the subspecies of C. endeis “in the U.S.” without description, definition, or

bibliographic reference to such (fails Art. 13.1). Therefore, this species lacks an available name, and is

new. This new species is generally similar to C. endeis in having brown wings with yellow or white spots,

some in discal bands separated by veins, and two patches of submarginal red spots (sometimes vestigial)

distad of the yellow discal band on the dorsal hindwing, by the apex and tornus. The new species differs

from C. endeis in having a yellow to orange rather than a white discal band of dorsal hindwing (and

frequently on forewing) and typically larger patches of red hindwing spots. Due to phenotypic variability,

definitive identification is provided by DNA, and a combination of the following characters is diagnostic

a Chlosyne definita definita|21108A10|ST|USA:TX,Nueces Co.|1884 b Chlosyne definita definita (=schausi)|22036H04|?HT|Mexico:Ver|old res Chlosyne definita definita|21108A10|ST

nuclear Chlosyne definita definita (=schausi)|22036H04|?HT|Mexico:Verjold Z-chr Chlosyne definita definita|7665|USA:TX,Cameron Co.|1990 mito Chlosyne definita definita|3462|USA:TX

Chlosyne definita definita|7667|USA:TX,El Paso Co.|1981 Chlosyne definita definita|7670|Mexico:Coah|1978 Rhlosyne definita definita|21025F12|Mex

ipo’ Chlosyne definita definita|22088E02|Mex

C d definita (=schausi)|22036H04|?HT|Mex

C definita dolosa [not anastasia]|22088C12|HT

o& definita dolosa [not anastasia]|22088D01|PT

C definita dolosa [not anastasia]|22088D10|PT

ae [not definita]|21025F10|Mex

Chlosyne definita definita]7668|USA:TX,Jeff Davis Co.|1987

Chlosyne definita definita|7670|Mexico:Coah|1978

Chlosyne definita dolosa [not anastasia]|22088C12|HT|Mexico:Chih|1984

Chlosyne definita dolosa [not anastasia]|22088D01|PT|Mexico:Son|1987

Chlosyne definita dolosa [not anastasia]|22088D10|PT|Mexico:Son|1987

Chlosyne anastasia [not definita]|21025F10|Mexico:Dur|1981

Chlosyne anastasia [not definita]|22097C01|Mexico:Dur|1981

Chlosyne pardelina [not endeis]|17117C05|HT|USA:TX, Duval Co.|1980

Chlosyne pardelina [not endeis]|19086A10|PT|Mexico:SLP|1988

Chlosyne endeis|22057H07|Mexico:Nay|1985

Chlosyne endeis|22097C03|Mexico:Nay|~1980

Chlosyne melitaeoides|17117C11|USA:TX, Starr Co.|1974

Chlosyne melitaeoides|19086A09|Mexico:SLP|1984

Chlosyne eumeda|17119F01|Mexico:Gro|1910

Chlosyne eumeda]19125H05|Mexico:Mich|1989

Chlosyne erodyle|19125H03|Mexico:Chia|1988

Chlosyne erodyle|19125H04|Mexico:Chia|1988

Chlosyne melanarge|19086A07|09-SRNP-14964|Costa Rica|2009

Chlosyne melanarge|19125G07|Mexico:Oax|1988

Chlosyne marina|19086A08|Mexico:Chia|1988

Chlosyne marina|19125H06|Mexico:Chia|1988

Chlosyne definita definita|3462|USA:TX,Duval Co.|2015

C definita dolosa [not anastasia]|22088D10|PT|Mexico:Son|1987

Chlosyne definita definita]21025F12|Mexico:NL|2007

Chlosyne definita dolosa [not anastasia]|22088C 12|HT|Mexico:Chih|1984

Chlosyne definita dolosa [not anastasia]|22088D01|PT|Mexico:Son|1987

Chlosyne anastasia [not definita]|21025F10|Mexico:Dur|1981

Chlosyne anastasia [not definita]|22097C01|Mexico:Dur|1981

Chlosyne endeis|22057H07|Mexico:Nay|1985

Chlosyne endeis|22097C03|Mexico:Nay|~1980

36° -Chlosyne pardelina [not endeis]|17117CO5|HT|USA:TX, Duval Co.|1980

Chlosyne pardelina [not endeis]|19086A10|PT|Mexico:SLP|1988

Chlosyne melitaeoides|17117C11|USA:TX,Starr Co.|1974

Chlosyne melitaeoides|19086A09|Mexico:SLP|1984

Chlosyne eumeda|17119F01|Mexico:Gro|1910

Chlosyne eumeda|19125H05|Mexico:Mich|1989

Chlosyne erodyle|19125H03|Mexico:Chia|1988

Chlosyne erodyle|19125H04|Mexico:Chia|1988

Chlosyne melanarge|19086A07|09-SRNP-14964|Costa Rica|2009

Chlosyne marina]19125H06|Mexico:Chia|1988 hlosyne marina|19086A08|Mexico

anastasia [not definita]]22097C01|Mex

losyne endeis|22057H07|Mexico:Nay

losyne endeis|22097C03|Mexico:Nay

if pardelina [not endeis]|17117CO5|HT|USA:TX

pardelina [not endeis]|19086A10|PT|Mexico

iGhlosyne melitaeoides|19086A09|Mexico

hlosyne melitaeoides|17117C11|USA

iGhlosyne eumeda|17119F01|Mexico

61 Chlosyne eumeda|19125H05|Mexico

Chlosyne erodyle|19125H03|Mexico

Chlosyne erodyle|19125H04|Mexico

igjosyne melanarge|19125G07|Mexico

Fig. 6. Phylogenetic trees of selected Chlosyne species inferred from protein-coding regions of a) the nuclear genome

(autosomes), b) the Z chromosome, and c) the mitochondrial genome. Different taxa are shown in different colors: C. definita

(blue, with C. definita dolosa ssp. n. in red), C. anastasia stat. rest. (green), C. pardelina sp. n. (magenta), and C. endeis

(violet). One tree branch was truncated, as indicated by dots.

in the nuclear genome: hm2012952-RA.1:A156G, hm2012952-RA.1:A543T, hm2010701-RA.4:C66T,

hm2018077-RA.9:G69C, hm2006719-RA.4:C78T and in COI barcode: A286C, C451T, 562T, 574C, A625G.

Barcode sequence of the holotype. Sample NVG-17117C06, GenBank OR837724, 658 base pairs:

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGACTTT TAAT TCGAACAGAATTAGGAAATCCAGGTTCATTAATTGGAGATGATCAAATTTATAATACA

ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAA

TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATTCTCTTAATTTCCAGAAGAATTGTAGAAAAT GGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC

TCATAGAGGATCTTCTGTTGATTTAGCAATTTTTTCATTACATCTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACTACAATCATTAATATACGAATTAATAATATATCA

TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCCCTTTTACTACTTTTATCTTTACCTGTATTAGCTGGAGCTATTACCATACTTCTAACTGATCGAAATATTAATACAT

CATTTTTTGATCCTGCAGGGGGAGGAGATCCAATCTTATACCAACATTTATTT

Type material. Holotype: o deposited in the Texas A&M University Insect Collection, College Station,

TX, USA [TAMU], illustrated in Fig. 7, bears six labels: five white | TEXAS: | DUVAL COUNTY | Texas

det. Roy O. Kendall | [M. & B. No. 601.b] |, [ DNA sample ID: | NVG-17117C06 | c/o Nick V. Grishin ],

and one red [ HOLOTYPE o& | Chlosyne pardelina | Grishin ]. Its pupal case and the last instar caterpillar

exuvium are in a gelatine capsule pinned under the specimen. The date given on the label refers to

eclosion. Paratypes: 299: 19 the same data as the holotype, but eclosed on 13-Sep-1980 (NVG-

17117C05) and 12 Mexico: San Luis Potosi, Rte 80, 2-7 mi NW Ciudad del Maiz, 16-Jul-1988, D.

Mullins leg. (NVG-19086A 10, USNMENT 01314130) [USNM].

Type locality. USA: Texas, Duval Co., SH16 ca. 15 mi south of Freer at Parrilla Creek, GPS 27.6478,

—98.6572.

Fig. 7. Holotype of Chlosyne pardelina sp. n. in dorsal (left) and ventral (right) views, data in text.

Etymology. In the interest of stability, the name used by Higgins and Scott is kept. In Spanish, the word

pardelina refers to any small, spotted, or mottled bird, and it fits the general appearance of this species.

The name is a feminine noun in apposition.

Distribution. South Texas and northeastern Mexico.

Chlosyne anastasia (Hemming, 1934) is a species distinct from

Chlosyne definita (E. Aaron, [1885])

Melitaea anastasia Hemming, 1934, a replacement name for Melitaea beckeri Godman, [1901] (type

locality Mexico: Durango, Durango City), which is a junior primary homonym of Melitaea artemis var.

beckeri Herrich-Schaffer, 1851 (type locality in Spain), currently treated as a subspecies of Chlosyne

definita (E. Aaron, 1885) (type locality in USA: Texas, Nueces Co.) is genetically distant from it with

Fs/COI barcode difference of 0.27/3% (20 bp). The COI barcode difference is large because the

mitochondrial DNA of M. anastasia is closest (0.3%, 2 bp between the COI barcodes, likely due to

introgression) to Chlosyne endeis (Godman & Salvin, 1894) (type locality in Mexico: Nayarit) (Fig. 6c), a

Species more distant from M. anastasia according to the nuclear genome tree (Fig. 6a). Because of this

genetic differentiation, we propose that Chlosyne anastasia (Hemming, 1934), stat. rest. is a species

distinct from Chlosyne definita (E. Aaron, [1885]). Both C. definita and C. anastasia stat. rest. have been

recorded from the state of Durango, where the former is known from the north, and the latter is

documented from the south (Fig. 6). Chlosyne anastasia stat. rest. does not occur in the United States.

Chlosyne definita dolosa Grishin, new subspecies

http://zoobank.org/0CE8273D-D38A-47D7-A73E-A 15A3354B0CC

(Figs. 6 part, 8)

Definition and diagnosis. Before this work, western populations of Chlosyne definita (E. Aaron, 1885)

(type locality in USA: Texas, Nueces Co.), including those in northwestern Mexican states of Sonora and

Chihuahua have been placed within the subspecies Chlosyne definita anastasia (Hemming, 1934) (type

locality Mexico: Durango, Durango City) due to their phenotypic similarity in having less extensive dark

markings and narrower white band and spots on wings venter. Genomic trees reveal that C. d. anastasia is

not monophyletic, and the populations near its type locality are genetically differentiated at the species

level (1.e., C. anastasia stat. rest., see above) (Fig. 6), but more northern populations differ from them by

3.3% (22 bp) in COI barcode and are closer related to the nominotypical C. definita (COI barcode

difference of 0.6% 4 bp). Therefore, we regard these northwestern Mexico populations as conspecific

with C. definita, but due to their phenotypic and genetic differences propose that they constitute a distinct

subspecies. This new subspecies is phenotypically more similar to C. anastasia stat. rest. and differs

from it in the following characters: the central white band on the ventral hindwing is less broad but

broader than in the nominotypical subspecies; black markings are more extensive but less expressed than

in the nominotypical subspecies, e.g., the basal white band on the ventral hindwing is typically cut

through (or even cut short) by black overscaling around vein 1A+2A. Due to phenotypic variability,

definitive identification is provided by DNA, and a combination of the following characters is diagnostic

in the nuclear genome: hm2010867-RA.6:C66T, hm2010867-RA.6:G87A, hm2003966-RA.6:T1521C, hm200

3966-RA.6:C4239T, hm2014195-RA.2:A709G and in COI barcode: A40G, 169T, A205T, T283C, T475T.

Barcode sequence of the holotype. Sample NVG-22088C12, GenBank OR837725, 658 base pairs:

TACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTGGGAACATCTTTAAGACTTTTAATTCGAACAGAATTAGGAAATCCAGGTTCATTAATTGGAGATGATCAAATTTATAATACA

ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAA

TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATCCTATTAATTTCCAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC

TCATAGAGGATCATCTGTTGATTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATCACCACAATCATTAATATACGAGTTAATAATATATCA

TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTCTTTTACTACTTTTATCTTTACCTGTATTAGCTGGAGCAATTACAATACTTCTAACTGATCGAAATATTAATACAT

CATTCTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: & deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida

Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 8, bears four printed (text

Fig. 8. Holotype of Chlosyne definita dolosa ssp. n. in dorsal (left) and ventral (right) views, data in text.

in italics handwritten) labels: three white [| Chihuahua, Mex. | 19.4 miles E. of | Tomochic Oak-Pine | July

2009-26 |, [ DNA sample ID: | NVG-22088C12 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ¢@ |

Chlosyne definita | dolosa Grishin ]. Paratypes: 292 Mexico, Sonora, 5 mi NW of Yecora, plateau edge,

25-Jul-1987, M. Smith leg. (NVG-22088D10) and 28/29-Jul-1987 (NVG-22088D01) [MGCL].

Type locality. Mexico: Chihuahua, 19.4 mi E of Tomochic, elevation ca. 7000".

Etymology. In Latin, do/osus means cunning, deceitful, crafty, or sly. The name is given for the deceitful

nature of this subspecies, which was hidden behind the name Chlosyne anastasia before it was revealed

by genomic sequence comparison. The name is a feminine adjective.

Distribution. Northwestern Mexico, recorded from the states of Sonora and Chihuahua.

Chlosyne bollii (W. H. Edwards, 1878) is a species distinct

from Chlosyne theona (Ménétriés, 1855)

Our previous genomic analysis demonstrated that Chlosyne chinatiensis (Tinkham, 1944) (type locality in

USA: Texas, Presidio Co.) is a species distinct from Chlosyne theona (Ménétriés, 1855) (type locality in

Nicaragua) (Zhang et al. 2020) in agreement with Cassie et al.(2001). Sequencing of additional specimens

across the range from Arizona and Texas to Costa Rica reveals that Melitaea bollii W. H. Edwards, 1877

(type locality USA: Texas, Bexar Co., San Antonio), currently regarded as a subspecies of C. theona (Fig.

nuclear **—= Chlosyne chinatiensis|3246|USA:TX,Hudspeth Co.|1998 Z-chr C chinatiensis|7663|Mexico:NL|1977

3 C chinatiensis|3246|USA:TX,Hudspeth Co.|1998 mito

C chinatiensis|697|USA:TX, Brewster Co.|2009 —_—_——-

om © chinatiensis|22097D02|USA:TX,Culberson Co.|1980

C chinatiensis|7664|Mexico:NL|1977

C chinatiensis|7663|Mexico:NL|1977

C theona bollii X chinatiensis|19072B01|USA:TX, Brewster Co.|1994

- C bollii [not theona]|22042C02|HT|USA:TX, Bexar Co.|old

2" C bollii [not theona]|5209|USA:TX,Starr Co.|2015

C bollii [not theona]|22065F11|USA:TX,Uvalde Co.|2003

C bollii [not theona]|22097D01|USA:TX, Val Verde Co.|1981

C bollii [not theona]|22104C12|USA:TX, Terrell Co,|1978

Chlosyne chinatiensis|697|USA:TX,Brewster Co.|2009

Chlosyne chinatiensis|22097D02|USA:TX,Culberson Co.|1980

Chlosyne chinatiensis|7664|Mexico:NL|1977

Chlosyne chinatiensis|7663|Mexico:NL|1977

Chlosyne theona bollii X chinatiensis|19072B01|USA:TX, Brewster Co.|1994

Chlosyne bollii [not theona]|22042C02|HT|USA:TX, Bexar Co.|old

Chlosyne bollii [not theona]|22065F10|USA:TX,Hidalgo Co.|2006

Chlosyne bollii [not theona]|22065F05|USA:TX, Brewster Co.|2005

Chlosyne bollii [not theona]|22065F11|USA:TX,Uvalde Co.|2003 J 499

Chlosyne bollii [not theona]|22065F08|USA:TX,Medina Co.|2007

Chlosyne bollii [not theona]|22097D01|USA:TX,Val Verde Co.|1981

Chlosyne bollii [not theona]|22104C12|USA:TX, Terrell Co.|1978

Chlosyne bollii [not theona]]22104C11|USA:TX,Val Verde Co.|1981

Chlosyne bollii [not theona]|5209|USA:TX, Starr Co.|2015

Chlosyne theona thekla|9728|USA:AZ,Cochise Co.|2017

Chlosyne theona thekla|15099A01|LT|USA:AZ,Pima Co.|old

Chlosyne theona thekla|22097F02|USA:AZ,Yavapai Co.|1995

Chlosyne theona thekla|22057H12|USA:AZ,Navajo Co.|1985

Chlosyne theona thekla|10947|USA:TX,Jeff Davis Co.|2018

Chlosyne theona brocki|22097D06|Mexico:Son|1986

Chlosyne theona brocki|22097D05|Mexico:Son|1984

Chlosyne theona mullinsi|22097E07|Mexico:Hid|1986

Chlosyne theona mullinsi|22097E10|Mexico:Oax|1979

Chlosyne theona minimus|22097E02|Guatemala|1969

Chlosyne theona minimus|22097D11|Belize|1992

Chlosyne theona theona|22097C09|Nicaragua|1969

Chlosyne theona costaricensis|22097D08|Costa Rica|1978 0.003

Chlosyne theona costaricensis|22097D07|Costa Rica|1969

9 chinatiensis|22059D09|USA:TX, Jeff Davis

1 fe chinatiensis|697|USA:TX, Brewster

chinatiensis|22064E09|USA:TX, Brewster

7€ chinatiensis|3246|USA:TX,Hudspeth

i chinatiensis|22097D02|USA:TX,Culberson

theona bollii X chinatiensis|19072B01|USA

il ¢ bollii [not theona]|22065F10|USA:TX, Hidalgo

s& bollii [not theona]|22104C12|USA:TX, Terrell

9€ bollii [not theona]|22042C02|HT|USA:TX, Bexar

4C bollii [not theona]|22065F11|USA:TX,Uvalde

0.02

C bollii [not theona]|22104C11|USA:TX, Val Verde Co.|1981

C bollii [not theona]|22065F10|USA:TX,Hidalgo Co.|2006

C bollii [not theona]|22065F05|USA:TX, Brewster Co.|2005

C bollii [not theona]|22065F08|USA:TX,Medina Co.|2007

C theona thekla|9728|USA:AZ,Cochise Co.|2017

C theona thekla|10947|USA:TX,Jeff Davis Co.|2018

C theona thekla]22057H12|USA:AZ,Navajo Co.|1985

C theona thekla|22097F02|USA:AZ, Yavapai Co.|1995

C theona thekla|15099A01|LT|USA:AZ,Pima Co.|old

C theona brocki|22097D05|Mexico:Son|1984

C theona brocki|22097D06|Mexico:Son|1986

C theona mullinsi|22097E10|Mexico:Oax|1979

C theona mullinsi|22097E07|Mexico:Hid|1986

C theona minimus|22097D11|Belize|1992

C theona minimus|22097E02|Guatemala|1969

C theona theona|22097C09|Nicaragua|1969

C theona costaricensis|22097D07|Costa Rica|1969

C theona costaricensis|22097D08|Costa Rica]1978

9€ bollii [not theona]|5209|USA:TX,Starr Co.

30 C bollii [not theona]|22065F08|USA:TX,Medina

C bollii [not theona]|22097D01|USA:TX, Val Verde

o bollii [not theona]|22104C11|USA:TX, Val Verde

bollii [not theona]|22065F05|USA:TX, Brewster

&& theona thekla|22057H12|USA:AZ,Navajo

gaC theona thekla|22097F02|USA:AZ, Yavapai

7€ theona thekla]10947|USA:TX,Jeff Davis

C theona thekla|15099A01|LT|USA:AZ,Pima

theona mullinsi|22097E07|Mexico:Hid

14 theona mullinsi|22097E10|Mexico:0ax

10d C theona brocki|22097D05|Mexico:Son

C theona minimus|22097E02|Guatemala

joe theona theona|22097C09|Nicaragua

€,theona costaricensis|22097D08|C Rica

C theona costaricensis|22097D07|C Rica

otheona brocki|22097D06|Mexico:Son|1986

theona thekla|9728|USA:AZ,Cochise Co.|2017

“Oo

0.003

Fig. 9. Phylogenetic trees of selected Chlosyne species inferred from protein-coding regions of a) the nuclear genome

(autosomes), b) the Z chromosome, and c) the mitochondrial genome. Different taxa are shown in different colors: C.

chinatiensis (green), C. bollii stat. rest. (red), C. theona (blue, with nominotypical subspecies in violet color), and a hybrid

specimen C. bollii (father) x C. chinatiensis (mother) (olive, highlighted in yellow). One tree branch was truncated, as

indicated by dots.

9 red) forms a prominent clade that is sister to C. chinatiensis in the tree from autosomes (Fig. 9a) and in

the mitochondrial genome tree (with some possible introgression, Fig. 9c) (i.e., not monophyletic with

Chlosyne theona), but is sister to C. theona in the Z chromosome tree (Fig. 9b). All other subspecies of C.

theona we sequenced (including a nominotypical specimen from Nicaragua, NVG-22097C09) clustered

together and were not strongly separated from each other despite large geographic distances between

these populations, e.g., Chlosyne theona thekla (W. H. Edwards, 1870) (type locality in USA: AZ, Pima

co.) and Chlosyne theona costaricensis (Austin & M. Smith, 1998) (type locality in Costa Rica), and their

phenotypic distinction. The genetic differentiation of C. theona bollii from C. chinatiensis and all other

sequenced C. theona subspecies is at the level characteristic of distinct species, 1.¢., Fst/Gmin/COI barcode

difference of 0.62/0.001/0.6% (4 bp, they essentially share mitochondrial DNA) (C. chinatiensis) and

0.46/0.003/1.2% (8 bp) (C. theona). Therefore, we propose that Chlosyne bollii (W. H. Edwards, 1878),

stat. rest. is a species distinct from Chlosyne theona (Ménétriés, 1855).

A natural hybrid between Chlosyne bollti (W. H. Edwards, [1878])

and Chlosyne chinatiensis (Tinkham, 1944)

Sequencing of a suspected hybrid between Chlosyne bollii (W.

H. Edwards, [1878]), stat. rest. (type locality USA: Texas,

Bexar Co., San Antonio) and Chlosyne chinatiensis (Tinkham,

1944) (type locality in USA: Texas, Presidio Co.), a female

NVG-19072B01 collected in USA: Texas, Brewster Co., along

FM2627 25 mi SE of USH385 on 23-Mar-1994 by Steve M.

Spomer (Fig. 10) places it in different positions in the three trees

(Fig. 9 olive) thus confirming its hybrid origin. In the nuclear

genome tree constructed from autosomes (Fig. 9a), this

Specimen is sister to C. chinatiensis, suggesting that it has a

significant fraction of C. chinatiensis genes. In the Z

chromosome tree (Fig. 9b), this specimen is within C. bollii,

suggesting that its Z chromosome, which in females is inherited

from the father (in butterflies, ZZ are males and ZW are

females), came from C. bol/ii. In the mitochondrial genome tree

(Fig. 9c), the specimen is placed within C. chinatiensis,

suggesting that its mitochondrial DNA, which is inherited from |

the mother, came from C. chinatiensis. Therefore, we confirm Fig. 10. Chlosyne bollii (father) = C.

this female as a natural interspecies hybrid and conclude that its | ¢//7aensis (mother) hybrid in dorsal (top)

father was C. bollii, and its mother was C. chinatiensis. SGV CIAL COU OWN) WIE WS TE DEVE POMEL

Family Riodinidae Grote, 1895 (1827)

Euselasia satyroides Lathy, 1926 and Eurygona modesta H. Bates, 1868

belong to the genus Eugelasia Grishin, 2021

Genomic trees reveal that Euselasia satyroides Lathy, 1926 (type locality in Argentina) is sister to

Eugelasia brevicauda (Lathy, 1926) (type locality in Bolivia) and, therefore, originates within the genus

Eugelasia Grishin, 2021 (type species Eurygona eugeon Hewitson, 1856) (Fig. 11). Although we have not

sequenced Eurygona modesta H. Bates, 1868, currently in the genus Euselasia Hiibner, 1819 (type

species Euselasia gelaena Hiibner, 1819, which is a junior subjective synonym of Papilio gelon Stoll,

1787), it is phenotypically similar to E. satyroides and its relatives (Santos et al. 2014). Therefore, we

propose the following new combinations: Eugelasia satyroides (Lathy, 1926) and Eugelasia modesta (H.

Bates, 1868).

Methone noctula|18072D12|12-SRNP-56637|Costa Rica|2013 [Jp

Methone cecilia|18121F11|Guyana|2000

Eurylasia euryone|19035C10|Guyana|2000

Myselasia mys|19036A12|Guyana|2006

Erythia labdacus reducta|19036C07|Bolivia|2003

Erythia thucydides|19036D09|Brazil:RJ|1994

Methone noctula|18072D12|12-SRNP-56637|Costa Rica

Methone cecilia|18121F11|Guyana|2000

Eurylasia euryone|19035C10|Guyana|2000

Myselasia mys|19036A12|Guyana|2006

Erythia labdacus reducta|19036C07|Bolivia|2003

Erythia thucydides|19036D09|Brazil:RJ|1994

Pelolasia pelor|19035A12|Peru:MD|1991

» Pelolasia cataleuca|19035C02|Mexico:Ver|1910

Pelolasia leucophryna [not Euselasia]|22034A12|ST|Costa Rica

Marmessus lisias|19036G05|Guyana|2001

Maculasia albomaculiga|19035D07|Ecuador:Pastaza|1988

Euselasia gelon|19035G06|French Guiana|1988

Euselasia phedica|19035E11|Guyana|2000

cof Ugelasia brevicauda|19036F09|Brazil:RO|1991

Eugelasia satyroides [not Euselasia]|22074H01|Argentina

Eugelasia eugeon|19036F 10|Guyana|2000

mito

Pelolasia pelor|19035A12|Peru:MD|1991

joe Clolasia cataleuca|19035C02|Mexico:Ver|1910

Pelolasia leucophryna [not Euselasia]|22034A12|ST|Costa Ricalold

Marmessus lisias|19036G05|Guyana|2001

Maculasia albomaculiga|19035D07|Ecuador:Pastaza|1988

Euselasia gelon|19035G06|French Guiana|1988

Euselasia phedica|19035E11|Guyana|2000

of Ugelasia brevicauda|19036F09|Brazil:RO|1991

Too-ugelasia satyroides [not Euselasia]|22074H01|Argentina|1973

0.03 Eugelasia eugeon|19036F 10|Guyana|2000

0.03

Fig. 11. Phylogenetic trees of selected Euselasiini species inferred from protein-coding regions of a) the nuclear (autosomes)

and b) the mitochondrial genomes. Different genera are colored differently, and species transferred between genera are labeled

in different colors: Eurygona leucophryna comb. nov. (magenta) and Eugelasia satyroides comb. nov. (orange).

Eurygona leucophryna Schaus, 1913 belongs to the genus Pelolasia Grishin, 2021

Genomic sequencing of a syntype of Eurygona leucophryna Schaus, 1913 (type locality in Costa Rica:

Cachi) reveals that it is sister to Pelolasia cataleuca (R. Felder, 1869) (Fig. 11) in the genus Pelolasia

Grishin, 2021 (type species Eurygona pelor Hewitson, 1853). This close relationship with P. cataleuca

was mentioned in the original description of E. leucophryna (Schaus 1913). Thus, we propose Pelolasia

leucophryna (Schaus, 1913), comb. nov.

Erythia paracheles Grishin, new species

http://zoobank. org/E7TE4D9E8-760B-4D0F-BFC7-DD0060AC7FBB

(Figs. 12, 13 part)

Definition and diagnosis. Genomic analysis reveals that an orange female from central Panama (Figs. 12,

13 orange) initially identified as an aberration of Erythia aurantiaca (Salvin & Godman, 1868) (type

locality in Guatemala) is instead sister to but genetically differentiated from Erythia cheles (Godman &

Salvin, 1889) (type locality in Panama: Chiriqui, holotype sequenced as NVG-21123B03) (Fig. 13), e.g.,

COI barcode difference of 4.4% (29 bp). We sequenced two specimens of E. cheles (the holotype and

another female, NVG-19036F06), and they are genetically close to each other (Fig. 13 blue). However,

due to strong genetic differentiation, the orange female represents a distinct species that, according to our

investigation, does not have a name. The female of this new species differs from its relatives in the nearly

uniform orange coloration of the dorsal side of wings, only with a hint of the brown outer margin, more

developed by the apex of the forewing, and is similarly orange, only slightly yellower, on the ventral side,

with a thin postdiscal darker orange band on both wings and no other markings. In females of other

species, the apex of the dorsal forewing and usually the outer margin are largely brown, and there are at

1cm

Fig. 12. Holotype of Erythia paracheles sp. n. in dorsal (left) and ventral (right) views, data in text.

Erythia cheles|21123B03|HT|Panama:Chiriqui|1886 b mitochondrial

100 » Erythia cheles|19036F06|Panama:Herrera|1978

Erythia paracheles [not aurantiaca or cheles]|19036F07|HT|Panama|1976

Erythia borrosa|19036HO9|HT|Panama:Panama|1973

Erythia aurantiaca|22074G04|Mexico:Ver|1963

5p Erythia aurantiaca|22074G01|Guatemala|1992

Erythia aurantiaca|22074G02|Belize|1990

Erythia teleclus|19036D07|Peru:MD|2011

Erythia labdacus labdacus|22074E04|Suriname|2002

Erythia midas crotopina|22074F09|Ecuador:Sucumbios|1990

peythia cheles|21123B03|HT|Panama:Chiriqui|1886

rythia cheles|19036F06|Panama:Herrera|1978

Erythia paracheles [not aurantiaca or cheles]|19036F07|HT

Erythia borrosa|19036HO9|HT|Panama:Panama|1973

toy aurantiaca|22074G04|Mexico:Ver|1963

gythia aurantiaca|22074G01|Guatemala|1992

Erythia aurantiaca|22074G02|Belize|1990

Erythia teleclus|19036D07|Peru:MD|2011

Erythia labdacus labdacus|22074E04|Suriname|2002

0.02 Erythia midas crotopina|22074F09|Ecuador:Sucumbios

a nuclear

Fig. 13. Phylogenetic trees of selected Erythia species inferred from protein-coding regions of a) the nuclear (autosomes) and

b) the mitochondrial genomes. Different species are colored in different colors: E. cheles (blue), E. paracheles sp. n. (orange),

E. borrosa sp. n. (magenta), and E. aurantiaca (violet).

least traces of black submarginal spots on the ventral hindwing. While it remains unclear whether this

Specimen is an aberration, we are confident that it is a species distinct from both E. cheles and E.

aurantiaca due to its prominent genetic differentiation, and, therefore, it is described as a new species. To

confidently identify this new species despite the unknown phenotypic variation, we provide a diagnostic

combination of DNA characters in the nuclear genome: cne1 1073.6.7:T54C, cne3970.3.2:TII1C, cne20880.

1.4:A84G, cne10214.9.8:A66G, cne4577.3.8:C18T, cne1935.4.1:C1113C (not T), cne1935.4.1:C1558C (not

A), cne84.2.2:C1860C (not T), cne15258.2.1:A612A (not T), cnel4561.1.14:C79C (not T) and in the COI

barcode: T16C, 88C, T142C, T169C, T250C, T361C, T391A, T400C, A577G, T619C.

Barcode sequence of the holotype. Sample NVG-19036F07, GenBank Sane AS: 658 base pairs:

AACTTTATATTTTATCTTTGGAATTT Sea Nae TAGTAGGAACATCATTAAGACTATTAATTCGAATAGAATTAGGAATTTCAGGCTCTTTTATTGGAGATGATCAAATTTATAATACT

ATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCCATTATAATCGGAGGATTTGGAAATTGACTAGTCCCCCTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAA

TAAATAACATAAGATTTTGATTATTACCCCCCTCATTAATACTTTTAATTTCAAGAAGAATTGTCGAAAACGGAGCAGGAACAGGATGAACTGTGTACCCCCCACTATCATCTAATATCGC

TCACAGAGGATCATCAGTTGATT TAGCAATTTTTTCCTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAACTTTATCACAACAATTATTAATATACGAGTAAATAATATAATA

TTCGATCAAATATCCCTATTTATCTGAGCTGTTGGTATTACAGCTCTATTACTTTTACTATCATTACCAGTTT TAGCAGGAGC1 TATTACTATGCTATTAACTGATCGAAATTTAAATACAT

CATTTTTTGATCCCGC1 r'GGAGGAGGAGATCCAAI TTCTTTACCAACATTTATTT

Type material. Holotype: ° deposited in the National Museum of Natural History, Washington, DC,

USA [USNM], illustrated in Fig. 12, bears four printed labels: three white [ Riodinidae? 3/28/76 | Las

Cruces Trail, CZ |, [DNA sample ID: | NVG-19036F07| c/o Nick V. Grishin ], [ USNMENT | {QR

Code} | 00939912 ], and one red [ HOLOTYPE 2 | Erythia paracheles | Grishin ].

Type locality. Panama: Canal Zone, Las Cruces Trail.

Etymology. The prefix “para” means alongside, near, beyond, or similar to. This new species is sister to

E. cheles and is similar to it. The name is treated as a masculine noun in apposition.

Distribution. Currently known only from the holotype collected in central Panama.

Erythia borrosa Grishin, new species

http://zoobank. org/86B3 96F7-EF80-4EC8-AE29-A4D674DCDDDE

(Figs. 13 part, 14)

Definition and diagnosis. Genomic phylogeny inferred from all sequenced specimens of Euselasiini

Kirby, 1871 (1867) reveals that a specimen from central Panama (Figs. 13 magenta, 14) is sister to the

clade of Erythia cheles (Godman & Salvin, 1889) (type locality in Panama: Chiriqui) with Erythia

paracheles sp. n. (type locality in Panama: Canal Zone) and therefore represents a species distinct from

them (Fig. 13), also being strongly differentiated genetically, e.g., COI barcode difference of 4.9% (32 bp)

from E. cheles and 5.9% (39 bp) from E. paracheles. These three species form a clade sister to Erythia

aurantiaca (Salvin & Godman, 1868) (type locality in Guatemala). Even in wing patterns, the specimen

from Panama appears different from the named taxa, and these differences, supported by genetic

differentiation, suggest that this specimen belongs to a new species. Males of this new species differ from

their relatives in a diffuse boundary between brown framing along wing margins and orange interior on

the dorsal side: brown overscaling partially extends into orange areas. The brown/orange boundary is

sharper and could even be rather crips in closely related species, or orange areas are more restricted on

forewing to the area between the inner margin and discal cell. The costal area of the dorsal hindwing is

brown from its base, and the discal cell is largely orange but brown towards the costa; the dorsal hindwing

has a brown batch at the apex and a brown margin of decreasing width and disappearing towards the

tornus; the submarginal area is browner than the brighter orange discal area from costa to mid-wing. The

Fig. 14. Holotype of Erythia borrosa sp. n. in dorsal (left) and ventral (right) views, data in text.

ventral side of the wings is pearly-pinkish with a posdiscal pale-brown line on all wings (close to a

submarginal row of spots on the hindwing) and orange-brown narrow marginal framing. Due to

unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the

following characters is diagnostic in the nuclear genome: cne5785.3.5:A96T, cne7688.1.2:T150G, cne3970.

3.2:G96A, cne254625.2.3:G270A, cnel10780.4.1:T1347A, cne4782.4.3:T282T (not C), cne3195.11.14:A54A

(not G), cne563.4.3:G216G (not A), cne563.4.3:G219G (not A), cne3970.3.2:TI11T (not C) and in COI

barcode: T4C, T56T, T197T, T202C, T206T, T274C, T550C.

Barcode sequence of the holotype. Sample NVG-19036H09, GenBank OR837727, 658 base pairs:

AACCTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAATAGAACTAGGAATTTCAGATTCTTTTATTGGAGATGATCAAATTTATAACACT

ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGT CCCATTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAA

TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATTCTCTTAATTT CAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACTGTGTACCCCCCACTATCATCTAATATTGC

TCATAGAGGATCATCAGTTGATTTAGCTATTTTCTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAGTAAATAATATAATA

TTTGATCAAATATCTCTATTTATTTGAGCTGTAGGAATTACAGCATTATTACTCTTATTATCATTACCAGTT TTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATCTAAATACAT

CATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT

Type material. Holotype: & deposited in the National Museum of Natural History, Washington, DC,

USA [USNM], illustrated in Fig. 14, bears four printed (2™ and 3" lines on the 1‘ label handwritten)

labels: three white [ Panama:Panama | Cerro Campana | 800m. 17.III.1973 | G. B. Small ], [ DNA sample

ID: | NVG-19036H09 | c/o Nick V. Grishin |], [USNMENT | {QR Code} | 01544858 |, and one red

| HOLOTYPE co | Erythia borrosa | Grishin ].

Type locality. Panama: Panama Province, Cerro Campana, elevation 800 m.

Etymology. In Spanish, borrosa means blurry or fuzzy. The name refers to edges between brown and

orange in this species that lack the sharpness of its relatives, and brown gradually dissolves into orange, or

orange is overscaled with brown towards the margins. The name is a Latinized feminine adjective.

Distribution. Currently known only from the holotype collected in central Panama.

Mesosemia nesti Hewitson, 1858, Mesosemia acuta Hewitson, 1873,

and Mesosemia eurythmia Stichel, 1915 belong to the genus Ectosemia Grishin, 2021

Genomic sequencing of Mesosemia nesti Hewitson, 1858 (type locality in French Guiana)—the species

transferred to Semomesia Westwood, 1851 (type species Papilio croesus Fabricius, 1777) in Callaghan

and Lamas (2004)—and Mesosemia acuta Hewitson, 1873 (type locality in Brazil, possibly Rio de

Janeiro) reveals that they are not monophyletic with Mesosemia Hibner, 1819 (type species Mesosemia

philoclessa Hiibner, 1819) that includes Semomesia as its junior subjective synonym, but instead originate

within the genus Ectosemia Grishin, 2021 (type species Papilio eumene Cramer, 1776) (Fig. 15).

Therefore, we propose the following new combinations: Ectosemia nesti (Hewitson, 1858) and

Ectosemia acuta (Hewitson, 1873). Although we have not sequenced Mesosemia eurythmia Stichel, 1915

(type locality in Brazil: Amazonas), we tentatively place it in Ectosemia due to wing pattern similarities:

Ectosemia eurythmia (Stichel, 1915), comb. nov.

Ectosemia eumene [TS of Ectosemia]|19037H07|Guyana

Ectosemia attavus [not eumene]|19037H08|Ecuador:Pastaza

ctosemia erinnya|21126C01|PLT|Ecuador:Archidonalold

etosemia erinnya (=furia) [not eumene]|18121H06|Peru

ihcetosemia erinnya (=furia) [not eumene]|21126B11|LT|Bolivia

Ectosemia erinnya|21126B12|LT|Peru:Pozuzolold

Ectosemia acuta [not Mesosemia]|]19037H12|Brazil:RJ

Ectosemia nesti [not Semomesia]|18122A01|French Guiana

Ectosemia steli|19037H11|Peru:Cusco|2015

Mesosemia tullius[TS of Perophthalma]|18122A10|Guyana

Mesosemia philocles [TS of Mesosemia]|19037D02|Guyana

Mesosemia croesus [TS of Semomesia]|19038A04|Guyana

Mesosemia icare [TS of Leucochimona]|19038A05|Guyana

Mesosemia idotea [TS of Mesophthalma]|18122B01|Brazil:RO

Endosemia ulrica [TS of Endosemia]|19037H06|Guyana

Endosemia macella|19037H10|Brazil:RO|1991

Hyphilaria nicia|19121G01|Guyana|2000

Napaea eucharila]18072F01|13-SRNP-1135|Costa Rica|2013

;gEctosemia eumene [TS of Ectosemia]|19037HO7|Guyana|2000 . :

* Ectosemia attavus [not eumene]|19037H08|Ecuador:Pastaza|1969 b mitochondrial

7gq_Ectosemia erinnya|21126C01|PLT|Ecuador:Archidonalold

séctosemia erinnya (=furia) [not eumene]|18121H06|Peru|1995 0.04

Ectosemia erinnya (=furia) [not eumene]|21126B11|LT|Boliviajold

Ectosemia erinnya|21126B12|LT|Peru:Pozuzo|lold

Ectosemia acuta [not Mesosemia]|19037H12|Brazil:RJ|1994

Ectosemia nesti [not Semomesia]|18122A01|French Guiana|1988

Ectosemia steli]19037H11|Peru:Cusco|2015

Mesosemia tullius [TS of Perophthalma]|18122A10|Guyana|1999 96

Mesosemia philocles [TS of Mesosemia]|19037D02|Guyana|2001

Mesosemia croesus [TS of Semomesia]|19038A04|Guyana|2000

Mesosemia icare [TS of Leucochimona]|19038A05|Guyana|2001

Mesosemia idotea [TS of Mesophthalma]|18122B01|Brazil:RO|1996

Endosemia ulrica [TS of Endosemia]|19037H06|Guyana|2000

Endosemia macella]19037H10|Brazil:RO|1991

Hyphilaria nicia|19121G01|Guyana|2000

Napaea eucharila|18072F01|13-SRNP-1135|Costa Rica|2013

a_ionuclear

Fig. 15. Phylogenetic trees of selected Mesosemiini species inferred from protein-coding regions of a) the nuclear (autosomes)

and b) the mitochondrial genomes. Different genera of Mesosemiina are colored in different colors: Ectosemia (blue, with

Ectosemia acuta comb. nov. and Ectosemia nesti comb. nov. labeled in red; Ectosemia attavus stat. nov. in magenta; and

Ectosemia erinnya in cyan), Mesosemia (violet), and Endosemia (olive). TS - type species.

Mesosemia eumene furia Stichel, 1910 is a Junior subjective synonym

of Ectosemia erinnya (Stichel, 1910)

Genomic analysis of syntypes of Mesosemia eumene erinnya Stichel, 1910 (type locality in Ecuador and

Peru, sequenced as NVG-21126B12 and NVG-21126C01), currently a valid species of Ectosemia

Grishin, 2021 (type species Papilio eumene Cramer, 1776) and Mesosemia eumene furia Stichel, 1910

(type locality in Bolivia and Peru, sequenced as NVG-21126B11) kept in the same status since its

description and, as a consequence of being a subspecies of the type species (Zhang et al. 2021) of

Ectosemia, transferred in this genus, reveals that they are genetically close (Fig. 15), do not segregate into

separate clades, and most likely are conspecific. Therefore, we propose that Mesosemia eumene furia

Stichel, 1910, syn. nov. is a junior subjective synonym of Ectosemia erinnya (Stichel, 1910). To define

these taxa objectively and to clarify their type localities, their lectotypes are designated below.

First, N.V.G. hereby designates a syntype in the MFNB collection, a female with the following six

printed (but 4" handwritten) labels, the 1%‘ red, 4° greenish-gray, and others white: [ Typus ], [ Stid Peru |

NVG-21126B12 | c/o Nick V. Grishin | as the lectotype of Mesosemia eumene erinnya Stichel, 1910. The

lectotype is a specimen in good condition with half of its right antenna broken off, and some scales

rubbed off near the middle of the forewing outer margin. The type locality of Ectosemia erinnya becomes

Peru: Pozuzo. According to our genomic analysis, the lectotype is conspecific with the paralectotype

(NVG-21126C01) from Ecuador: Archidona (Fig. 15).

Second, N.V.G. hereby designates a syntype in the MFNB collection, a male with the following

six printed (but 4" handwritten) labels, the 1% red, 4°" greenish-gray, and others white: [ Typus ], [ Bolivia

| NVG-21126B11 | c/o Nick V. Grishin | as the lectotype of Mesosemia eumene furia Stichel, 1910. The

lectotype lacks the abdomen, and outer-marginal segments of the right forewing are chipped off from the

middle to the tornus. The type locality of M. e. furia becomes Bolivia: La Paz, Farinas.

Mesosemia eumene race attavus J. Zikan, 1952 is a species distinct

from Ectosemia eumene (Cramer, 1776)

The genomic comparison reveals that Mesosemia eumene race attavus J. Zikan, 1952 (type locality in

Brazil: Amazonas, Sdo0 Gabriel da Cachoeira municipality, Rio Negro), currently a subspecies of

Ectosemia eumene (Cramer, 1776) (type locality in Suriname), is strongly differentiated genetically from

the latter (Fig. 15), e.g., COI barcode difference of 4.4% (29 bp). These genetic and also pronounced

phenotypic differences in wing patterns (narrower dark brown dorsal hindwing bands) and shapes (more

convex outer hindwing margin) suggest that Ectosemia attavus (J. Zikan, 1952), stat. nov. is a species

distinct from Ectosemia eumene (Cramer, 1776).

Cremna telarania Grishin, new species

http://zoobank. org/8EFIOAA2F-9A47-4201-9E26-C 1507FDC9IFDO

(Figs. 16, 17 part)

Definition and diagnosis. Genomic sequencing of Cremna E. Doubleday, 1847 (type species Papilio

actoris Cramer, 1776) reveals a clade consisting of a pair from Bolivia (Fig. 16) distinct from other

species in the C. actoris group (Fig. 17): COI barcode difference of 1.8% (12 bp) with a syntype of

Cremna meleagris Hopffer, 1874 (type locality in Peru: Chanchamayo), a junior subjective synonym of

Cremna heteroea H. Bates, 1867 (type locality in Brazil: Amazonas), sister to the clade representing the

new species. This new species differs from its relatives in smaller size, paler wings (especially beneath),

more prominent cream-colored marginal spots above, and boomerang-shaped, narrower on the dorsal side

postdiscal (in addition to submarginal) spots on both wings (weak on dorsal forewing in the female).

These spots are broader and rounder in other species and are crescent-shaped only in Cremna calitra

Hewitson, 1869 (type locality in Ecuador), a species with mostly larger spots on the dorsal side, but

smaller spots along the outer wing margins (especially on the hindwing) and on the ventral side.

Barcode sequence of the holotype. Sample NVG-22112E04, GenBank OR939283, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGTTCATCTTTAAGTATTTTAATTCGTATAGAATTAGGAATACCTGGTTCTCTTATTGGAGATGATCAAATTTATAATACT

ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGTAATTGATTAGT TCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGTA

TAAATAATATAAGTTTTTGACTTTTACCCCCCTCTTTATTCCTTTTAATTTCGAGAAGAATTGTCGAAAATGGAGCAGGTACAGGATGAACTGTCTACCCCCCTTTATCTTCTAATATTGC

TCACAGAGGCTCTTCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCCGGTATTTCTTCTATTTTAGGTGCTATTAATTTCAT TACAACTATTATCAATATACGTATTAATAATTTATCA

TTTGATCAAATACCTTTATTTGTTTGATCAGTTGGTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAACTTAAATACTT

CTTTTTTCGACCCAGCAGGAGGAGGAGACCCTATTCTTTATCAACATTTATTT

Fig. 16. Cremna telarania sp. n. in dorsal (above) and ventral (below) views, data in text:

a) holotype & NVG-22112E04 and b) paratype 9 NVG-22112E11.

Cremna actoris|22112E06|Suriname|old

Cremna actoris|22112F01|Suriname|1898-9

Cremna actoris|22112E07|"Corityba S.Paulo"|old

Cremna actoris|22112F03|French Guianalold

a nuclear

Cremna heteroea|22112E02|Brazil:AM|old

Cremna heteroea|22112E12|Peru:Pozuzolold

Cremna heteroea|22112E05|Peru:Chmlold

Cremna telarania|22112E04|HT|Bolivia|1890

Cremna heteroea|22112D10|Ecuador:Macas|old

Cremna heteroea|22112E01|Peru:Iquitos|1895

Cremna heteroea (=meleagris)|21125A12|ST|Peru:Chmlold

Cremna actoris|22112E06|Surinamel|old

gemna actoris|22112F01|Suriname|1898-9

sfremna actoris|22112E07|"Corityba S.Paulo"|old

Cremna actoris|22112F03|French Guianalold

&remna heteroea|22112D10|Ecuador:Macas|old

geremna heteroea|22112E01|Peru:lquitos|1895

Cremna heteroea|22112E02|Brazil:AM|old

'?° Cremna heteroea|22112E12|Peru:Pozuzo|old

geremna heteroea|22112E05|Peru:Chmlold

Cremna heteroea (=meleagris)|21125A12|ST|Peru:Chm

Gremna telarania|22112E04|HT|Bolivia|1890

Cremna telarania|22112E11|PT|Bolivia|1890

Cremna calitra|23013G05|Ecuador|old

Cremna telarania|22112E11|PT|Bolivia|1890

Cremna calitra|23013G05|Ecuador|old

0.004

0.009

Fig. 17. Phylogenetic trees of selected Cremna species inferred from protein-coding regions of a) the nuclear (autosomes) and

b) the mitochondrial genome: C. te/arania sp. n. (red), C. heteroea (blue), C. actoris (green), and C. calitra (violet).

Type material. Holotype: o& deposited in the Museum fiir Naturkunde, Berlin, Germany [MFNB],

illustrated in Fig. 16a, bears five rectangular labels, the first two handwritten and others printed: four

NVG-22112E04 | c/o Nick V. Grishin ], and one red [ HOLOTYPE co | Cremna telarania | Grishin ].

Paratype: 12 with the same data as the holotype (NVG-22112E11, GenBank barcode OR939284, Fig.

16b).

Type locality. Bolivia: La Paz Department, Mapiri.

Etymology. In Spanish, la telarafia means spider web. The name is given for the cobweb wing pattern of

this species. The name is a feminine noun in apposition.

Distribution. Currently known only from the La Paz Department in Bolivia.

Cremna dentata (Stichel, 1910) is a species distinct

from Cremna radiata (Godman & Salvin, 1886)

Genomic analysis reveals that Voltinia radiata dentata Stichel, 1910 (type locality in Colombia),

currently treated as a junior subjective synonym of Cremna radiata (Godman & Salvin, 1886) (type

locality Costa Rica: Irazt), is genetically differentiated from it at the level characteristic of distinct species

(Fig. 18), e.g., COI barcode difference of 2.6% (17 bp) in the presence of phenotypic distinction

(Lukhtanov et al. 2016): C. dentata typically has longer white rays between veins on wings. Therefore, we

propose that Cremna dentata (Stichel, 1910), stat. nov. is a species distinct from Cremna radiata

(Godman & Salvin, 1886).

790 Cremna radiata|19038B11|Costa Rica|old — [ mitochondrial

100 Cremna radiata|22075B04|Costa Rica|1971 —

Cremna dentata [not radiata]|18078C12|T|Colombia|old 0.02

Gremna radiata|22075B04|Costa Rica|1971

100 Cremna radiata|19038B11|Costa Ricalold

Cremna dentata [not radiata]|18078C12|T

a nuclear

0.02

so remna theata|19038B10|Panama|1977

Cremna theata|18078C11|T|Colombia|old

Cremna heteroea|18122B08|Guyana|2000

Cremna alector|18122B07|Brazil:RJ|1995

Napaea beltiana|18122B10|10-SRNP-70958|Costa Rica

Napaea mellosa|19038B03|Ecuador|1999

iggremna theata|19038B10|Panama|1977

Cremna theata|18078C11|T|Colombial|old

Cremna heteroea|18122B08|Guyana|2000

Cremna alector|18122B07|Brazil:RJ|1995

Napaea mellosa|19038B03|Ecuador|1999

Napaea beltiana|18122B10|Costa Rica|2010

Fig. 18. Phylogenetic trees of selected Cremna and Napaea species inferred from protein-coding regions of a) the nuclear

(autosomes) and b) the mitochondrial genomes: C. radiata (blue), C. dentata stat. rest. (red), and their sister C. theata (green).

Cremna pupillata Stichel, 1915 is a species distinct

from Cremna alector (Geyer, 1837)

Genomic analysis reveals that specimens identified as Cremna alector (Geyer, 1837) (type locality in

Brazil) partition into two genetically differentiated clades suggestive of species level (Fig. 19): e.g., their

COI barcodes differ by 3.6% (24 bp). Upon phenotypic inspection, we find that specimens in one clade

have white spots by forewing costa in the postdiscal blue band, and specimens in the other clade lack

them, among other differences discussed by Hall (2005). While syntypes of C. alector are likely lost,

original illustrations of this species show the lack of spots (Geyer 1837). Inspecting these illustrations, we

conclude that they are detailed enough to depict the spots if they were present. The lectotype of Cremna

alector pupillata Stichel, 1910 (type locality in Brazil: Espirito Santo, sequenced as NVG-21125A10) has

the spots and thus, according to our genomic results, is a species different from C. alector, represented by

two specimens without spots from Linhares, Espirito Santo in Brazil (Fig. 19). Therefore, we propose that

Cremna pupillata Stichel, 1915, stat. nov. is a species distinct from Cremna alector (Geyer, 1837).

Cremna alector|22075B08|Brazil:ES|1973

Cremna alector|22075B09|Brazil:ES|1972

Cremna pupillata [not alector]|21125A10|LT|Brazil:ES|old

Cremna pupillata [not alector]|18122B07|Brazil:RJ|1995

Cremna heteroea|18122B08|Guyana|2000

Cremna theata|19038B10|Panama|1977

Cremna radiata|22075B04|Costa Rica|1971

iGremna alector|22075B08|Brazil:ES|1973

Cremna alector|22075B09|Brazil:ES|1972

Cremna pupillata [not alector]|21125A10|LT|Brazil:ES

Cremna pupillata [not alector]|18122B07|Brazil:RJ

Cremna heteroea|18122B08|Guyana|2000

Cremna theata|19038B10|Panama|1977

Cremna radiata|22075B04|Costa Rica|1971

A Zchromosome b mitochondiral

0.02

Fig. 19. Phylogenetic trees of selected Cremna species inferred from protein-coding regions of a) the Z chromosome and b) the

mitochondrial genome: C. alector (blue) and C. pupillata stat. nov. (red).

A Species list of Napaeina J. Hall, 2003 assigned to genera

The list below is mostly based on previously published results (Callaghan and Lamas 2004; Hall 2005;

Seraphim et al. 2018; Zhang et al. 2021) guided by the genome-level phylogeny (Fig. 20) and is given to

correct some ambiguities and mistakes. For example, Zhang et al. (2021) gave an erroneous combination

Napaea sanarita (Schaus, 1902) (type locality in Brazil: Rio de Janeiro) while correctly resurrecting the

genus Eucorna Strand, 1932 of which Eucora sanarita Schaus, 1902 is the type and the only species

100

Hyphilaria nicia|19121G01|Guyana|2000

Hyphilaria parthenis|18122B05|Peru|1995

Eucorna sanarita|18122C01|Brazil:RJ|1996

Cremna alector|22075B09|Brazil:ES|1972

Cremna pupillata|18122B07|Brazil:RJ|1995

yoo Cremna radiata|22075B04|Costa Rica|1971

Too Cremna dentata|18078C12|T|Colombia|old

Cremna theata|19038B10|Panama|1977

Cremna actoris|22112F01|Suriname|1898-9

; Cremna heteroea|22112E02|Brazil:AM|old

“ Cremna telarania|22112E04|HT|Bolivia|1890

Cremna calitra]23013G05|Ecuador|old

Napaea sylva|18122B09|Ecuador|2014

100

N. beltiana|18122B10|10-SRNP-70958|C. Rica|2010

Napaea danforthi|20112A07|Mexico:Son|2003

N. umbra|18122C04|90-SRNP-2859|C. Rica|1991

vo apaea maya|19038C02|Belize|1995

100 Napaea totonaca|19038C01|Mexico:SLP|1982

ooNapaea rufolimba|19038B07|Costa Rica|1977

Napaea tumbesia|18122C03|Peru|1996

i Napaea fratelloi|18122B11|Guyana|1989

09 100

N. eucharila|18122B12|10-SRNP-72877|C. Rica|2010

Napaea phryxe|18122C05|Brazil:Bahia|1991

Napaea agroeca|18122C02|Brazil:RJ|1995

N. frustatoria (=tfrustatoria)|21125B04|ST|Fr. Guianalold

100

Hyphilaria nicia|19121G01|Guyana

Hyphilaria parthenis|18122B05|Peru

Eucorna sanarita|18122C01|Brazil:RJ

Cremna alector|22075B09|Brazil:ES

“Cremna pupillata|18122B07|Brazil:RJ

> Cremna radiata|22075B04|Costa Rica

ol sodCremna dentata|18078C12|T|Colombia

Cremna theata|19038B10|Panama|1977

100 Cremna actoris|22112F01|Suriname

eeCremna heteroea|22112E02|Brazil:AM

f@remna telarania|22112E04|HT|Bolivia

Cremna calitra|23013G05|Ecuador|old

Napaea sylva|18122B09|Ecuador|2014

N. beltiana|18122B10|10-SRNP-70958|CR

Napaea danforthi|20112A07|Mexico:Son

N. umbra|18122C04|90-SRNP-2859|CR

“Napaea maya|19038C02|Belize|1995

56- Napaea totonaca|19038C01|Mexico:SLP

,Napaea rufolimba|19038B07|Costa Rica

Napaea tumbesia|18122C03|Peru|1996

‘Pp, Napaea fratelloi|18122B11|Guyana|1989

28 NY. eucharila|18122B12|10-SRNP-72877|CR

+4. N. frustatoria (=#frustatoria)|21125B04|ST

Napaea phryxe|18122C05|Brazil:Bahia

p9Napaea agroeca|18122C02|Brazil:RJ

100

700 ©Napaea zikani|19038B04|Brazil:RJ|1959 es $4 Napaea zikani|19038B04|Brazil:RJ|1959

100

0.02 ee

100

10-4 100 Napaea joinvilea|19038B02|Brazil:SC|1976

Napaea melampia|22112B06|Brazil:BA|old

Napaea merula|22039F12|Ecuador|2005

Napaea mellosa|19038B03|Ecuador|1999

Napaea gynaecomorpha|19038B05|Ecuador|1994

100

"Napaea" thasus|18122B06|Brazil:MT|1983

olthomiola eburna|22039F11|Ecuador|2016

too Ithomiola candidata|18122D03|Ecuador|1999

Ithomiola oweni|18122D04|Costa Rica|2004

Ithomiola cribralis]}18122D02|Panama|1977

oo 'thomiola bajotanos|19038C05|Peru|2016

Ithomiola tanos|18078CO9|HT|Bolivia|1896

Ithomiola nepos|18122C11|Brazil:SC|1990

Ithomiola orpheus|18122C10|Peru|1992

50 thomiola callixena|22039F09|Ecuador|2014

Ithomiola buckleyi|22039F10|Peru:San Martin

Ithomiola floralis floralis]18122C09|Guyana|2000

Ithomiola theages theages|19121G02|Panama|1978

0.02

rir elisae|19038B06|Brazil:RJ|1979

apaea joinvilea|19038B02|Brazil:SC

; Napaea mellosa|19038B03|Ecuador|1999

i Napaea gynaecomorpha|19038B05|Ecuador

Napaea merula|22039F 12|Ecuador|2005

"Napaea" thasus|18122B06|Brazil:MT

;dghomiola eburna|22039F 11|Ecuador|2016

todthomiola candidata|18122D03|Ecuador

Ithomiola oweni|18122D04|C Rica|2004

Ithomiola nepos|18122C11|Brazil:SC|1990

Ithomiola orpheus|18122C10|Peru|1992

98, Jghomiola callixena|22039F09|Ecuador|2014

ovo Ithomiola buckleyi|22039F10|Peru:S Martin

Ithomiola floralis floralis|18122C09|Guyana

jogithomiola theages theages|19121G02|Pan

100 'thomiola cribralis|18122D02|Panama|1977

id¢homiola bajotanos|19038C05|Peru|2016

Ithomiola tanos|18078CO9|HT|Bolivia|1896

100

Fig. 20. Phylogenetic trees of Napaeina species inferred from protein-coding regions of a) the nuclear genome (autosomes) and

b) the Z chromosome. Different genera are colored in different colors: Hyphilaria (cyan), Eucorna (magenta), Cremna (green),

Napaea (blue, with “Napaea” thasus in orange), and /thomiola (purple).

(Rosa et al. 2023). We note that Cremna calitra Hewitson, 1869 (type locality in Ecuador) belongs to

Cremna E. Doubleday, 1847 (type species Papilio actoris Cramer, 1776), not Napaea Hubner, 1819 (type

species Cremna eucharila Bates, 1867) (Fig. 20).

Assignment of species to genera follows our study (Zhang et al. 2021), and we attempt arranging

Species in the list to maximize the phenotypic similarity of the neighbors but without disrupting a

phylogenetic order given by genomic trees (Fig. 20): i.e., a strongly supported clade in the trees is a

continuous segment in the list. We start with Hyphilaria, but the order of the entire list can be reversed.

We put Cremna and Napaea next to each other because species in these genera are similar (Hall 2005).

To maintain phylogenetic order, the considerations above necessitate placing /thomiola last. Finally, we

situate Eucorna next to Cremna instead of it being last in the list because Eucorna looks more different

from Jthomiola than from Cremna. Similar arguments were applied within each genus. Further

suggestions about the order to optimize similarity in appearance between neighbors are encouraged.

Only valid names of genera and species are given below; for subspecies, see the Butterflies of

America website (Warren et al. 2023); for synonyms and taxonomic discussions, see other publications

(Callaghan and Lamas 2004; Hall 2005). Type genus (for family-group names) or type species (for genus-

group names) names are given in parenthesis, and names of type species are underlined.

Tribe Mesosemiini Grote, 1898 (Mesosemia Hiibner, [1819])

Subtribe Napaeina J. Hall, 2003 (Napaea Hiibner, [1819])

Genus Hyphilaria Hubner, [1819] (Ayphilaria nicia Hubner, [1819])

Hyphilaria anthias (Hewitson, 1874)

Hyphilaria nicia Hubner, [1819]

Hyphilaria parthenis (Westwood, 1851)

Genus Eucorna Strand, 1932 (Eucora sanarita Schaus, 1902)

Eucorna sanarita (Schaus, 1902)

Genus Cremna E. Doubleday, 1847 (Papilio actoris Cramer, 1776)

Cremna alector (Geyer, 1837)

Cremna pupillata Stichel, 1915, stat. nov.

Cremna radiata (Godman & Salvin, 1886)

Cremna dentata (Stichel, 1910), stat. nov.

Cremna theata (Stichel, 1910)

Cremna actoris (Cramer, 1776)

Cremna heteroea H. Bates, 1867

Cremna telarania Grishin, sp. n.

Cremna calitra Hewitson, 1869

Genus Napaea Hubner, [1819] (Cremna eucharila Bates, 1867)

Napaea sylva (Moschler, 1877)

Napaea beltiana (H. Bates, 1867)

Napaea dramba (J. Hall, Robbins & Harvey, 2004) [fossil]

Napaea danforthi A. Warren & Opler, 1999

Napaea umbra (Boisduval, 1870)

Napaea loxicha (RG. Maza & J. Maza, 2016)

Napaea maya (J. Maza & Lamas, 2016)

Napaea necaxa (RG. Maza & J. Maza, 2018)

Napaea totonaca (RG. Maza & J. Maza, 2016)

Napaea rufolimba J. Hall, 2005

Napaea tumbesia J. Hall & Lamas, 2001

Napaea fratelloi J. Hall & Harvey, 2005

Napaea eucharila (H. Bates, 1867)

Napaea frustatoria Brévignon, 2019

Napaea phryxe (C. Felder & R. Felder, 1865)

Napaea agroeca Stichel, 1910

Napaea cebrenia (Hewitson, [1873])

Napaea zikani Stichel, 1923

Napaea elisae (J. Zikan, 1952)

Napaea joinvilea J. Hall & Harvey, 2005

Napaea melampia (H. Bates, 1867)

Napaea mellosa J. Hall & Harvey, 2005

Napaea gynaecomorpha J. Hall, Harvey & Gallard, 2005

Napaea merula (Thieme, 1907)

Genus “new genus 1” Seraphim et al. 2018

“Napaea” thasus (Stoll, 1780) comb. nov. [placed in its possible sister genus for now just to have a genus name]

Genus Ithomiola C. Felder & R. Felder, 1865 U/thomiola floralis C. Felder & R. Felder, 1865)

Ithomiola eburna (J. Hall & Harvey, 2005)

Ithomiola candidata (Hewitson, 1874)

Ithomiola oweni (Schaus, 1913)

Ithomiola calculosa J. Hall & Harvey, 2005

Ithomiola theages (Godman & Salvin, 1878)

Ithomiola cribralis (Stichel, 1915)

Ithomiola neildi (J. Hall & Willmott, 1998)

Ithomiola bajotanos J. Hall, 2005

Ithomiola tanos (Stichel, 1910)

Ithomiola nepos (Fabricius, 1793)

Ithomiola orpheus (Westwood, 1851)

Ithomiola callixena (Hewitson, 1870)

Ithomiola buckleyi J. Hall & Willmott, 1998

Ithomiola floralis C. Felder & R. Felder, 1865

Lasaia peninsularis Clench, 1972 is a species distinct

from Lasaia sula Staudinger, 1888

Genomic analysis reveals that Lasaia sula peninsularis Clench, 1972 (type locality Mexico: Yucatan,

Pisté) is genetically differentiated from Lasaia sula Staudinger, 1888 (type locality in Honduras) at the

level characteristic of distinct species (Fig. 21) with Fst/Gmin/COI barcode difference of 0.52/0.005/1.5%

(10 bp), with the barcode difference computed between lectotypes of both names. Therefore, we propose

that Lasaia peninsularis Clench, 1972, stat. nov. is a species distinct from Lasaia sula Staudinger, 1888.

Genus Subgenus ) Lasaia peninsularis [not sula]|3243|USA:TX,Cameron Co.|2003

“7 “asaia peninsularis [not sula]|4026|USA:TX,Cameron Co.|2015

7, Lasaia peninsularis [not sula]|15099E04|HT|Mexico:Yuc|1952

106 Lasaia peninsularis [not sula]]19027B06|Mexico:Yuc|1960

Lasaia sula|18054E11|LT|Honduras|1887

by ‘° Lasaia sula|19027B07|Panama|1977

Lasaia Lasaia pseudomeris|19027C03|Peru:Loreto|1995

108 Lasaia arsis|19027B05|Peru:Cusco|2011

Lasaia moeros|19027C01|Peru:Cusco|2000

A Lasaia sessilis]}19027C02|Costa Rica|1980

Lasaia maria maria|19027C04|Mexico:Que|1982

Lyropteryx (Lyropteryx) lyra cleadas|18072C11|16-SRNP-46105|Costa Rica|2016

Lyropteryx ‘oa LYropteryx (Lyropteryx) apollonia apollonia|19025E03|Peru:Cusco|2014

199 Lyropteryx (Lyropteryx) terpsichore terpsichore|19025E07|Brazil:Mato Grosso|1969

Lyropteryx - Lyropteryx (Lyropteryx) melaniae [not Melanis]|21123F11|T|Brazil:SC|old

Lyropteryx (Necyria) ingaretha|19025F05|Costa Rica|1965

Lyropteryx (Necyria) bellona westwoodi|19025F02|Peru:San Martin|1990

[os Ancyluris paramba|19025F12|Panama|1981

| 100 J Ancyluris mira thaumasia|19025G06|Peru:Cusco|2013

Ancyluri Ancyluris formosissima|19025G09|Peru:Cusco|2011

a Melanis pixe|5148|USA:TX,Hidalgo Co.|2015

TOO Melanis melandra|21123G01|Brazil:AM|old

Melanis xenia|19027E06|Brazil:DF|1969

Melanis boyi|21123F10|T|Brazil:PA|old

, Melanis alena|21127F06|Brazil:RJ|old

Isapis Melanis cinaron|19027C11|Peru:Cusco|2011

Isapis (Isapis) gait Abba tails See O Us ave tel tee

100

Isapis ‘iat seaa) oustila eat Tpeineheliaopaces rer Amazonas|1999

Themone pais|19026C01|Guyana|2000

Paraphthonia (Paraphthonia) molione|19129E04|Ecuador:Napo|2016

“Paraphthonia (Parapanara) diadocis [not Lyropteryx]|18076G08|T|Brazil:AM|1891

Paraphthonia Paraphthonia

09100 Parapanara subgen. n

76 = TBACReler esthema|19026C03|Peru:Cusco|2016

002 sD ide > Brachyglenis dodone|19026C04|Costa Rica|1977

Brachyglenis “*“Brachyglenis dinora|19026C05|Panama|2001

; Brachyglenis drymo|19026C06|Brazil:SC|1982

Siseme “re Siseme pallas|19027F03|Venezuela|1978

Siseme pseudopallas|19027F05|Peru:San Martin|1998

Fig. 21. The phylogenetic tree of selected Riodinini species inferred from protein-coding regions of the nuclear genome

(autosomes). Taxa discussed in the text are shown in different colors, and those transferred between genera (green arrows

indicate the direction of transfer) are labeled in a color different from the rest of the genus. Genus-group names (genera in bold

italics and subgenera in italics) are shown by corresponding branches. Levels in the tree that approximately correspond to

genus and subgenus are labeled on top. New subgenera are highlighted in yellow.

Necyria Westwood, 1851 is a subgenus of Lyropteryx Westwood, 1851

Although traditionally treated as distinct (and monophyletic) genera for more than 170 years, Lyropteryx

Westwood, 1851 (type species Lyropteryx apollonia Westwood, 1851) and Necyria Westwood, 1851

(type species Necyria bellona Westwood, 1851) are genetically (Fig. 21) and phenotypically close. COI

barcodes of their type species differ by 2.7% (18 bp), which is typical for closely related sister species,

not different genera, and both genera are characterized by lyre- or harp-like wing patterns resulting from

metallic overscaling between the veins complemented with red spots or stripes. A novice cannot easily

assign a species to a genus by wing patterns. For all these reasons, we propose to treat these monophyletic

groups as subgenera. Necyria and Lyropteryx were proposed in the same work issued on the same day

(Westwood 1851), and being the first revisers, we give precedence to Lyropteryx because this name is

more descriptive of a butterfly appearance: its wing (atépvé - pteryx) resembles the musical instrument

lyre (A0pa - lyra). Therefore, we propose that Necyria Westwood, 1851, stat. nov. is a subgenus of

Lyropteryx Westwood, 1851.

Lymnas melaniae Stichel, 1930 belongs to the genus Lyropteryx Westwood, 1851

and not Melanis Hiibner, [1819]

Genomic phylogeny reveals that Lymnas melaniae Stichel, 1930 (type locality in Brazil: Santa Catarina),

currently in the genus Melanis Hibner, [1819] (type species Papilio melander Stoll, 1780), is not

monophyletic with it and instead is a close sister to Lyropteryx Westwood, 1851 (type species Lyropteryx

apollonia Westwood, 1851) (Fig. 21): COI barcode difference of 2.3% (15 bp), which is typical for

closely related congeners. To restore the monophyly of Melanis, we transfer L. melaniae to the genus

Lyropteryx, forming a new combination Lyropteryx melaniae (Stichel, 1930), comb. nov.

Eurygona? pulcherrima Herrich-Schiaffer, [1853] and Themone poecila H. Bates, 1868

belong to the genus /sapis E. Doubleday, 1847 and not Themone Westwood, 1851

Eurygona? pulcherrima Herrich-Schaffer, [1853] (type species in Suriname) and Themone poecila H.

Bates, 1868 (type locality Brazil: Amazonas, Ega [= Tefé]) currently placed in the genus Themone

Westwood, 1851 (type species Helicopis pais Hiibner, [1820]) are not monophyletic with it and instead

form a clade together with /sapis E. Doubleday, 1847 (type species Papilio agyrtus Cramer, 1777) and are

close to it genetically (Fig. 21). To restore monophyly of Themone, we transfer the two species to [sapis

forming new combinations /sapis pulcherrima (Herrich-Schaffer, [1853]), comb. nov. and /sapis poecila

(H. Bates, 1868), comb. nov. Furthermore, we note that the clade with these species is sister to Melanis

Hiibner, [1819] (type species Papilio melander Stoll, 1780), and they are closely related to it, 1.e., COI

barcodes of the type species of Melanis and Isapis differ by 7.3% (48 bp). Therefore, /sapis can be

included in Me/anis, a step we are not taking here but proposing for consideration.

Callitera Grishin, new subgenus

http://zoobank.org/261B10A3-E22E-49EA-97B3-466C43 93884E

Type species. Eurygona? pulcherrima Herrich-Schaffer, [1853].

Definition. As shown above, Eurygona? pulcherrima Herrich-Schaffer, [1853] (type locality in

Suriname) belongs to the genus /sapis E. Doubleday, 1847 (type species Papilio agyrtus Cramer, 1777)

and not to Themone Westwood, 1851 (type species Helicopis pais Hiibner, [1820]) (Fig. 21). However, it

is genetically differentiated from the type species of /sapis at the subgenus level, e.g., their COI barcodes

differ by 6.5% (43 bp). Therefore, we propose that the lineage with /sapis pulcherrima represents a new

subgenus. This subgenus differs from its relatives by a combination of the following characters: each

wing is blackish-brown with a yellow stripe by its base beneath (as in the type species of /sapis) and

discal white streaks sometimes framed with metallic-green scales on the dorsal side and could be vestigial

on the hindwing. In DNA, a combination of the following characters is diagnostic in the nuclear genome:

cne3301.6.2:T166A, cne3301.6.2:C186T, cnel78.3.20:T1233A, cnel78.3.20:T1632A, cne37196.1.3:A87T

and in COI barcode: T67A, T82C, A211G, 223A, A268T, T625G.

Etymology. The name of the type species, pulcherrima, is a Latin word meaning very beautiful, most

beautiful, or prettiest. The name of the new subgenus is formed from the Greek word KoaAAitepy

(kalliteri), which means most beautiful. The name is a feminine noun in the nominative singular.

Species included. Only the type species.

Parent taxon. Genus /sapis E. Doubleday, 1847.

Matizada Grishin, new subgenus

http://zoobank.org/203DA466-AC54-4A5E-9BC5-44CEQAFDIF2F

Type species. 7hemone poecila H. Bates, 1868.

Definition. As shown above, Themone poecila H. Bates, 1868 (type locality Brazil: Amazonas, Ega

[= Tefé]) belongs to the genus /sapis E. Doubleday, 1847 (type species Papilio agyrtus Cramer, 1777)

and not to Themone Westwood, 1851 (type species Helicopis pais Hiibner, [1820]) (Fig. 21). However, it

is genetically differentiated from the type species of /sapis at the subgenus level, e.g., their COI barcodes

differ by 8.1% (53 bp) and is sister to the clade of two subgenera: /sapis and Callitera subgen. n.

Therefore, we propose that the lineage with /sapis poecila represents a new subgenus. This subgenus

differs from its relatives by a combination of the following characters: each wing is blackish-brown with a

yellow-orange area towards the base and a central yellow spot, which may be vestigial on the dorsal side.

In DNA, a combination of the following characters is diagnostic in nuclear genome: cne792.14.1:C927T,

ene792.14.1:A132T, cne2411.1.1:A348T, cne5004.10.6:A822T, cne5004.10.6:G633A, cne5335.1.1:C114C

(not T), cne5335.1.1:T129T (not C), cne5331.3.1:A53A (not G), cne5331.3.1:T237T (not C), cne573.8.1:

C63C (not G) and in COI barcode: A4C, C81T, T88A, A278A, 421C, A586A.

Etymology. The name of the type species, poecila, typically refers to colorful or variegated markings or

patterns. It 1s derived from the Greek word zouctioc (poikilos), which means varied, diverse, or

multicolored. The name of the new subgenus is formed from the Spanish word matizado, which means

variegated or mottled. The name is treated as a feminine noun in the nominative singular.

Species included. Only the type species.

Parent taxon. Genus /sapis E. Doubleday, 1847.

Lyropteryx diadocis Stichel, 1910 belongs to the genus Paraphthonia Stichel, 1910

and not Lyropteryx Westwood, 1851

Genomic phylogeny reveals that Lyropteryx diadocis Stichel, 1910 (type locality in Brazil: Amazonas)

kept in its original genus is not monophyletic with Lyropteryx Westwood, 1851 (type species Lyropteryx

apollonia Westwood, 1851) and instead is sister to Paraphthonia Stichel, 1910 (type species Monethe

molione Godman, 1903) (Fig. 21). Because Paraphthonia itself is already quite closely related to

Brachyglenis C. Felder & R. Felder, 1862 (type species Brachyglenis esthema C. Felder & R. Felder,

1862) and Themone Westwood, 1851 (type species Helicopis pais Hiibner, [1820]) (Fig. 21): COI barcode

difference of 6.2% (41 bp) and 6.8% (45 bp), respectively, we restore monophyly of Lyropteryx by

including L. diadocis in the genus Paraphthonia to form a new combination Paraphthonia diadocis

(Stichel, 1910), comb. nov. Due to the genetic closeness of these three genera (Paraphthonia,

Brachyglenis, and Themone), it is conceivable to combine them in a single genus Themone, a step we are

not taking here but proposing for consideration.

Parapanara Grishin, new subgenus

http://zoobank.org/F41 BC3E1-EAB0-44E4-A4F3-E9C9F8D04775

Type species. Lyropteryx diadocis Stichel, 1910.

Definition. As shown above, Lyropteryx diadocis Stichel, 1910 (type locality in Brazil: Amazonas)

belongs to the genus Paraphthonia Stichel, 1910 (type species Monethe molione Godman, 1903) and not

to Lyropteryx Westwood, 1851 (type species Lyropteryx apollonia Westwood, 1851) (Fig. 21). However,

it is genetically differentiated from the type species of Paraphthonia at the subgenus level, e.g., their COI

barcodes differ by 6.1% (40 bp). Therefore, we propose that the lineage with Paraphthonia diadocis

represents a new subgenus. This subgenus differs from its relatives by a combination of the following

characters: forewing vein R2 originates at the anterior distal corner of the discal cell, the forewing with the

orange-yellow band from mid-costa to near tornus, and the hindwing with metallic-green overscaling

around veins in distal half. In DNA, a combination of the following characters is diagnostic in the nuclear

genome: cne3461.1.26:A146G, cne3461.1.26:A1989G, cne6404.2.4:C87T, cne945.5.1:A342T, cne945.5.1:

T352C, cne3615.3.2:A132A (not G), cne4618.3.1:C31C (not G), cne4618.3.1:C37C (not G), cne6843.7.6:

G489G (not A), cne6843.7.6:T525T (not C) and in COI barcode: TI1O0A, C284T, T286A, A352C, T355A,

A604G.

Etymology. In its appearance, the type species of this subgenus resembles some species from the genus

Panara E. Doubleday, 1847 (type species Papilio jarbas Drury, 1782), and the prefix “para” means

alongside, near, beyond, or similar to. The name is a feminine noun in the nominative singular.

Species included. Only the type species.

Parent taxon. Genus Paraphthonia Stichel, 1910.

Synargis orestessa Hiibner, [1819] is a junior subjective synonym of Synargis soranus

(Stoll, 1781), and Synargis arche (Hewitson, 1865) is a valid species

Synargis orestessa Hiibner, [1819] was proposed as a replacement name for Papilio orestes Cramer, 1780

(type locality in Suriname) preoccupied by Papilio orestes Meerburgh, 1777 (in Papilionidae). Original

illustrations (dorsal and ventral) (Cramer 1775-1780) of P. orestes and a possible syntype specimen in

RMNH that agrees with the illustrations and would simultaneously be a syntype of the replacement name

S. orestessa look more similar to the original illustrations of Synargis soranus (Stoll, 1781) (type locality

in Suriname) and specimens referred to by the name “soranus,” than to specimens of the species currently

referred to by the name “orestessa.” Genomic analysis shows the presence of two species (Fig. 22) that

differ by 3.2% (21 bp) in their COI barcodes: females of one possess broader yellow-orange bands on the

forewing, and of the other have narrower and whiter bands usually separated into spots, among other

differences. For these reasons, we propose that Synargis orestessa Hiibner, [1819], stat. nov. is a junior

subjective synonym of Synargis soranus (Stoll, 1781). The oldest name for the species that was referred

to by the name “orestessa” 1s Nymphidium arche Hewitson, 1865 (type locality in Brazil: Amazonas),

and, hence, Synargis arche (Hewitson, 1865) is a valid species.

Too SYNargis soranus (=orestessa & =forestes)|22014D05|?ST|no datalold [g mito

Synargis soranus|19031G03|Guyana|2001

Synargis arche [not orestessa]|19031G02|Guyana|2001

ae Synargis arche (=pseudomandana) [not orestessa]|18095B05|HT|no datalold

* Synargis arche (=f. cinerea) [not orestessa]|21119G04|Brazil:Paralold

Synargis abaris|19031G05|Guyana|2001

Synargis abaris|19031G04|Peru:MD|2013 —oo

Synargis soranus (=orestessa & =forestes)|22014D05|?ST

yd at Dis soranus|19031G03|Guyana|2001

ipynargis arche [not orestessa]|19031G02|Guyana|2001

ig@ynargis arche (=pseudomandana) [not orestessa]|18095B05|HT

Synargis arche (=f. cinerea) [not orestessa]|21119G04|Brazil

Synargis abaris|19031G05|Guyana|2001

Synargis abaris|19031G04|Peru:MD|2013

a nuclear

100

—— 0.004

Fig. 22. Phylogenetic trees of several Synargis species inferred from protein-coding regions of a) the nuclear (autosomes) and

b) the mitochondrial genomes: S. soranus (red), S. arche stat. rest. (blue), and their sister S. abaris (green).

Family Lycaenidae [Leach], [1815]

Nothodanis Hirowatari, 1992 is a subgenus of Danis [Fabricius], 1807

Genomic phylogeny of Polyommatini Swainson, 1827 reveals that Nothodanis Hirowatari, 1992 (type

species Lycaena schaeffera Eschscholtz, 1821) (Fig. 23 cyan) is closely related to its sister genus Danis

[Fabricius], 1807 (type species Papilio danis Cramer, 1775) (Fig. 23 violet), e.g., their COI barcodes

differ by 10.2% (67 bp) and the two diverged from each more recently than most other genera (Fig. 23, on

the right of the green line). Therefore, we propose to treat Nothodanis Hirowatari, 1992, stat. nov. as a

subgenus of Danis [Fabricius], 1807.

a nuclear sod arucus theophrastus|22027C05|Algeria|1982 b mitochondrial

Tarucus theophrastus|22027C06|Algeria|1978

Tarucus clathratus [not Castalius]|20124E10|HT|Celebes|1887

jogesvens rosimon|22027C07|Nepal|1964

astalius rosimon|22027C08|Nepal|1962

Zintha hintza hintza|20127E05|?T|South Africa|old

Tuxentius melaena melaena|20127E06|?T|South Africa|1891

qqrucus theophrastus|22027C05|Algeria|1982

arucus theophrastus|22027C06|Algeria|1978

Tarucus clathratus [not Castalius]|20124E10|HT|Celebes

Gastalius rosimon|22027C07|Nepal|1964

Castalius rosimon|22027C08|Nepal|1962

Zintha hintza hintza|20127E05|?T|South Africajold

Tuxentius melaena melaena|20127E06|?T|South Africa|1891

Tuxentius margaritaceus|20127E07|ST|Kenya|1889

Thaumaina uranothauma deliciosa|22038B01|PNG|1972

Thaumaina evena [was Upolampes]|22027A02|PNG|old

Psychonotis caelius plotinus|22038A10|Papua New Guinea|1978

Perpheres perpheres peri [not Danis]|22027A12|New Guinea

Caleta caleta]22027A04|Celebes|old

Caleta roxus roxus|22027A09|Javalold

Caleta nigropunctata [was Pistoria]|SAMN18674175|PNG

Discolampa ethion|22027A06|no datalold

Nacaduba kurava prominens|22026H03|Sri Lankal|old

Nacaduba cyanea pindus|22038A03|Halmahera IsI.|1984

Danis (Danis) danis|22027A11|Amboina|old

Danis (Danis) regalis]22038A05|Papua|1933

Danis (Nothodanis) schaeffera schaeffera|22038A07|no datalold

0.03 Danis (Nothodanis) schaeffera baladensis|22038A08|New Caledonia

Tuxentius margaritaceus|20127E07|ST|Kenya|1889

Thaumaina uranothauma deliciosa|22038B01|PNG|1972

Thaumaina evena [was Upolampes]|22027A02|PNGl|old

Perpheres perpheres peri [not Danis]|22027A12|New Guinea|1971

Psychonotis caelius plotinus|22038A10|Papua New Guinea|1978

Caleta caleta|22027A04|Celebes|old

> ~Caleta roxus roxus|22027A09|Javalold

Caleta nigropunctata [was Pistoria]|SAMN18674175|PNG

Discolampa ethion|22027A06|no datalold

Nacaduba kurava prominens|22026H03|Sri Lankalold

Nacaduba cyanea pindus|22038A03|Halmahera IsI.|1984

Danis (Danis) danis|22027A11|Amboinal|old

Danis (Danis) regalis|22038A05|Papua|1933

idganis (Nothodanis) schaeffera schaeffera|22038A07|no datalold

Danis (Nothodanis) schaeffera baladensis|22038A08|New Caledonia|1984

Fig. 23. Phylogenetic trees of selected Polyommatini species inferred from protein-coding regions of a) the nuclear

(autosomes) and b) the mitochondrial genomes. Taxa discussed in the text are shown in color. The green line delineates genera.

The sequence of SAMN18674175 is taken from the alignment provided in Kawahara et al. (2023).

Perpheres Hirowatari, 1992 is confirmed as a valid genus

Perpheres Hirowatari, 1992 (type and the only species Thysonotis perpheres (H. H. Druce & Bethune-

Baker, 1893) (Fig. 23 olive) was at times lumped with Danis [Fabricius], 1807 (type species Papilio danis

Cramer, 1775), but is in a clade different from Danis (subtribe Danina Kocak & Seven, 1997) and the

same clade with Castalius Htibner, [1819] (type species Papilio rosimon Fabricius, 1775, subtribe

Castaliina Distant, 1884) (Fig. 23). Therefore, the placement of 7. perpheres in Danis is incorrect and,

because Perpheres is genetically distant from genera that are closest to it (Fig. 23), we confirm Perpheres

as a valid genus in the subtribe Castaliina.

Pistoria Hemming, 1964 is a junior subjective synonym of Ca/eta Fruhstorfer, 1922

Adding DNA segments of Mambara nigropunctata Bethune-Baker, 1908 (type locality in Papua New

Guinea, biosample SAMN18674175), the type species of currently valid genus Pistoria Hemming, 1964,

taken from the alignment provided in Kawahara et al. (2023) (Fig. 23 red) to our genomic datasets of its

relatives, we find that Pistoria nigropunctata originates within Caleta Fruhstorfer, 1922 (type species

Lycaena caleta Hewitson, 1876), rendering it paraphyletic. To restore the monophyly, due to the genetic

closeness of Pistoria nigropunctata and Caleta caleta (COI barcode difference of 5.9%, 39 bp), we

propose that Pistoria Hemming, 1964, syn. nov. is a junior subjective synonym of Caleta Fruhstorfer,

1922.

Upolampes Bethune-Baker, 1908 is a junior subjective synonym

of Thaumaina Bethune-Baker, 1908

Genomic trees reveal that Upolampes Bethune-Baker, 1908 (type species Upolampes striata Bethune-

Baker, 1908, which is a junior subjective synonym of Lycaena evena Hewitson, 1876) (Fig. 24b, Fig. 23

orange) and Thaumaina Bethune-Baker, 1908 (type species Thaumaina uranothauma Bethune-Baker,

1908) (Fig. 24a, Fig. 23 green) are closely related to each other despite the remarkable difference in their

wing patterns (Fig. 24): e.g., their COI barcode differ by 6.5% (43 bp) and therefore should be

synonymous. The two names, Upolampes and Thaumaina, were published in the same work issued on the

same date (Bethune-Baker 1908). As the first revisers, we give precedence to Thaumaina (two valid

Species, fewer name changes) over Upolampes (one valid species) and propose that Upolampes Bethune-

Baker, 1908, syn. nov. is a junior subjective synonym of Thaumaina Bethune-Baker, 1908.

Fig. 24. Males of Thaumaina from Papua New Guinea in dorsal (left) and ventral (right) views: a) 7. uranothauma deliciosa

Wind & Clench, 1945, Wau, 5000 ft, 18-22-Apr-1972, R. H. Carcasson leg. (NVG-22038B01) [USNM]; b) 7. evena comb.

nov., Madang, genitalia of this specimen are illustrated on pl. 5, f. 14 in Fruhstorfer (1918) (NVG-22027A02) [ZSMC].

Tarucus clathratus W. Holland, 1891, comb. rest.

Genomic sequencing of the holotype by monotypy: “the type, a male,” per original description (Holland

1891), of Tarucus clathratus W. Holland, 1891 (type locality in Sulawesi, sequenced as NVG-20124E10)

(Fig. 25, Fig. 23 magenta), currently placed in the genus Castalius Htibner, [1819] (type species Papilio

rosimon Fabricius, 1775), reveals that it is not monophyletic with its type species and is in the same clade

with Tarucus F. Moore, 1881 (type species Hesperia theophrastus Fabricius, 1793) (Fig. 23 blue), where

it was originally placed. Therefore, we return it to the genus 7arucus, as originally proposed: Tarucus

clathratus W. Holland, 1891, comb. rest. We note that the photograph of 7. clathratus holotype in the

original description (Holland 1891) (Fig. 25b) on a casual look does not appear particularly similar to

Hoiland abdomen Taken Lex Few;

Colléction ;

Cassidy Zax S Eps

DNA sample ID:

NVG—20124E10

c/o Nick V. Grishin

9. Peninsula, Celebes

li “Coll, Doherty, 1887. «

Fig. 25. Holotype of Tarucus clathratus, data in text: a) photographs taken on 28-Jun-2021 by N.V.G., dorsal (left) and ventral

(right) views of the specimen with its labels (below); labels reduced by one third compared to the specimen; larger scale bar

refers to the specimen, smaller scale bar refers to labels and genitalia vial; b) photograph of the holotype in ventral view

reproduced from pl. 5, f. 8 in Holland (1891).

the holotype specimen (Fig. 25a). The photograph shows a specimen with narrower dark bands (likely

overexposed or possibly re-touched) and a different position of antenna (was re-attached later). However,

despite these differences, the wing shape and outline of the spread with the right hindwing closer to the

forewing than the left pair, the position of tails, and the tear along the Rs vein in the middle of the right

hindwing match between the likely holotype and the photograph. The specimen is in CMNH, bears the

label “Holland Collection”, agrees with the original description better than the photograph (broad dark

bands per description), and is labeled in Holland’s handwriting as “Type” in a manner similar to all other

type specimens he described and labeled. Therefore, there is little reason to doubt that the specimen we

sequenced (NVG-20124E10) is the holotype.

Family Hesperiidae Latreille, 1809

Euriphellus colombiensis Grishin, new species

http://zoobank.org/466927D6-598F-4C 73-883 5-F3D4305F40BB

(Figs. 26 part, 27a, c, 28a—b)

Definition and diagnosis. The Z chromosome analysis of Euriphellus Austin, 2008 (type species Papilio

euribates Stoll, 1782) reveals that four specimens from Colombia and Ecuador form a clade sister to

several Euriphellus species that is genetically differentiated from them (Fig. 26a). Therefore, these

specimens belong to species distinct from the rest. The two pairs of specimens are genetically

differentiated from each other, e.g., COI barcode differences of 4.9% (32 bp) between them (possible

introgression with Euriphellus lama (Evans, 1952), Fig. 26b), and belong to two different new species.

The one from western Colombia is described here, and the one from eastern Ecuador is described below.

The new species from Colombia keys to D.4.2(b) in Evans (1952), and differs from its relatives by the

following combination of characters in male: dorsal wing color yellower in hue, forewing without

submarginal hyaline spots in cells M1-M2, M2-M3, or R3-R4, only two yellow hyaline subapical spots in

cells R4a-Rs5 and Rs-Mi, hindwing with six well-developed and nearly collected into a band postdiscal

brown spots on dorsal side, one in each cell between veins RS and 1A+2A, ventrally with prominent

yellow spots, including near the base of cell Sc+R1-RS (Fig. 27a), tegumen narrower in dorsal view,

harpe longer than in relatives, humped along ventral margin, expanded into a keel with several

small teeth on dorsal side and narrows to a point, ampulla with a nearly square process, flattened

along its somewhat irregular dorsoposterior margin (Fig. 28a, b); and female with larger discal

forewing hyaline spots, the spot in cell M3-CuA1 overlaps the spot in cell CuA1-CuAz by most of its

width (Fig. 27c). Due to unknown phenotypic variation, definitive identification is provided by DNA,

and a combination of the following characters is diagnostic in the nuclear genome: aly2582.35.2:G1861A,

aly2582.35.2:C1862G, aly767.18.5:A88T, aly767.18.5:TI17A, aly54.32.1:C215G and in COI barcode:

A181G, T259C, C343T, T364C, T376A, T484T, T553A.

Euriphellus marian|17103G12|Peru:Loreto|1990

> Euriphellus marian|17103G01|Peru:Tingo Maria|1994

7) Euriphellus lama|18083C04|PT|Belizelold mitochondrial

Too Euriphellus lama|17102E11|Guatemalal|old

Euriphellus lama|18083C07|HT|Guatemalal|old

Euriphellus phraxanor (=mutius)|21117A01|ST|Colombia|1881

Euriphellus phraxanor|18052E07|Venezuelal|old

Euriphellus phraxanor (=heras)|15031F06|ST|Venezuela|old

Euriphellus mena|18083C08|HT|Ecuador|old

Euriphellus mena|18082E09|PT|Ecuador|old

Euriphellus mena|21115B04|Ecuador|old

Euriphellus colombiensis|18052E08|HT|Colombia|old

Euriphellus colombiensis|18052E11|PT|Colombia|old

Euriphellus ecuadoricus|18057G01|HT|Ecuador|old

Se ein ecuadoricus|18057G02|PT|Ecuador|old

> Euriphellus euribates|14063D10|Guyana|2000

*“Euriphellus euribates|14063E01|Peru:MD|2013

») Euriphellus polygius|19041H03|Brazil:SC|old

0.007 Euriphellus polygius|22018B11|Brazil:SC|old

500 EUriphellus marian|17103G12|Peru:Loreto

Euriphellus marian|17103G01|Peru:Tingo Maria

Euriphellus lama|18083C04|PT|Belize|old

uriphellus lama|18083C07|HT|Guatemalalold

oéuriphellus lama|17102E11|Guatemalalold

Furiphellus colombiensis|18052E08|HT|Colombia

Euriphellus colombiensis|18052E11|PT|Colombia

E phraxanor (=mutius)|21117A01|ST|Colombia

is phraxanor (=heras)|15031F06|ST|Venezuela

Euriphellus phraxanor|18052E07|Venezuela

Z chromosome

yriphellus mena|18083C08|HT|Ecuador|old

idouriphellus mena|21115B04|Ecuador|old

Euriphellus mena|18082E09|PT|Ecuador|lold

Fyriphellus ecuadoricus|18057G02|PT|Ecuador

Euriphellus ecuadoricus|18057G01|HT|Ecuador

Fyriphellus euribates|14063D10|Guyana|2000

Euriphellus euribates|14063E01|Peru:MD|2013

Furiphellus polygius|19041H03|Brazil:SC|old

0.02 Euriphellus polygius|22018B11|Brazil:SClold

Fig. 26. Phylogenetic trees of selected Euriphellus species inferred from protein-coding regions of a) the Z chromosome and b)

the mitochondrial genome: E. marian (violet), E. lama (cyan), E. phraxanor (blue), E. mena (green), E. colombiensis sp. n.

(red), E. ecuadoricus sp. n. (magenta), E. euribates (olive), and E. polygius (black).

Fig. 27. Type specimens of Euriphellus: a) E. colombiensis sp. n. & holotype, b) E. ecuadoricus sp. n. & holotype, c) EF.

colombiensis sp. n. ¢ paratype, d) E. ecuadoricus sp. n. ° paratype in dorsal (left) and ventral (right) views, data in text.

Fig. 28. Genitalia of holotypes: a—b) Euriphellus colombiensis sp. n. and c—d) Euriphellus ecuadoricus sp. n. in dorsal (a, c)

and left lateral (b, d) views.

Barcode sequence of the holotype. Sample NVG-18052E08, GenBank OR837728, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATGTTAGGAACTTCTTTAAGTTTACTAATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAAATGATCAAATTTATAATACT

ATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGGGGATTCGGAAACTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTTCCACGAA

TAAATAATATAAGATTCTGATTACTTCCCCCTTCTTTAATATTATTAATTTCAAGAAGAATCGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCTCCTTTATCTGCTAACATTGC

CCATCAAGGATCATCAGTTGATTTAGCAATTTTTTCTCTTCACTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAACTTATCT

TTCGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTACTTCTCTCTTTACCAGTACTAGCAGGTGCAATTACTATATTATTAACAGACCGAAATTTTAATACAT

CTTITTTTTGATCCTICIGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: & deposited in the Museum fiir Naturkunde, Berlin, Germany [MFNB],

illustrated in Fig. 27a, bears four printed labels: 1‘ green, two white [ W.Columb. | Rio Dagua | 600-

1000m | W.Hopp S. | 2 - 5 | (the last line is rotated 90° to the left and printed on the right margin of the

label), [ DNA sample ID: | NVG-18052E08 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22111G11 |

c/o Nick V. Grishin |], and one red [ HOLOTYPE c@ | Euriphellus | colombiensis Grishin |. The first NVG

number corresponds to a sampled leg, and the second is for the abdomen DNA extraction followed by

genitalia dissection. Paratype: 12° with the same data as the holotype (NVG-18052E11, GenBank

barcode OR837729, Fig. 27c).

Type locality. Colombia: Rio Dagua, 600—1000 m.

Etymology. The name is given for the country of the type locality. The name is a masculine adjective.

Distribution. Currently known only from Colombia.

Euriphellus ecuadoricus Grishin, new species

http://zoobank.org/462B5465-AC20-4876-93A3-4803BB75CD2C

(Figs. 26 part, 27b, d, 28c—d)

Definition and diagnosis. Genomic analysis of Euriphellus Austin, 2008 (type species Papilio euribates

Stoll, 1782) reveals that four specimens from Colombia and Ecuador form a clade sister to several

Euriphellus species that is genetically differentiated from them (Fig. 26). Therefore, these specimens

belong to species distinct from the rest. The two pairs of specimens are genetically differentiated from

each other, e.g., COI barcode differences of 4.9% (32 bp) between them, and belong to two different new

species. The one from eastern Ecuador is described here, and the one from western Colombia is described

above. The new species from Ecuador keys to D.4.2(b) in Evans (1952), and differs from its relatives by

the following combination of characters in males: wings not as rounded as in Euriphellus mena (Evans,

1952) (type locality in Ecuador), dorsal wing color redder in hue, forewing may be with small

submarginal hyaline spots in cells Mi-M2, M2-M3, and R3-R4, and larger hyaline subapical spots in cells

R4-Rs and Rs-Mj), hindwing with five weaker-developed and separated postdiscal brown spots on dorsal

side, one in each cell between veins RS and CuAg, ventrally with prominent yellow spots, but not near the

base of cell Sc+Ri-RS (Fig. 27b), tegumen broader in dorsal view, harpe shorter than in Euriphellus

colombiensis sp. n., only weakly humped along ventral margin, no dorsal keel, and narrows to a point,

ampulla with a rounded thumb-like process with somewhat irregular margins (Fig. 28c, d); and female

with smaller discal forewing hyaline spots, the spot in cell M3-CuA1 offset distad from the spot in cell

CuAi-CuA2 not overlapping with it (Fig. 27d). Due to unknown phenotypic variation, definitive

identification is provided by DNA, and a combination of the following characters is diagnostic in the

nuclear genome: aly331.26.8:C109A, aly331.26.8:G267A, aly331.26.8:T291C, aly536.154.1:A618G, aly536.

154.1:T631C and in COI barcode: A28G, T91A, A229G, C343A, G474A, A538G, T544A, T607C, T634C.

Barcode sequence of the holotype. Sample NVG-18057G01, GenBank OR837730, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGGGCAGGAATACTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAACTCCCGGTTCATTAAT TGGAAATGATCAAATTTATAATACT

ATTGTTACAGCCCATGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTACCATTAATATTAGGAGCCCCAGATATGGCTTTTCCACGAA

TAAACAATATAAGATTTTGATTACTTCCACCTTCTTTAATATTATTAATTT CAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCACCTTTATCTGCTAATATTGC

BSN WS EC ts ak NG i eat pT AER BAe Cae Ong ea hates ii pS a ee GaCh Ce a re aan en gS Ubi amer ne ake Se eur a ag ah ae tik i ly ear a

TTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTGCTTCTATCTTTACCTGTATTAGCAGGTGCAATTACTATATTATTAACAGACCGAAATTTTAATACAT

CCTTTTTTGATCCTTCTGGAGGAGGAGACCCTATTTTATATCAACATTTATTT

Type material. Holotype: & deposited in the Zoologische Staatssammlung Miinchen, Germany [ZSMC],

illustrated in Fig. 27b, bears five printed labels: four white [| Canelos | Ecuador or. |, [ Collection |

v.Rosen |, [ DNA sample ID: | NVG-18057G01 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-

first NVG number corresponds to a sampled leg, and the second is for the abdomen DNA extraction

followed by genitalia dissection. Paratype: 1° with the same data as the holotype (NVG-18057G02,

GenBank barcode OR837731, Fig. 27d).

Type locality. Ecuador: Canelos.

Etymology. The name is given for the country of the type locality. The name is a masculine adjective.

Distribution. Currently known only from Ecuador.

Goniurus proteoides Plétz, 1881 is a junior subjective synonym of Urbanus proteus

domingo (Scudder, 1872) and not of Urbanus proteus proteus (Linnaeus, 1758)

Genomic analysis of a syntype of Goniurus proteoides Plotz, 1881 (type locality in North America, NVG-

15029D03) currently considered a junior subjective synonym of Urbanus proteus proteus (Linnaeus,

1758) (type locality in America) (Mielke 2005) reveals that it is not monophyletic with the latter and

instead placed within specimens of Urbanus proteus domingo (Scudder, 1872) (type locality in Haiti), in

agreement with Evans (1952) (Fig. 29). Therefore, we regard Goniurus proteoides Plétz, 1881 as a junior

subjective synonym of Urbanus proteus domingo (Scudder, 1872) and not of Urbanus proteus proteus

rbanus proteus proteus :TX,Hidalgo Co. rbanus proteus proteus :FL,Levy Co.

a Urb 3841|USA:TX,Hidalgo Co.|2015 Urb p p 4697|USA:FL,Levy Co.|2015

Urbanus proteus proteus|4371|USA:TX,Chambers Co.|2015 Beppnds proteus proteus|22063G04|USA:AL, Baldwin Co.|2018

nuclear Urbanus proteus proteus|15038C02|?NT|USA:NC,Craven Co.|1959 mito rbanus proteus proteus|4371|USA:TX,Chambers Co.|2015

Urbanus proteus proteus|22063G04|USA:AL, Baldwin Co.|2018

Urbanus proteus proteus|4894|USA:FL,Miami-Dade Co.|2015

Urbanus proteus proteus|10211|USA:TX,Dallas Co.|2017

Urbanus proteus proteus|4697|USA:FL,Levy Co.|2015

Urbanus proteus domingo|15099B09|Barbados|1985

Urbanus proteus domingo|10308|Jamaica|2017

Urbanus proteus domingo|19071A09|Dominican Republic|1981

U. proteus domingo (=proteoides) [not nominal]|15029D03|LT|no datalold

Urbanus proteus domingo|19069D10|Bahamas:North Caicos|1984

Urbanus proteus domingo|19069D11|Cuba, Guantanamo|1965

Urbanus proteus domingo|19069D12|Cuba, Sierra Maestra|1929

Urbanus cubanus|18057F12|HT|Cuba:Havana|2014

Urbanus cubanus|21126H02|PT|Cubalold

Urbanus velinus|19064C10|Venezuela|1979

Urbanus velinus|19126B09|Peru:MD|2019

0.004 Urbanus velinus|5697|Guyana|1999

erie proteus proteus|15038C02|?NT|USA:NC,Craven Co.|1959

rbanus proteus proteus|4894|USA:FL,Miami-Dade Co.|2015

33rbanus proteus proteus|10211|USA:TX,Dallas Co.|2017

rbanus proteus domingo|19069D12|Cuba,Sierra Maestra|1929

Hibanus proteus domingo|19069D10|Bahamas:North Caicos|1984

rbanus proteus domingo|19071A09|Dominican Republic|1981

9. proteus domingo (=proteoides) [not nominal]|15029D03|LT

Urbanus proteus domingo|10308|Jamaica|2017

qa. proteus proteus|3841|USA:TX,Hidalgo Co.|2015

tbo'§rbanus proteus domingo|15099B09|Barbados|1985

Urbanus proteus domingo|19069D11|Cuba,Guantanamo|1965

Peeenne cubanus|18057F12|HT|Cuba:Havana|2014

rbanus cubanus|21126H02|PT|Cuba|old

rbanus velinus]19064C10|Venezuela|1979

bbanus velinus|19126B09|Peru:MD|2019

—— 0.008 Urbanus velinus|5697|Guyana|1999

Fig. 29. Phylogenetic trees of selected Urbanus species inferred from protein-coding regions of a) the nuclear genome

(autosomes) and b) the mitochondrial genome: U. proteus (blue branches) with U. proteus proteus (blue labels) and U. proteus

domingo (specimens from Cuba are labeled in magenta, the lectotype of Goniurus proteoides in orange, and others in violet),

U. cubanus sp. n. (red), and their sister U. velinus (green).

(Linnaeus, 1758). In agreement with this conclusion, Godman (1907), who inspected the unpublished

drawing t[afel].33 by Plétz of G. proteoides, wrote that he had its “Specimens from the Lesser Antilles in

the G. & S. coll.” To stabilize nomenclature, N.V.G. hereby designates the sole syntype curated in the

MENB collection, a male with the following five labels, the 2"¢ handwritten and others printed, the 1% red

and others white: [ Type |, [ proteoides | Pl. 104], [ Coll. H—Sch ], [ {QR Code} http://coll.mfn-

Goniurus proteoides Plétz, 1881. The type locality of G. proteoides is in the Antilles (unclear if the

Greater or the Lesser). Sequencing additional specimens of U. p. domingo across its range may pinpoint

the type locality more precisely.

Urbanus (Urbanus) cubanus Grishin, new species

http://zoobank.org/E13 11827-75D9-4699-8E88-D7A3 17D9792A

(Figs. 29 part, 30, 31la—e)

Definition and diagnosis. The nuclear genome tree reveals a prominent clade of two specimens from

Cuba (Fig. 29 red) initially identified as Urbanus proteus domingo (Scudder, 1872) (type locality in

Fig. 30. Urbanus (Urbanus) cubanus sp. n. in dorsal (left) and ventral (right) views, data in text:

a) holotype ? NVG-18057F12 and b) paratype @ NVG-21126H02.

cubanus _ cubanus

HT PT

domingo

1mm a b Cc ie f g

Latent

Fig. 31. Female genitalia of Urbanus (Urbanus) cubanus sp. n.: a—c) holotype NVG-18057F12 and d—e) paratype NVG-

21126H02, data in text, and f-g) Urbanus (Urbanus) proteus domingo NVG-23012A04 from Cuba: Havana, 3-Mar-1927

[ZMSC] in ventral (a, b, d, f) and right ventrolateral (c, e, g) views. Complete genitalia with ductus and corpus bursae are

shown in a) and reduced two times (as indicated by smaller scale) compared to other images. Blue arrows point at the antrum.

Haiti) that is sister to all other Urbanus proteus (Linnaeus, 1758) (type locality in America) we sequenced

(Fig. 29 blue branches), and is placed approximately halfway between U. proteus and its sister species

Urbanus velinus (Pl6tz, 1881) (type locality in Brazil: Bahia) (Fig. 29 green). The two specimens are

strongly differentiated genetically from U. p. domingo (Fig. 29 violet, orange, and magenta labels),

including two other specimens from Cuba (southeastern region) (Fig. 29 magenta labels): Fst/Gmin/COI

barcode difference of 0.51/0.00/0.8% (5 bp, barcodes are similar between the two species). Therefore, these

two specimens represent a species distinct from U. proteus. This new species keys to C.13.1(b) in Evans

(1952) and differs from its closest relative U. proteus in broader and straighter ventral hindwing dark

brown bands and a darker area by mid-costa, hyaline spot in forewing cell CuA;-CuAg2 closer aligned with

the spot in discal cell rather than shifted distad, absent or small submarginal hyaline spots in forewing

cells Mi-M2 and M2-M3, and narrower antrum (Fig. 31 blue arrows). Due to unexplored phenotypic

variation, definitive identification is provided by DNA, and a combination of the following characters is

diagnostic in the nuclear genome: aly103.33.9:A90G, aly103.33.9:T160C, aly103.33.9:G162C, aly207.9.6:

A180G, aly103.50.3:T60C and in COI barcode: C220C, T322C, T385C, T610C, C616T.

Barcode sequence of the holotype. Sample NVG-18057F12, GenBank OR837732, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTT TAAT TGGAGATGATCAAATTTATAATACT

ATTGTAACAGCTCATGCTTTCATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTAGT TCCATTAATAATAGGT GCCCCTGATATAGCTTTC

TAAATAATATAAGATTTTGATTATTACCCCCTTCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGTACCGGATGAACAGTCTATCCCCCTCTTTCATCTAATATTG

CCACCAAGGAGCTTCCGTTGACCTAGCAATTTTTTCTCTTCATCTTGCTGGAATT TCATCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT

TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTCTCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT

CATTCTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ¢ deposited in the Zoologische Staatssammlung Miinchen, Germany [ZSMC],

illustrated in Fig. 30a, bears six labels: four white, the 3 greenish [ CUBA, La Habana, | Boyeros, Finca

La | Chata (23.036 N, - | 82.376 W), July 9 2014 | R. Nufiez leg. J], [ RNA-1-171 ], [BC ZSM Lep

92903 |, [ DNA sample ID: | NVG-18057F12 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-

23012A03 | c/o Nick V. Grishin ], and one red [ HOLOTYPE @ | Urbanus (Urbanus) | cubanus Grishin ].

The first NVG number corresponds to a sampled leg, and the second is for the abdomen DNA extraction

followed by genitalia dissection. Paratype: 19 Cuba, Gundlach leg., Coll. Thieme, genitalia vial NVG-

22111G12 (NVG-21126H02, GenBank barcode OR837733, Fig. 30b) [MFNB].

Type locality. Cuba: Havana, Boyeros, Finca La Chata, GPS 23.036, —82.376.

Etymology. The name is given for the country of the type locality. The name is a masculine adjective.

Distribution. Cuba; currently confirmed from the northwestern region (Havana).

Comment. The ground color difference between the holotype and paratype (darker brown vs. paler

reddish-brown, Fig. 30) is due to fading with age: the paratype was collected more than a century ago.

Quadrus (Zera) difficilis (Weeks, 1901) is confirmed as a species

distinct from Quadrus (Zera) zera (A. Butler, 1870)

Although Quadrus (Zera) difficilis (Weeks, 1901) (type locality in Bolivia) is treated as a distinct species

and not a subspecies of Quadrus (Zera) zera (A. Butler, 1870) (type locality in Venezuela), on the

Butterflies of America website (Warren et al. 2023), this taxonomic opinion has not been substantiated

numerically. Genomic sequencing of several specimens of both taxa reveals prominent genetic

differentiation between them (Fig. 32), e.g., Fs/COI barcode difference of 0.30/2.7% (18 bp), thus

confirming Quadrus (Zera) difficilis (Weeks, 1901) as a species-level taxon.

Quadrus (Zera) zera|19086F06|Panama|1982 D mitochondrial

Quadrus (Zera) zera|20054A12|Panama|2013

Quadrus (Zera) zera|19086F09|Ecuador|1990 —

Quadrus (Zera) zera|19086F08|Venezuela|1985 ne

Quadrus (Zera) difficilis (=concolor)|18078F11|HT|Panama|1887

Quadrus (Zera) difficilis]18011E12|Peru|2014

Quadrus (Zera) difficilis]18087D06|Bolivia|old

Quadrus (Zera) difficilis|19086F11|Brazil:MT|1978

Quadrus (Zera) teresa|19086F10|Brazil:RJ|old

Quadrus (Zera) teresa|22018E11|Paraguaylold

Quadrus (Zera) belti|19086F05|Panama|1968

Quadrus (Zera) belti|19086F04|Panama|1968

Quadrus (Zera) zera|20054A12|Panama|2013

97 Quadrus (Zera) zera|19086F06|Panama|1982

oQuadrus (Zera) zera|19086F09|Ecuador|1990

Quadrus (Zera) zera|19086F08|Venezuela|1985

Quadrus (Zera) difficilis (=concolor)|18078F11|HT

Quadrus (Zera) difficilis]18011E12|Peru|2014

°Quadrus (Zera) difficilis|18087D06|Bolivialold

Quadrus (Zera) difficilis}19086F 11|Brazil:MT|1978

Quadrus (Zera) teresa|22018E11|Paraguaylold

Quadrus (Zera) teresa|19086F10|Brazil:RJ|old

Quadrus (Zera) belti]19086F05|Panama|1968

Quadrus (Zera) belti|19086F04|Panama|1968

a nuclear

Fig. 32. Phylogenetic trees of selected Quadrus (Zera) species inferred from protein-coding regions of a) the nuclear genome

(autosomes) and b) the mitochondrial genome: Q. zera (blue) and Q. difficilis (red).

Bolla subgisela Strand, 1921 is a junior subjective synonym

of Staphylus melangon epicaste Mabille, 1903 and not of Bolla eusebius (Plétz, 1884)

Genomic analysis of the holotype of Bolla subgisela Strand, 1921 (type locality in Colombia), currently

regarded as a junior subjective synonym of Bolla eusebius (Pl6tz, 1884) (type locality in Central America)

reveals that it is not monophyletic with Bolla Mabille, 1903 (type species Bolla pullata Mabille, 1903

treated as a junior subjective synonym of Staphylus imbras Godman and Salvin, 1896), but instead is

placed within specimens of Staphylus melangon (Mabille, 1883) (type locality in South America) and

away from Staphylus tucumanus (P16tz, 1884) (type locality in Argentina), a sister species of S. melangon

(Fig. 33). Therefore, B. subgisela is conspecific with S. melangon. The phylogenetic analysis we used

does not differentiate between subspecies of S. melangon (Fig. 33), and we assign B. subgisela to

subspecies by a combination of wing pattern characters and locality. Only Staphylus melangon epicaste

Mabille, 1903 (type locality in Brazil) possesses brown ventral hindwing without dominant white

overscaling toward tornus and inner margin, similar to B. subgisela, and it is the only subspecies

documented from Colombia (Evans 1953). Therefore, we propose that Bolla subgisela Strand, 1921 is a

junior subjective synonym of Staphylus melangon epicaste Mabille, 1903.

a nucieal Bolla eusebius|15033G09|T|Central America|old b pieppiailtcale

Bolla imbras|21054A07|Mexico:Ver|1972

Staphylus lizeri|18058D05|Peru:Cuzco|2013

Staphylus musculus|22046G08|Brazil:RS|1954

Staphylus melangon melangon|18058D07|Brazil:MT|old

Staphylus melangon epicaste|18058D08|Brazil:SP|1959

Staphylus melangon epicaste (=subgisela) [not Bolla eusebius}|20082F09|HT|Colombialold

Staphylus melangon melangon|21055A01|Brazil:MG|1971

Staphylus melangon epicaste|18058D11|Brazil:RO|1991

) otaphylus tucumanus|22046G10|Argentinalold

Staphylus tucumanus|22101D01|Argentina|~1970

Staphylus ascalaphus|18058F06|Panama|1975

Bolla eusebius|15033G09|T|Central America|old

Bolla imbras|21054A07|Mexico:Ver|1972

Staphylus lizeri|18058D05|Peru:Cuzco|2013

Staphylus musculus|22046G08|Brazil:RS|1954

Staphylus melangon melangon|21055A01|Brazil:MG|1971

graphylus melangon melangon|18058D07|Brazil:MT|old

taphylus melangon epicaste|18058D11|Brazil:RO|1991

Beaphylus melangon epicaste|18058D08|Brazil:SP|1959

Staphylus m. epicaste (=subgisela) [not Bolla eusebius]|20082F09|HT

Staphylus tucumanus|22101D01|Argentina|~1970

Staphylus tucumanus|22046G10|Argentinalold

Staphylus ascalaphus|18058F06|Panama|1975

0.02

Fig. 33. Phylogenetic trees of selected Bolla (violet) and Staphylus inferred from protein-coding regions of a) the nuclear

genome (autosomes) and b) the mitochondrial genome: S. melangon (blue, with Bolla subgisela Strand, 1921, which 1s a junior

subjective synonym of S. m. epicaste, in magenta) and its sister species S. tucumanus (green).

Gorgythion marginata Schaus, 1902 is a species distinct

from Gorgythion begga (Prittwitz, 1868)

Gorgythion marginata Schaus, 1902 (type locality in Peru) (Fig. 34 red) currently regarded as a junior

subjective synonym of Gorgythion begga pyralina (Moschler, 1877) (type locality in Suriname) (Fig. 34

blue, part) is genetically differentiated from it and generally from Gorgythion begga (Prittwitz, 1868)

(type locality in Brazil: Rio de Janeiro) at the species level (Fig. 34), e.g., Fs/COI barcode difference of

0.26/2.9% (19 bp). Therefore, we propose that Gorgythion marginata Schaus, 1902, stat. rest. is a

species-level taxon distinct from Gorgythion begga (Prittwitz, 1868).

Gorgythion begga pyralina|15043E10|Surinam|2002 b

Gorgythion begga pyralina|4978|French Guiana|1993 2 :

Gorgythion begga begga|15033E06|ST|Brazil:RJjold Mitochondrial

bo COrgythion begga begga (=beggoides) [not plautia]|15101B07|ST|Trinidad|old

**Gorgythion begga begga|4981|Brazil:RJ|1995

Gorgythion guyanus|15043F10|HT|Guyana|1993 a

Gorgythion marginata [not begga]|15101C03|ST|Peruljold

Gorgythion marginata [not begga]|15101F06|ST|Perulold

Gorgythion marginata [not begga]|4974|Peru|1983

Gorgythion beggina beggina|15033E07|ST|Bolivialold

Gorgythion beggina beggina|15033E08|ST|Bolivialold

Gorgythion beggina escalophoides|15043F03|Argentina|1986

Gorgythion beggina escalophoides|4994|Argentina|1978

Gorgythion plautia|4977|Guyana|1999

Gorgythion plautia|4984|Brazil:RO|1991

oo COrgythion canda|4992|Brazil:MT|1990

Gorgythion canda|21015C08|Paraguay|1922

Gorgythion vox|4970|Mexico:Chiapas|1973

Gorgythion vox|4972|EI Salvador|1967

[00 Gorgythion alcandra|4989|Ecuador:Loja|1975

Gorgythion alcandra|15043E02|Ecuador,Loja|1974

Gorgythion begga pyralina|15043E10|Surinam|2002

'@orgythion begga begga (=beggoides) [not plautia]|15101B07|ST

sGorgythion begga begga|4981|Brazil:RJ|1995

orgythion begga pyralina|4978|French Guiana|1993

Gorgythion begga begga|15033E06|ST|Brazil:RJ|old

Gorgythion guyanus|15043F10|HT|Guyana|1993

7p @orgythion plautia|4977|Guyana|1999

Gorgythion plautia|4984|Brazil:RO|1991

ifeorgythion canda|4992|Brazil:MT|1990

orgythion canda|21015C08|Paraguay|1922

Gpraytnion vox|4970|Mexico:Chiapas|1973

orgythion vox|4972|EI Salvador|1967

Gorgythion marginata [not begga]|15101C03|ST|Perulold

{fgorgythion marginata [not begga]|15101F06|ST|Perulold

Gorgythion marginata [not begga]|4974|Peru|1983

Prgythion beggina beggina|15033E08|ST|Bolivia|old

orgythion beggina beggina|15033E07|ST|Bolivialold

“Geraythion beggina escalophoides|4994/Argentina|1978

orgythion beggina escalophoides|15043F03|Argentina

feraythion alcandra|4989|Ecuador:Loja|1975

orgythion alcandra|15043E02|Ecuador,Loja|1974

Z chromosome

0.007

Fig. 34. Phylogenetic trees of Gorgythion species inferred from protein-coding regions of a) the Z chromosome and b) the

mitochondrial genome. Different species are shown in different colors: G. begga (blue, with G. beggoides syntype labeled in

orange), G. guyanus sp. n. (magenta), G. marginata stat. rest. (red), G. beggina (violet), G. plautia (cyan), G. canda (olive),

G. vox (green), and G. alcandra (black).

Gorgythion beggoides Schaus, 1902 is a junior subjective synonym of

Gorgythion begga begga (Prittwitz, 1868), not of Gorgythion plautia (Méschler, 1877)

Gorgythion beggoides Schaus, 1902 (type locality in Trinidad) (Fig. 34 orange) currently treated as a

junior subjective synonym of Gorgythion plautia (Méschler, 1877) (type locality in Suriname) (Fig. 34

cyan) is not monophyletic with it and is instead placed within specimens of Gorgythion begga (Prittwitz,

1868) (type locality in Brazil: Rio de Janeiro) (Fig. 34 blue). Hence, we propose that G. beggoides and G.

begga are conspecific. Due to extensive expression of white scaling around the tornus on the ventral

hindwing, G. beggoides belongs to the nominotypical subspecies and not to Gorgythion begga pyralina

(Moschler, 1877) (type locality in Suriname). Therefore, we propose that Gorgythion beggoides Schaus,

1902 is a junior subjective synonym of Gorgythion begga begga (Prittwitz, 1868), not of Gorgythion

plautia (Méschler, 1877).

Gorgythion guyanus Grishin, new species

http://zoobank.org/75920045-0024-46CF-83F0-F53371D32E59

(Figs. 34 part, 35, 36)

Definition and diagnosis. Genomic analysis of Gorgythion Godman & Salvin, 1896 (type species Helias

pyralina Moschler, 1877) reveals that a specimen from Guyana (NVG-15043F10) (Figs. 34 magenta, 35)

while being sister to Gorgythion begga (Prittwitz, 1868) (type locality in Brazil: Rio de Janeiro) (Fig. 34

blue), is not grouping closely with any of the described species (Fig. 34) and therefore is new. It exhibits

COI barcode differences of 2.4% (16 bp) from Gorgythion begga pyralina (Moschler, 1877) (type locality

in Suriname). This new species keys to E.36.1(a) in Evans (1953) and differs from its relatives in nearly

unmarked dark-brown dorsal hindwing with convex outer margin, rounder than in Gorgythion plautia

(Moschler, 1877) (type locality in Suriname) (Fig. 34 cyan), ventral hindwing without white area towards

tornus, forewing not prominently truncate or produced at the apex, with developed markings and broad

4 »

ce wee Oe sl ci HA al

Fig. 35. Holotype of Gorgythion guyanus sp. n. in dorsal (left) and ventral (right) views, data in text.

a Cc

a er er er ee Oe

Fig. 36. Genitalia of Gorgythion guyanus sp. n. holotype in a) dorsal, b) posterolateral, c) left, and d) right lateral views.

pale-brown areas (Fig. 35); left valva broader at the base, and expansion of its ampulla curved inward,

appearing truncate in lateral view (Fig. 36). Due to unknown phenotypic variation, definitive

identification is provided by DNA, and a combination of the following characters is diagnostic in the nu-

clear genome: aly1313.36.6:C75T, aly1497.9.9:A87G, aly361.8.3:TI11C, aly361.8.3:C126T, aly13198.6.3:

G318C, aly1204.4.2:G54G (not A), aly1166.4.2:A30A (not C), aly1166.4.2:T42T (not C), aly770.15.7:A12A

(not G), aly770.15.7:G30G (not A) and in COI barcode: T59C, T172T, A181G, T280T, T463C, T574C.

Barcode sequence of the holotype. Sample NVG-15043F10, GenBank OR837734, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGATTACTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT

ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGGGGATTTGGAAATTGACTTGTTCCATTAATATTAGGAGCCCCTGATATAGCATTCCCCCGAA

TAAATAATATAAGATTTTGACTTTTACCTCCTTCCCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCTCCTCTTTCAGCTAATATTGC

CCATCAGGGGGCATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAGAAATTTATCT

TTTGATCAAATACCATTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCATTACCTGTTTTAGCAGGTGCTATTACCATATTATTAACAGATCGAAATTTAAATACAT

CATTTTTTGACCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: co deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida

Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 35, bears five labels: four

SRS-4628 |, [ Allyn Museum | Acc. 1994-5 ], [DNA sample ID: | NVG-15043F10 | c/o Nick V.

Grishin |, and one red [ HOLOTYPE o& | Gorgythion | guyanus Grishin ].

Type locality. Guyana: Essequibo, Mt. Wokomung, elevation 3500 ft.

Etymology. The name is given for the country of the type locality. The name is a masculine adjective.

Distribution. Currently known only for the holotype collected in Guyana.

Pardaleodes murcia (Pl6tz, 1883) is a species distinct

from Pardaleodes incerta (Snellen, 1872)

Genomic analysis reveals that Hesperia murcia SSpigrdslaouos fan DO DSBOSIA IE aoronnIaNa

(Plétz, 1883) (type locality not specified, syntype *Pardleoge ant 7060 kenya aes

sequenced as NVG-21116G06), currently treated as cot are odes cae yte 7108G06)Sierra Liune|1974

a subspecies of Pardaleodes incerta (Snellen, 1872) sap ardaleodes incerta|19067A03|Kenya|1987_

(type locality in Angola), is not monophyletic with it pa patdaleadesmurca ot cert 2111806 tina data

and is sister to the clade of P. incerta (Stoll, 1781) Pardaleodes murcia not Incertali17108608)Congol 188

together with P ar daleodes edip us (Stoll, 1781) (type J neraslendestbuialenizeGbel|icamereanicls a

locality in South Africa) (Fig. 37), genetically OER eee eo

differentiated from them with Fs/Gmin/COI barcode Dee ieee ena te oe

difference of 0.61/0.00/4.6% (30 bp) (P. incerta) and : spar daleodes pusiella (not cotorl| BOSSE 10|Ugendal 1946

0.64/0.00/5.0% (33 bp) (P. edipus). Therefore, we | Fig. 37. The nuclear genome tree (autosomes) of selected

propose that Pardaleodes murcia (Plétz, 1883), stat. Pardaleodes species: P. edipus (violet), P. incerta (blue), ye

; . ee murcia stat. rest. (red), P. tibullus (cyan), P. bule (olive),

rest. is a species distinct from Pardaleodes incerta

(Snellen, 1872). Sequencing a series of specimens

from additional localities in western Africa and comparing them with genomic sequences of P. murcia

syntypes may help in determining the type locality of this species more precisely.

P. sator (green), and P. pusiella stat. rest. (magenta).

Pardaleodes pusiella Mabille, 1877 is a species distinct

from Pardaleodes sator (Westwood, 1852)

Genomic analysis reveals that Pardaleodes pusiella Mabille, 1877 (type locality in Angola), currently

regarded as a subspecies of Pardaleodes sator (Westwood, 1852) (type locality in Guinea), is genetically

differentiated from it at the species level (Fig. 37): e.g., Fst/Gmin/COI barcode difference of 0.62/0.00/

3.2% (21 bp). Therefore, we propose that Pardaleodes pusiella Mabille, 1877, stat. rest. is a species

distinct from Pardaleodes sator (Westwood, 1852).

Semalea malawi Grishin, 2023 is confirmed as a species-level taxon

Genomic sequencing of Hesperiidae from the CAS collection revealed a second confirmed specimen of

Semalea malawi Grishin, 2023 (type locality in Malawi, holotype sequenced as NVG-19043B12), which

is also a male as the holotype but was collected in northeastern Tanzania (Tanga District, Usambara Mts.,

Amani Malaria Station, elevation 300 ft, 6-Jan-1970, M. E. Irwin & E. S. Ross leg., NVG-22108B02,

Fig. 38. Semalea malawi Grishin, 2023: a) the holotype and b) a specimen from Tanzania, data in text.

Semalea rega|18073A03|ST|Sierra Leone|old b

Semalea rega|22108B04|Ghana|1973

Semalea rega|21099B07|Liberia|1956

Semalea rega (=evansi)|18087B08|T|Sierra Leone|1906

Semalea rega|21099B06|Liberia|1955

Semalea rega|19043B10|Nigeria|1973

Semalea rega|21099B08|Liberia|1958

Semalea rega (=sierrae)|18073A01|ST|Sierra Leone|old

Semalea rega (=staudingeri)|20125A08|HT|Cameroon|old

Semalea vibius|7765|Cameroon|1987

- Semalea vibius|18096F03|French Congolold

Semalea vibius|SAMN18587799|Uganda

Semalea vibius|18099F02|Uganda|1940

Semalea vibius|21099B04|Rwanda|1957

» Semalea malawi|22108B02|Tanzania|1970

Semalea malawi|19043B12|HT|Malawi|1940

Semalea rega (=evansi)|18087B08|T

qemalea rega (=sierrae)|18073A01|ST

2Semalea rega|21099B07|Liberia|1956

9Semalea rega|21099B06|Liberia|1955

190 Semalea rega|21099B08|Liberia|1958

5,emalea rega|18073A03|ST|Sierra Leone

sgemalea rega|19043B10|Nigeria|1973

ifemalea rega|22108B04|Ghana|1973

Semalea rega (=staudingeri)|20125A08|HT

ape vibius|7765|Cameroon|1987

emalea vibius|18096F03|French Congo

isemalea vibius|SAMN18587799|Uganda

emalea vibius|21099B04|Rwanda|1957

emalea vibius|18099F02|Uganda|1940

oo 2emalea malawi|22108B02|Tanzania|1970

Semalea malawi|19043B12|HT|Malawi|1940

Semalea rega|18073A03|ST|Sierra Leone|old Cc

Semalea rega (=evansi)|18087B08|T|Sierra Leone|1906

Semalea rega|19043B10|Nigeria|1973

Semalea rega|21099B06|Liberia|1955

Semalea rega|21099B07|Liberia|1956

Semalea rega (=sierrae)|18073A01|ST|Sierra Leone|old

Semalea rega|21099B08|Liberia|1958

; Semalea rega|22108B04|Ghana|1973

Semalea rega (=staudingeri)|20125A08|HT|Cameroonjold

Semalea vibius|18096F03|French Congolold

Semalea vibius|7765|Cameroon|1987

Semalea vibius|18099F02|Uganda|1940

Semalea vibius|21099B04|Rwanda|1957

> Semalea malawi|22108B02|Tanzania|1970

core emalea malawi|19043B12|HT|Malawi|1940

0.006 0. —— 0.009

Fig. 39. Phylogenetic trees of selected Semalea species inferred from protein-coding regions of a) the nuclear genome

(autosomes), b) the Z chromosome, and c) the mitochondrial genome. Different species are shown in different colors: S. rega

(violet), S. vibius (blue), and S. malawi (red). The sequence of SAMN18587799 is taken from the alignment provided in

Kawahara et al. (2023).

CASENT 8568645) (Figs. 38b, 39). Compared to the holotype (Fig. 38a), it is yellower in the hue of paler

scales (forewing patch, ventral overscaling, palpi, and cheeks), with a slightly shorter forewing orange

patch, and has a small orange subapical spot on the forewing, more expressed on the ventral side (Fig.

39b). The COI barcode sequence of this specimen (GenBank OR837735) matches all 7 diagnostic

characters given in the original description (Zhang et al. 2023b) but differs by 5 bp from the holotype.

With this additional specimen, we carried out Fst/Gmin test to obtain the values 0.34/0.000 (with S. vibius

(Hewitson, 1878)) and 0.55/0.000 (with S. rega (Mabille, 1889)) confirming S. malawi as a species.

Limochores mystic nino Grishin, new subspecies

http://zoobank.org/E1AE8324-1FFE-4A 14-916D-8BCC85B96105

(Figs. 40 part, 41)

Definition and diagnosis. Genomic sequencing of specimens from the southwesternmost population of

Limochores mystic (W. H. Edwards, 1863) (type locality in USA: NY, Greene Co., Huner) reveals that

they are sister to all other subspecies of L. mystic in the tree inferred from the nuclear genome (autosomes

only) (Fig. 40a), although they fall among other L. mystic populations in the Z chromosome (not shown)

and mitogenome trees (Fig. 40b), and their COI barcodes differ only due to variation. Therefore, this

population is likely conspecific with L. mystic; however, being most divergent from all others, it

represents a separate and new subspecies. In its duller look with more diffuse boundaries between brown

ground color and yellow-orange spots, this subspecies is most similar to Limochores mystic dacotah (W.

Limochores mystic mystic|18042E01|USA:NH,Grafton Co.|2001

97 Limochores mystic mystic|]18042E03|USA:NH,Grafton Co.|2001

Limochores mystic dacotah|PAO133|USA:WY,Goshen Co.|2016

Limochores mystic mystic|18042G01|F|USA:WI,Dunn Co.|2016

gh eka mystic dacotah (=pallida)|15095H03|ST|USA:SD, Brookings Co. |old

Limochores mystic mystic|15098A06|NT|USA:NY,Greene Co.|old

(| imochores mystic nino|22102C07|HT|USA:AZ,Coconino Co.|1988

Limochores mystic nino|22102C08|PT|USA:AZ,Coconino Co.|1988

Limochores mystic dacotah|15098A12|HT|USA:CO,Clear Creek Co.|old

mochores mystic dacotah|PAO149|USA:CO, Jefferson Co.|2016

Limochores sonora utahensis]20063C12|USA:CO,Grand Co.|1995

g,imochores sonora siris|21048H11|USA:WA, Thurston Co.|1993

Limochores sonora siris]21048H12|USA:WA, Thurston Co.|1994

,4imochores sonora flavaventris|15038B08|HT|USA:NV,Humboldt Co.|1987

43 Limochores sonora flavaventris|22076H10|PT|USA:NV,Humboldt Co.|1987

, Limochores sonora utahensis|9320|USA:WY,Park Co.|2017

* Limochores sonora sonora|21089G06|USA:CA, Siskiyou/Trinity Co.|2021

Limochores sonora sonora|PAO447|USA:CA, Sierra Co.|2017

‘°? Limochores sonora longinqua|15038B07|HT|USA:NV,Esmeralda Co.|1979

Limochores sonora longinqua|PAO521|USA:NV,Esmeralda Co.|2017

Limochores mystic mystic|18042G01|F|USA:WI,Dunn Co.|2016 b

Limochores mystic mystic|15098A06|NT|USA:NY,Greene Co.|old

Limochores mystic dacotah|PAO133|USA:WY,Goshen Co.|2016

Limochores mystic mystic|18042E03|USA:NH,Grafton Co.|2001

Limochores mystic mystic|18042E01|USA:NH,Grafton Co.|2001

Limochores mystic dacotah|PAO149|USA:CO, Jefferson Co.|2016

Limochores mystic dacotah|15098A12|HT|USA:CO,Clear Creek Co.|old

Limochores m. dacotah (=pallida)|15095H03|ST|USA:SD, Brookings Co.|old

Limochores mystic nino|22102C07|HT|USA:AZ,Coconino Co.|1988

Limochores mystic nino|22102C08|PT|USA:AZ,Coconino Co.|1988

Limochores sonora siris]21048H11|USA:WA, Thurston Co.|1993

Limochores sonora siris|21048H12|USA:WA, Thurston Co.|1994

Limochores sonora sonora|21089G06|USA:CA, Siskiyou/Trinity Co.|2021

Limochores sonora sonora|PAO447|USA:CA, Sierra Co.|2017

Limochores sonora flavaventris|15038B08|HT|USA:NV,Humboldt Co.|1987

Limochores sonora flavaventris|22076H10|PT|USA:NV,Humboldt Co.|1987

Limochores sonora longinqua|15038B07|HT|USA:NV,Esmeralda Co.|1979

Limochores sonora longinqua|PAO521|USA:NV,Esmeralda Co.|2017

Limochores sonora utahensis|9320|USA:WY,Park Co.|2017

Limochores sonora utahensis|20063C12|USA:CO,Grand Co.|1995

0.005

0.003

Fig. 40. Phylogenetic trees of Limochores mystic (blue, with L. mystic dacotah in cyan and L. mystic nino ssp. n. in magenta)

and Limochores sonora (black, with L. sonora utahensis in violet color) inferred from protein-coding regions of a) the nuclear

(autosomes) and b) the mitochondrial genomes.

Fig. 41. Limochores mystic nino ssp. n. in dorsal (left) and ventral (right) views, data in text: a) holotype c& and b) paratype &.

H. Edwards, 1871) (type locality in USA: Colorado, Clear Creek Co.) and differs from it by the following

characters. Males have reduced orange scaling, spots and bands are narrower, e.g., the orange on the

dorsal hindwing is reduced to a band approximately the same width as the brown margin, and the band is

separated from the orange discal cell by a brownish belt. Both sexes have darker ventral sides of wings.

Due to extensive phenotypic variation, definitive identification is provided by DNA, and a combination of

the following characters is diagnostic in the nuclear genome: aly499.49.4:G66C, aly848.2.19:TS1C, aly838.

7.2:C48T, aly838.7.2:T63C, aly1838.42.3:C34T.

Barcode sequence of the holotype. Sample NVG-22102C07, GenBank OR837736, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT

ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGAT TAGTACCATTAATACTAGGAGCTCCTGATATAGCTTTCCCTCGAA

TAAATAATATAAGATTTTGAATATTACCACCTTCACTAACATTGTTAATTTCAAGAAGAATTGTAGAGAATGGTGCAGGAACAGGTTGAACAGTTTACCCACCTTTATCTTCTAATATTGC

ACATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCCGGAATTTCTTCTATTTTAGGAGCTATTAATTTTAT TACAACAATTAT TAATATACGAATTAAAAATTTATCA

TTTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCTTTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTACTTACAGATCGAAATTTAAATACTT

CATTTTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material. Holotype: ¢& deposited the California Academy of Sciences, San Francisco, CA, USA

[CAS], illustrated in Fig. 41a, bears seven printed (text in italics handwritten) labels: six white [ Circle

Bar Draw at | Tillman Ranch, 7100' | Coconino Co. AZ |, [ 9 June 1988 | collected by Kilian Roever ],

sample ID: | NVG-22102C07 | c/o Nick V. Grishin ], [ {QR Code} CASENT | 8566979 |, and one red

[ HOLOTYPE ¢& | Limochores mystic | nino Grishin ]. Paratype: 12° same data as the holotype (NVG-

22102C08, CASENT 8566980, Fig. 41b) [CAS].

Type locality. USA: Arizona, Coconino Co., Circle Bar Draw at Tillman Ranch, 7100".

Etymology. The name is formed from the name of the county of the type locality [Coco]nino and is a

noun in apposition.

Distribution. Only known from central Arizona, USA. Populations in southwestern Colorado should be

studied to determine their taxonomic identity.

Hesperia pahaska Leussler, 1938 populations in most of New Mexico and the White

Mountains, Arizona are the nominal subspecies, not H. p. williamsi Lindsey, 1940

Genomic trees of Hesperia pahaska Leussler, 1938 (type locality in USA: Nebraska, Sioux Co.) reveal

that a specimen from southeastern New Mexico (Lincoln Co., NVG-22057C03) and specimens from the

White Mountains in Arizona are not in the same clade with Hesperia pahaska williamsi Lindsey, 1940

(type locality in USA: Arizona, Pima Co. Baboquivari Mts., holotype sequenced as NVG-15096B10), a

subspecies they were usually attributed to, but are within specimens of the nominal H. pahaska (Fig. 42).

Therefore, we deduce that populations in most of New Mexico and eastern Arizona are H. pahaska

pahaska, while the specimens from southwestern New Mexico remain to be studied.

Hesperia pahaska hannawackeri Grishin, new subspecies

http://zoobank.org/FC3A2704-0C47-4FEC-8476-2947275E52FD

(Figs. 42 part, 43)

Definition and diagnosis. Populations of Hesperia pahaska Leussler, 1938 (type locality in USA:

Nebraska, Sioux Co.) from southeastern Utah and southwestern Colorado are usually included in

Hesperia pahaska martini MacNeill, 1964 (type locality USA: California, San Bernardino Co., 4.5 mi SE

of Ivanpah). However, they form a distinct clade in the Z chromosome tree and possess a distinct

mitochondrial genome haplotype (Fig. 42 red), representing distinct subspecies. This new subspecies

differs from H. p. martini in better outlined and contrasting with fulvous ground color brown outer

margins, smaller forewing subapical spots, and usually smaller ventral hindwing white spots; from the

nominal Hesperia pahaska by less contrasting with the fulvous colors subapical and submarginal dorsal

forewing spots, which are typically paler in H. p. pahaska, and usually more extensive fulvous areas

penetrating fuscous margins in females on wings above (more similar to H. p. williamsi in this aspect) and

Hesperia leonardus leonardus|20067A08|USA:PA,Dauphin Co.|1976

os,esperia leonardus montana|17116D02|USA:CO, Jefferson Co.|1987

Hesperia leonardus pawnee|20067B01|USA:SD,Day Co.|1967

hips pers pahaska pahaska|21048F08|USA:NE, Sioux Co.|1986

. esperia pahaska pahaska|22047D11|PT|USA:NE,Sioux Co.|1917

Hesperia pahaska pahaska|22057C03|USA:NM, Lincoln Co.|2020

7Alesperia pahaska pahaska|22063G11|USA:AZ,Apache Co.|2020

esperia pahaska pahaska|11294|USA:NM,Santa Fe Co.|2018

esperia pahaska pahaska|11633|USA:AZ,Greenlee Co.|2018

Hesperia pahaska hannawackeri|20045F06|HT|USA:UT,San Juan Co.|2016

ee pahaska hannawackeri|20045F05|PT|USA:UT,San Juan Co.|2020

esperia pahaska hannawackeri|22055G10|PT|USA:CO, Delta Co.|1983

édesperia pahaska hannawackeri|22055G09|PT|USA:CO,Mesa Co.|2007

Lot bate pahaska hannawackeri|22055G08|PT|USA:CO,Mesa Co.|2007

speria pahaska hannawackeri|22055G12|PT|USA:CO,Montrose Co.|2016

Hesperia pahaska hannawackeri|22055G11|PT|USA:CO,Montrose Co.|2016

Hesperia pahaska hannawackeri|PAO566|PT|USA:CO,Mesa Co.|2017

Hesperia pahaska williamsi]11128|USA:TX,Jeff Davis Co.|2018

Heepere pahaska williamsi]20067B04|Mexico:Son|2003

esperia pahaska williamsi|20067B02|Mexico:Son|2004

Hecpcns pahaska williamsi]20067B03|Mexico:Son|1998

esperia pahaska williamsi|8279|USA:AZ,Pinal Co.|2017

Hesperia pahaska williamsi|15096B10|HT|USA:AZ,Pima Co.|1923

speria pahaska martini|20067B05|USA:CA, San Bernardino Co.|1959

esperia pahaska martini|21048F11|USA:CA,San Bernardino Co.|1978

esperia pahaska martini|15105D04|HT|USA:CA,San Bernardino Co.|1955

esperia pahaska martini]21048F12|USA:CA,San Bernardino Co.|1981

Hesperia pahaska martini|21048G01|USA:CA,San Bernardino Co.|1978

yob!esperia columbia|PAO38|USA:CA,Monterey Co.|2016

Hesperia columbia|PAO368|USA:CA,Colusa Co.|2017

Hesperia ottoe|22058B12|USA:IL,Winnebago Co.|1979

Hesperia ottoe|22058C01|USA:TX,Hemphill Co.|2022

Hesperia viridis|22068D06|USA:AZ,Greenlee Co.|198

Hesperia viridis]22055H04|USA:CO, Fremont Co.|1996

700 Hesperia metea licinus|20059A02|USA:TX,Wise Co.|2004

Hesperia metea metea|20062G06|USA:NJ,Ocean Co.|1962

hygsperia attalus attalus|12448|USA:KS, Barber Co.|2019

esperia attalus attalus|22058B08|USA:TX,Hemphill Co.|2022

a 55 Hesperia leonardus leonardus|20067A08|USA:PA,Dauphin Co.|1976 b

00 Hesperia leonardus montana|17116D02|USA:CO,Jefferson Co.|1987 H :

Z chr. Hesperia leonardus pawnee|20067B01|USA:SD,Day Co.|1967 mitochondrial

7 Hesperia pahaska pahaska|11294|USA:NM, Santa Fe Co.|2018

rr Hesperia pahaska pahaska|22057C03|USA:NM, Lincoln Co.|2020

Hesperia pahaska pahaska|21048F08|USA:NE,Sioux Co.|1986

188 Hesperia pahaska pahaska|22047D11|PT|USA:NE,Sioux Co.|1917

Hesperia pahaska pahaska|11633|USA:AZ,Greenlee Co.|2018

Hesperia pahaska pahaska|22063G11|USA:AZ,Apache Co.|2020

Hesperia pahaska hannawackeri|20045F05|PT|USA:UT,San Juan Co.|2020

Hesperia pahaska hannawackeri|22055G12|PT|USA:CO,Montrose Co.|2016

Hesperia pahaska hannawackeri|22055G11|PT|USA:CO,Montrose Co.|2016

Hesperia pahaska hannawackeri|20045F06|HT|USA:UT,San Juan Co.|2016

Hesperia pahaska hannawackeri|22055G08|PT|USA:CO,Mesa Co.|2007

Hesperia pahaska hannawackeri|22055GO9|PT|USA:CO,Mesa Co.|2007

190 Hesperia pahaska hannawackeri|22055G10|PT|USA:CO, Delta Co.|1983

Hesperia pahaska hannawackeri|PAO566|PT|USA:CO,Mesa Co.|2017

Hesperia pahaska williamsi|11128|USA:TX,Jeff Davis Co.|2018

rr Hesperia pahaska williamsi|20067B04|Mexico:Son|2003

Hesperia pahaska williamsi|15096B10|HT|USA:AZ,Pima Co.|1923

Hesperia pahaska martini|20067B05|USA:CA,San Bernardino Co.|1959

70 Hesperia pahaska williamsi|20067B02|Mexico:Son|2004

100 $s- Hesperia pahaska williamsi|8279|USA:AZ,Pinal Co.|2017

Hesperia pahaska williamsi|20067B03|Mexico:Son|1998

Hesperia pahaska martini|15105D04|HT|USA:CA,San Bernardino Co.|1955

Hesperia pahaska martini|21048G01|USA:CA,San Bernardino Co.|1978

Hesperia pahaska martini|21048F12|USA:CA,San Bernardino Co.|1981

Hesperia pahaska martini|21048F11|USA:CA,San Bernardino Co.|1978

Too Hesperia columbia|PAO38|USA:CA,Monterey Co.|2016

Hesperia columbia|PAO368|USA:CA,Colusa Co.|2017

Hesperia viridis|22068D06|USA:AZ,Greenlee Co.|198

Hesperia viridis]22055H04|USA:CO,Fremont Co.|1996

100 500 Hesperia attalus attalus|12448|USA:KS, Barber Co.|2019

Hesperia attalus attalus|22058B08|USA:TX,Hemphill Co.|2022

Hesperia metea licinus|20059A02|USA:TX,Wise Co.|2004

Hesperia metea metea|20062G06|USA:NJ,Ocean Co.|1962

400 Hesperia ottoe|22058B12|USA:IL,Winnebago Co.|1979

nese Hesperia ottoe|22058C01|USA:TX,Hemphill Co.|2022

100

124

100

Fig. 42. Phylogenetic trees of selected Hesperia species, including H. viridis (green) and H. pahaska with its subspecies H. p.

pahaska (violet), H. p. hannawackeri ssp. n. (red), H. p. williamsi (blue), and H. p. martini (cyan) inferred from protein-coding

regions of a) the Z chromosome and b) the mitochondrial genome.

Fig. 43. Hesperia pahaska hannawackeri ssp. n. in dorsal (above) and ventral (below) views, data in text:

a) holotype & NVG-20045F06 and b) paratype 2 NVG-20045F0S.

from Hesperia pahaska williamsi Lindsey, 1940 (type locality in USA: Arizona, Pima Co., Baboquivari

Mts) by generally larger white ventral hindwing spots. Due to extensive phenotypic variation, definitive

identification is provided by DNA, and a combination of the following characters is diagnostic in the

nuclear genome: aly5021.3.8:C60T, aly7690.1.10:C45A, aly7690.1.10:C204T, aly4196.3.1:C333G, aly4196.

3.1:A415G and in COI barcode: T10C, T19C, G101A, 328C, T646C.

Barcode sequence of the holotype. Sample NVG-20045F06, GenBank OR837737, 658 base pairs:

AACTTTATACTTTATTTTCGGTATTTGAGCTGGTATATTAGGAACTTCATTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTT TAAT TGGAAATGACCAAATTTATAATACT

ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTCCCACGTA

TAAATAATATAAGATTTTGAATATTACCACCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGCTGAACTGTTTATCCTCCTTTATCCTCTAATATTG

TCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCACTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAACTTATCT

TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTACTTACTGATCGAAATTTAAATACTT

CTTTTTTCGATCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material. Holotype: o deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida

Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 43a, bears four printed

labels: two white [ Pack Creek Day Use Area | La Sal Mountains | San Juan Co, UT | 2 June 2016 | Robb

Nick V. Grishin |, and one red [ HOLOTYPE co | Hesperia pahaska | hannawackeri Grishin |. Paratypes:

Socc 29: USA: 19 Utah, San Juan Co., Poison Canyon, el. 8500', 5-Jun-2020, R. Hannawacker leg.

(NVG-20045F05) (Fig. 43b); Colorado: Mesa Co.: 2c'c' Black Ridge Breaks, West Reef, 7050 ft, 24-25-

May-2007, M. S. Fisher leg. (NVG-22055G08 & NVG-22055G09); and lo BLM lands W of Gateway,

Unaweep Seep Natural Area, 10-Sep-2017, Paul A. Opler and Evi M. Buckner-Opler leg. (PAOQ566); 1c

Delta Co., 4.6-7.3 mi. SE of Austin, 6000-6600 ft, 12-Jun-1983, M. S. Fisher leg. (NVG-22055G10); Io

12 Montrose Co., Gunnison Gorge NWA, Wave-Eagle Trail Loop, 6000-6300 ft, 1- and 3-Jun-2016, M.

S. Fisher leg. (NVG-22055G11 & NVG-22055G12).

Type locality. USA: Utah, San Juan Co., La Sal Mountains, Pack Creek Picnic Area.

Etymology. The name honors Robb Hannawacker, the collector of the holotype and a female paratype

from Utah. Robb is a dedicated Lepidopterist and the author of the book on the butterflies of southeastern

Utah. He helped our lab tremendously with genomic studies of butterflies from his region (southeastern

Utah) by collecting specimens and connecting us with others who can help further. The name is a

masculine noun in the genitive case.

Distribution. Southeastern Utah and southwestern Colorado in the USA.

Pseudocopaeodes eunus ash Grishin, new subspecies

http://zoobank. org/9EB3 AEE9-E29D-4684-9A7D-lLEB65A9C6FB5

(Figs. 44 part, 45a)

Definition and diagnosis. Genomic sequencing of Pseudocopaeodes eunus (W. H. Edwards, 1881) (type

locality USA: Kern Co., the bottoms of Kern River, near Bakersfield) populations reveals that specimens

from the Ash Meadows area in southern Nevada are not monophyletic with Pseudocopaeodes eunus

alinea J. Scott, 1981 (type locality in USA: California, San Bernardino Co., Afton Canyon) despite the

similarity in being less marked than other populations, and form a distinct clade with genetic

differentiation larger than for some other P. eunus subspecies (Fig. 44), e.g., their COI barcodes differ by

1.1% (7 bp). Therefore, the Ash Meadows population represents a new subspecies. This subspecies is

most similar to P. e. alinea in appearance and differs from it in having less conspicuous and thinner

Pseudocopaeodes eunus obscurus|21036E07|HT|USA:NV,Carson City|1982 b

Pseudocopaeodes eunus obscurus|21036E08|AT|USA:NV,Carson City|1982

Pseudocopaeodes eunus flavus|21036E05|HT|USA:NV,Churchill Co.|1984

Pseudocopaeodes eunus flavus|21036E06|AT|USA:NV,Churchill Co.|1984

Pseudocopaeodes eunus eunus|PAO663|USA:CA,Inyo Co.|2018

--— Pseudocopaeodes eunus eunus|8050|USA:CA, Inyo Co.|1950

Pseudocopaeodes eunus eunus|20063H02|USA:CA, Inyo Co.|2006

Pseudocopaeodes eunus eunus|20063H01|USA:CA, Inyo Co.|2014

Pseudocopaeodes eunus eunus|21049E04|USA:CA, Kern Co.|1996

Pseudocopaeodes eunus eunus|21049E03|USA:CA,Kern Co.|2002

Pseudocopaeodes eunus eunus|21049E05|USA:CA,San Diego Co.|1976

Pseudocopaeodes eunus eunus (=wrightii)|15097HO2|LT|USA:CA,San Bernardino Co.|old

Pseudocopaeodes eunus alinea|22094B03|PT|USA:CA,San Bernardino Co.|1965

Pseudocopaeodes eunus alinea|22094B02|PT|USA:CA,San Bernardino Co.|1965

Pseudocopaeodes eunus alinea|22094B04|PT|USA:CA,San Bernardino Co.|1961

Pseudocopaeodes eunus obscurus|21036E07|HT|USA:NV,Carson City|1982

ifseudocopaeodes eunus obscurus|21036E08|AT|USA:NV,Carson City|1982

9g Seudocopaeodes eunus flavus|21036E06|AT|USA:NV,Churchill Co.|1984

Pseudocopaeodes eunus flavus|21036E05|HT|USA:NV,Churchill Co.|1984

Pseudocopaeodes eunus eunus|21049E05|USA:CA,San Diego Co.|1976

Rseudocopaeodes eunus eunus|21049E04|USA:CA, Kern Co.|1996

seudocopaeodes eunus eunus|21049E03|USA:CA,Kern Co.|2002

fseudocopaeodes eunus alinea|22094B03|PT|USA:CA,San Bernardino Co.|1965

s4 Pseudocopaeodes eunus eunus (=wrightii)|15097HO2|LT|USA:CA,San Bernardino Co.|old

sf seudocopaeodes eunus eunus|20063H02|USA:CA, Inyo Co.|2006

‘Pseudocopaeodes eunus eunus|PAO663|USA:CA, Inyo Co.|2018

Pseudocopaeodes eunus eunus|8050|USA:CA, Inyo Co.|1950

Pseudocopaeodes eunus eunus|20063H01|USA:CA, Inyo Co.|2014

oPseudocopaeodes eunus alinea|22094B02|PT|USA:CA,San Bernardino Co.|1965

Rseudocopaeodes eunus alinea |22094B01|PT|USA:CA,San Bernardino Co.|1965

Pseudocopaeodes eunus alinea |19061F04|HT|USA:CA,San Bernardino Co.|1965

Pseudocopaeodes eunus alinea|22094B04|PT|USA:CA,San Bernardino Co.|1961

spseudocopaeodes eunus ash [not alinea]|21049E07|HT|USA:NV,Nye Co.|1988

Pseudocopaeodes eunus ash [not alinea]|20063G12|PT|USA:NV,Nye Co.|1984

Pseudocopaeodes eunus ash [not alinea]|21049E06|PT|USA:NV,Nye Co.|1989 "eiaalaal) eae eunus ash [not alinea]|22076FO5|PT|USA:NV,Nye Co.|1987

Pseudocopaeodes eunus ash [not alinea]|20063G12|PT|USA:NV,Nye Co.|1984 seudocopaeodes eunus ash [not alinea]|22076F04|PT|USA:NV,Nye Co.|1987

0.006 Pseudocopaeodes eunus ash [not alinea]|22076F04|PT|USA:NV,Nye Co.|1987 002 | Pseudocopaeodes eunus ash [not alinea]|21049E06|PT|USA:NV,Nye Co.|1989

Pseudocopaeodes eunus alinea|22094B01|PT|USA:CA,San Bernardino Co.|1965

Pseudocopaeodes eunus alinea|19061F04|HT|USA:CA,San Bernardino Co.|1965

Pseudocopaeodes eunus ash [not alinea]|21049E07|HT|USA:NV,Nye Co.|1988

Pseudocopaeodes eunus ash [not alinea]|22076F05|PT|USA:NV,Nye Co.|1987

Fig. 44. Phylogenetic trees of Pseudocopaeodes eunus inferred from protein-coding regions of a) the nuclear genome

(autosomes) and b) the mitochondrial genome. Different subspecies are shown in different colors: P. e. obscurus (violet), P. e.

flavus (green), P. e. eunus (blue), P. e. alinea (cyan), and P. e. ash ssp. n. (red). One tree branch was truncated at dots.

stigma and by being paler and whiter on the ventral side of wings (Fig. 45a) instead of yellower in color.

In particular, palpi beneath, cheeks, area by ventral forewing costa at the wing base, forewing apex, and

hindwing overall are whiter (and wing venter redder) than in P. e. alinea, which is yellower (Fig. 45b).

Dorsal hindwing by the apex is usually less dark, and dark scales by the costa are confined mostly to the

base. Definitive identification is provided by DNA, and a combination of the following characters is

diagnostic in the nuclear genome: aly1022.2.1:G558A, aly1781.2.2:C384T, aly1781.2.2:G444A, aly4645.18.

2:C183T, aly4645.18.2:T213A and in COI barcode can be distinguished from other subspecies, except

Pseudocopaeodes eunus obscurus Austin & J. Emmel, 1998 (type locality in USA: Nevada, Carson City):

A214A, T220C, A484A, T514T, 604C.

Barcode sequence of the holotype. Sample NVG-21049E06, GenBank OR837738, 658 base pairs:

AACTTTATATTTTATTTTTGGTATCTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATAGT

ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCAGATATAGCTTTCCCACGAA

TAAATAATATAAGATTTTGAATATTACCCCCATCATTAATATTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGTTGAACTGTTTATCCTCCTTTATCTTCTAATATTGC

TCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCA

TTTGACCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCTTTATTATTATTATTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACCT

CTTTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: & deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida

Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 45a, bears four labels, 1%

handprinted others printed: three white [ASH MEADOWS | NYE CO. NEV. | 2 SEPT. 1989 |

Nick V. Grishin ], and one red [ HOLOTYPE co | Pseudocopaeodes | eunus ash Grishin |. Paratypes:

20h 292 same locality as the holotype: 2ch'ch' 6-Sep-1987, P. Savage colln. (NVG-22076F04 and NVG-

22076F05) [MGCL], 12 7-Sep-1988, P. Savage leg. (NVG-21049E07) [MGCL], and 19 12-Aug-1984 G.

T. Austin leg. (NVG-20063G12, CSU_ENT1028906) [CSUC].

Fig. 45. Holotypes of Pseudocopaeodes: a) P. eunus ash ssp. n. (data in text) and b) P. eunus alinea NVG-19061F04 USA:

CA, San Bernardino Co., Afton Canyon, 9-Sep-1965, Oakley Shields leg. [LACM] in dorsal (left) and ventral (right) views.

Type locality. USA: Nevada, Nye Co., Ash Meadows.

Etymology. The name is given for the type locality and the ashier appearance: paler, whiter, ventrally

dusted with white compared to other subspecies. The name is treated as a masculine noun in apposition.

Distribution. Southern Nevada; known only from the Ash Meadows area.

Comments. First, we note that where P. eunus is double-brooded, the two broods differ in appearance.

The first one produces darker specimens with broader dark-framed veins and more conspicuous two pale

rays of the ventral hindwing, thus having a classical P. eunus appearance. The second brood produces

paler specimens. Therefore, wing patterns within the broods should be compared between populations to

reach meaningful conclusions. Second, we see that genetic differentiation between the two subspecies

Pseudocopaeodes eunus obscurus Austin & J. Emmel, 1998 (type locality in USA: Nevada, Carson City)

and Pseudocopaeodes eunus flavus Austin & J. Emmel, 1998 (type locality in USA: Nevada, Churchill

Co.) is limited compared to others (Fig. 44), suggesting that they are not particularly distinct from each

other, despite their phenotypic difference in wing patterns. Thus, wing patterns can differ with very few

genetic changes. Third, we observe the genetic similarity between the lectotype of Copaeodes wrightii W.

H. Edwards, 1882 (type locality USA: California, San Bernardino Co., nr. Victorville) currently treated as

a junior subjective synonym of the nominal P. eunus and the type series of Pseudocopaeodes eunus alinea

J. Scott, 1981 (type locality USA: California, San Bernardino Co., Afton Canyon) (Fig. 44). While

additional analyses are required, it may be that C. wrightii is not a synonym of P. e. eunus, but instead is a

valid subspecies and the same taxon as P. e. alinea, with the latter being its junior subjective synonym.

Pamphila milo W. H. Edwards, 1883 is a junior subjective synonym

of Ochlodes agricola verus (W. H. Edwards, 1881)

The holotype of Pamphila milo W. H. Edwards, 1883 was stated to be from “Mt. Hood, Oregon”, and

later from Thurston Co., Washington, where this species is not known to occur (Pelham 2008; Pelham

2023). Genomic analysis of the holotype (NVG-15036C12) places it within specimens of Ochlodes

agricola verus (W. H. Edwards, 1881) (type locality USA: California, Kern Co., Havilah) from Kern Co.,

California that include the lectotype of the latter

Ochlodes agricola agricola|20063F05|Mexico:BC|1970

Ochlodes agricola agricola|20063F06|Mexico:BC|1970

(NVG-15096F09) (Fig. 46). Therefore, we propose

that Pamphila milo W. H. Edwards, 1883 is a junior

subjective synonym of Ochlodes agricola verus (W.

H. Edwards, 1881), and not of Ochlodes agricola

nemorum (Boisduval, 1852) (type locality in USA:

California, Plumas Co.) as currently treated. While

sequencing of additional specimens of Ochlodes

agricola (Boisduval, 1852) (type locality in USA:

California, Marin Co.) for population analysis is

needed for confident conclusions, our phylogenetic

Ochlodes a. agricola (=yreka)|15098B03|HT|USA:CA,S.Fran. Co.|old

Ochlodes agricola agricola|PAO338|USA:CA, Stanislaus Co.|2017

Ochlodes agricola agricola|20063E12|USA:CA, Stanislaus Co.|1970

Ochlodes agricola agricola|PAO339|USA:CA, Stanislaus Co.|2017

Ochlodes agricola agricola|20063E09|USA:CA,San Benito Co.|2006

Ochlodes agricola agricola|20063E11|USA:CA,Monterey Co.|2003

Ochlodes agricola agricola|20063E08|USA:CA,Sonoma Co.|2013

Ochlodes agricola agricola|PAO401|USA:CA,Sonoma Co.|2017

Ochlodes agricola agricola|20063E10|USA:CA,Mendocino Co.|2013

Ochlodes agricola nemorum|20063F02|USA:CA,Sierra Co.|2005

Ochlodes agricola nemorum|21049B06|USA:CA,Plumas Co.|1997

Ochlodes agricola nemorum|21049B07|USA:CA, Shasta Co.|2002

Ochlodes agricola nemorum|PAO23|USA:CA, Sierra Co.|2016

Ochlodes agricola verus|20063F01|USA:CA, Tulare Co. bead,

Ochlodes agricola verus|20063F03|USA:CA, Tulare Co.|20

Ochlodes agricola verus (=milo) [not fanoranit soaeBUN HOSES

Ochlodes agricola verus|20063D01|USA:CA,Kern Co.|2005

Ochlodes agricola verus|15096FO09|LT|USA:CA, Kern Co.|old

Ochlodes agricola verus|20063F04|USA:CA,Kern Co.|2006

. The nuclear genome tree (autosomes) of Ochlodes

analysis tentatively suggests that the type locality of | agricola subspecies: O. a. agricola (blue), O. a. nemorum

P. milo might have been in Kern Co., California, (green), Menu ores i ce a

possibly even “Havilah”’, together with O. a. verus. ee - nmi

Hesperia amanda P\é6tz, 1883 is a nomen dubium

Suggested as a probable variation of Hesperia ottoe W. H. Edwards, 1866 (type locality in USA: Kansas)

by Godman (1907) and placed as a junior subjective synonym of Ochlodes sylvanoides napa (W. H.

Edwards, 1865) (type locality in USA: Colorado, Clear Creek Co.) by Evans (1955), Hesperia amanda

Pl6tz, 1883 (type locality not stated and unknown) was described in an identification key from at least one

male with a forewing length of 13 mm (Plétz 1883). Relevant parts of the key are translated and

combined here as: “Upperside reddish-yellow. Forewing with a diagonal, wide, dark brown stigma that

starts broad in cell 1 and narrows in cell 3, and a

brown longitudinal spot in cell 5. Forewing margin

widely brown. Hindwing margin less _ wide,

especially on the inner margin, narrow and pale

brown. Hindwing underside reddish-yellow with a

faded yellow band”. Published on plate 180 (row 1,

images 4 and 5 from the left) illustration of H.

amanda in Draudt (1921-1924) (Fig. 47) is,

according to our reading of Evans (1955), paler than

inspected by Evans copy of Plétz’s original drawing U

tlafel]. 617. Indeed, Draudt’s illustration agrees well : $ | |

with the original description and likely reflects the | _ an 4. 2 a mand:

appearance of this species. In our opinion, H. amanda

amanda is conspecific neither with H. ottoe nor with | Fig. 47. Hesperia amanda trom pl. 1801 [4, 5] in Draudt

O. s. napa largely because the stigma in H. amanda (1921-1924), a paler copy of Pl6tz’s unpublished drawing.

extends into cell 3 (1.e., M3-CuA1), forewing brown streak distad of the discal cell is confined to the cell 5

(i.e., Mi-Mz2), and the inner margin of dorsal hindwing is only narrowly brown, with a paler-brown outer

margin by the tornus. These characters do not match the former two species. The stigma reaches into cell

3 in many Indo-Australian Hesperiidae, but we are not able to associate H. amanda with any species

known to us. Therefore, we propose to treat this name as nomen dubium, pending further research.

Ochlodes napa (W. H. Edwards, 1865) and Ochlodes santacruza J. Scott, 1981

are Species distinct from Ochlodes sylvanoides (Boisduval, 1852)

Genomic analysis of specimens identified as Ochlodes sylvanoides (Boisduval, 1852) (type locality in

USA: California, Plumas Co.) reveals their partitioning into three prominent clades genetically

differentiated at the level typical for distinct species (Fig. 48 green, red with magenta, and blue). The first

clade (Fig. 48 green) corresponds to populations from the Islands of the California coast: Santa Cruz

Island and Santa Catalina Island. The senior name for these populations is Ochlodes sylvanoides

santacruza J. Scott, 1981 (type locality USA: California, Santa Barbara Co., Santa Cruz Island). The

second clade (Fig. 48 red and magenta, two clades in mitochondrial genome tree Fig. 48b, likely due to

introgression) includes populations from the eastern part of the range (Colorado, southeastern Utah, and

Arizona) and is currently represented by one name, Ochlodes sylvanoides napa (W. H. Edwards, 1865)

a Ochlodes santacruza santacruza [not sylvanoides]|22038H08|PT|CA,Santa Cruz Is.|1967 b mito Ochlodes santacruza santacruza [not sylvanoides]|22038H08|PT|CA, Santa Cruz Is.

Ochlodes santacruza santacruza [not sylvanoides]|22097HO5|PT|CA, Santa Cruz Is.|1979 ,Qchlodes santacruza santacruza [not sylvanoides]|22097H11|CA, Santa Cruz Is.|1978

nuclear

Ochlodes santacruza santacruza [not sylvanoides]|22097HO6|PT|CA, Santa Cruz Is.|1979

Ochlodes santacruza santacruza [not sylvanoides]|22097H08|CA, Santa Cruz Is.|1978

Ochlodes santacruza santacruza [not sylvanoides]|22097H11|CA,Santa Cruz Is.|1978

Ochlodes santacruza santacruza [not sylvanoides]|22097H04|PT|CA,Santa Cruz Is.|1979

Ochlodes santacruza catalina [not sylvanoides]|19061E07|HT|CA,Santa Catalina Is.|1981

Ochlodes santacruza catalina [not sylvanoides]|21049C05|CA, Santa Catalina Is.|1940

Ochlodes santacruza catalina [not sylvanoides]|22097H01|CA,Santa Catalina Is.|1981

Ochlodes santacruza catalina [not sylvanoides]|22076F12|PT|CA, Santa Catalina Is.]1970

Ochlodes santacruza catalina [not sylvanoides]|22098A01|PT|CA,Santa Catalina Is.|1981

Ochlodes santacruza catalina [not sylvanoides]|19061E08|AT|CA,Sta Cat. Is.|1981

Ochlodes santacruza catalina [not sylvanoides]|22076F11|PT|CA,Santa Catalina Is.|1978

Ochlodes napa napa [not sylvanoides]|PAO263|USA:CO,Larimer Co.|2016

Ochlodes napa napa [not sylvanoides]|15098B02|NT|CO,Clear Creek Co.|old

Ochlodes napa napa [not sylvanoides]|20045F10|USA:UT,San Juan Co.|2020

Ochlodes napa napa [not sylvanoides]|20045FO9|USA:UT,Grand Co.|2016

Ochlodes napa kaibab|21113C07|HT|USA:AZ,Coconino Co.|2021

Ochlodes napa kaibab|21113C06|PT|USA:AZ,Coconino Co.|2021

Ochlodes sylvanoides sylvanoides|20063G05|USA:CA, Tulare Co.|2012

Ochlodes sylvanoides sylvanoides|PAO931|USA:CA,Plumas Co.|2019

Ochlodes sylvanoides sylvanoides|20063G07|USA:CA, Santa Clara Co.|1970

Ochlodes sylvanoides bonnevilla|22076G04|USA:NV,Elko Co.|1998

Ochlodes sylvanoides sylvanoides|22094E01|USA:CA,Santa Cruz Co.|2001

Ochlodes sylvanoides sylvanoides|22101H06|USA:CA,Santa Cruz Co.|1982

Ochlodes sylvanoides sylvanoides|22094D11|USA:CA, Santa Cruz Co.|2001

Ochlodes sylvanoides orecoasta|21049C01|USA:OR,Clatsop Co.|1993

Ochlodes sylvanoides orecoasta|21049B12|USA:OR,Clatsop Co.|1993

Ochlodes sylvanoides orecoasta|19061E06|HT|USA:OR,Clatsop Co.|1966

Ochlodes sylvanoides omnigena|21049C03|USA:NV,Lander Co.|1998

chlodes santacruza santacruza [not sylvanoides]|22097H04|PT|CA,Santa Cruz Is.

2x Ochlodes santacruza santacruza[not sylvanoides]|22097H06|PT|CA, Santa Cruz Is.

Qchlodes santacruza santacruza [not sylvanoides]|22097H05|PT|CA, Santa Cruz Is.

Ochlodes santacruza santacruza [not sylvanoides]|22097H08|CA, Santa Cruz Is.|1978

Ochlodes santacruza catalina [not sylvanoides]|22076F11|PT|CA,Santa Catalina Is.

Ochlodes santacruza catalina [not sylvanoides]|22076F12|PT|CA,Santa Catalina Is.

Ochlodes santacruza catalina[not sylvanoides]|19061E08|AT|CA,Sta Cat. Is.

\fichlodes santacruza catalina (not sylvanoides}|22098A01|PT|CA, Santa Catalina Is.

chlodes santacruza catalina [not sylvanoides]|19061E07|HT|CA,Santa Catalina Is.

Ochlodes santacruza catalina [not sylvanoides]|21049C05|CA, Santa Catalina Is.|1940

Ochlodes santacruza catalina [not sylvanoides]|22097H01|CA,Santa Catalina Is.|1981

<Qchlodes napa napa [not sylvanoides]|20045F09|USA:UT,Grand Co.|2016

iQchlodes napa napa [not sylvanoides]|20045F 10|USA:UT,San Juan Co.|2020

ape oges napa napa [not sylvanoides]|PAO263|USA:CO,Larimer Co.|2016

chlodes napa napa [not sylvanoides]|15098B02|NT|CO,Clear Creek Co.|old

Qghlodes napa kaibab|21113C07|HT|USA:AZ,Coconino Co.|2021

Ochlodes napa kaibab|21113C06|PT|USA:AZ,Coconino Co.|2021

Ochlodes sylvanoides sylvanoides|PAO931|USA:CA,Plumas Co.|2019

Ochlodes sylvanoides orecoasta|21049B12|USA:OR,Clatsop Co.|1993

'P°Ochlodes sylvanoides orecoasta|19061E06|HT|USA:OR,Clatsop Co.|1966

sk chlodes sylvanoides orecoasta|21049C01|USA:OR,Clatsop Co.|1993

Q¢hlodes sylvanoides sylvanoides|20063G07|USA:CA, Santa Clara Co.|1970

Ochlodes sylvanoides sylvanoides|22094D11|USA:CA,Santa Cruz Co.|2001

enone sylvanoides omnigena|21043CO03|AT|USA:NV,Lander Co.|1978

, Ochlodes sylvanoides omnigena|15038B06|HT|USA:NV,Lander Co.|1978

Qenioces sylvanoides sylvanoides|22094E01|USA:CA,Santa Cruz Co.|2001

chlodes sylvanoides sylvanoides|22101H06|USA:CA,Santa Cruz Co.|1982

Ochlodes sylvanoides sylvanoides|20063G05|USA:CA, Tulare Co.|2012

Ochlodes sylvanoides omnigena|15038B06|HT|USA:NV,Lander Co,.|1978 °Ochlodes sylvanoides bonnevilla|22076G04|USA:NV,Elko Co.|1998

Ochlodes sylvanoides sylvanoides (=francisca)|21116A05|ST|"Mexico"|old Ochlodes sylvanoides bonnevilla|19061E04|HT|USA:NV,Elko Co.|1966

Ochlodes sylvanoides omnigena|21043CO3|AT|USA:NV,Lander Co.|1978 [ Ochlodes sylvanoides sylvanoides (=francisca)|21116A05|ST|"Mexico"|old

Ochlodes sylvanoides bonnevilla|22076G03|USA:NV,Elko Co.|1980 sdchlodes sylvanoides bonnevilla|22076G03|USA:NV,Elko Co.|1980

Ochlodes sylvanoides bonnevilla|19061E04|HT|USA:NV,Elko Co.|1966 0.007 Ochlodes sylvanoides omnigena|21049C03|USA:NV,Lander Co.|1998

Fig. 48. Phylogenetic trees of selected Ochlodes species, including O. santacruza (green) and O. napa with its subspecies O. n.

napa (red) and O. n. kaibab ssp. n. (magenta), and O. sy/vanoides (blue) inferred from protein-coding regions of a) the nuclear

(autosomes) and b) the mitochondrial genome.

(type locality in USA: Colorado, Clear Creek Co.). The third clade (Fig. 48 blue) comprises all other

populations (Oregon, mainland California, Nevada) and includes the nominotypical subspecies O.

sylvanoides sylvanoides. Fst/Gmin/COI barcode difference among these clades are: 0.43/0.003/2.1% (14

bp) (O. s. sylvanoides vs. O. s. napa), 0.33/0.01/1.7% (11 bp) (O. s. sylvanoides vs. O. s. santacruza), and

0.54/0.008/2.6% (17 bp) (O. s. napa vs. O. s. santacruza). Therefore, we propose that Ochlodes napa (W.

H. Edwards, 1865), stat. rest. and Ochlodes santacruza J. Scott, 1981, stat. nov. are species distinct from

Ochlodes sylvanoides (Boisduval, 1852) and form a new species-subspecies combination: Ochlodes

santacruza catalina J. Emmel & T. Emmel, 1998, comb. nov.

Ochlodes napa kaibab Grishin, new subspecies

http://zoobank. org/OCF5A2B5-E6B9-460A-999F-S500EFEFE3921

(Figs. 48 part, 49)

Definition and diagnosis. Genomic sequencing reveals that specimens of Ochlodes napa (W. H.

Edwards, 1865), stat. rest. (type locality in USA: Colorado, Clear Creek Co.) from the southwestern part

of the range are genetically differentiated from the rest (Fig. 48) with the COI barcode difference of 2.0%

(13 bp). This difference is large because they possess mitochondrial genomes (and therefore COI

barcodes) more similar to Ochlodes sylvanoides (Boisduval, 1852) (type locality in USA: California,

Plumas Co.) than to O. napa (Fig. 48b). Due to this genetic differentiation, these populations from

Coconino Co. in Arizona represent a distinct taxon that currently does not have a name and therefore is

new. We consider it to be a subspecies of O. napa because genetic differentiation in the nuclear genome is

not prominent (Fig. 48a), and we are not aware of this new taxon being sympatric with O. napa. This new

subspecies is characterized by a darker appearance, sharper edges of brown areas likely caused by reduced

fulvous overscaling over the brown areas, especially near their edges (e.g., the brown spot distad of the

discal cell on forewing), and submarginal spots in cells Mi-M2 and Mo2-Ms3 are better separated from

fulvous areas of the forewing. Its females tend to have more developed fulvous areas in the forewing

Fig. 49. Ochlodes napa kaibab ssp. n. in dorsal (above) and ventral (below) views, data in text:

a) holotype @ NVG-21113C07 and b) paratype ? NVG-21113C06.

discal cell and wing bases above. Due to extensive phenotypic variation, definitive identification is

provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome:

aly1500.7.2:A162T, aly1500.7.2:T170A, aly3598.15.2:G447A, aly3598.15.2:C459T, aly378.20.4:A390G

and in COI barcode: A217A, A256C, T439C, T505C, T583T, T616C.

Barcode sequence of the holotype. Sample NVG-21113C07, GenBank OR837739, 658 base pairs:

AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTAT TAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACT

ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGT TCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAA

TAAATAATATAAGCTTTTGAATATTACCTCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTATATCCTCCTTTATCTTCTAATATTGC

TCACCAAGGATCTTCTGTTGATT TAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTCTAGGAGCTATCAATTTTATTACAACAATTATTAATATACGAATTAAAAACTTATCA

TTTGATCAAATACCCTTATTCGTATGATCAGTAGGTATTACAGCATTATTATTATTATTATCTTTACCTGTCTTAGCAGGTGCTATTACAATATTACTTACTGATCGAAATTTAAATACTT

CTTTTTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: co deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida

Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 49a, bears four printed

labels: three white [ South Canyon Spring | Kaibab Plateau, AZ | 30 July 2021 | Robb Hannawacker ],

Grishin ], and one red [ HOLOTYPE o& Ochlodes napa | kaibab Grishin ]. Paratype: 1° same data as the

holotype (NVG-21113C06) (Fig. 49b).

Type locality. USA: Arizona, Coconino Co., Kaibab Plateau, South Canyon Spring.

Etymology. The name is a noun in apposition taken from the type locality of this species.

Distribution. Northern Arizona, USA. Populations in southeastern Utah are the nominal subspecies, and

those in southwestern Utah should be studied to determine their identity.

Lectotype designation for Hesperia erratica Pl6tz, 1883

Hesperia erratica Plotz, 1883 (type locality in Guatemala), currently a junior subjective synonym of Lon

zabulon (Boisduval & Le Conte, [1837]) (type locality in North America, possibly USA: Georgia), was

described from an unstated number of specimens from Guatemala (Pl6tz 1883). One specimen, shown in

Fig. 50a, is curated in the MFNB collection as a syntype of H. erratica. We determine that this specimen

is indeed a syntype. First, it agrees with the original description, which we translate as: “Yellow on both

sides, all wings dark at the base and outer margin. Hindwing underside straw-yellow, at the base pale-

brown with yellow spot, cell 1b is overscaled with pale-brown. Three such spots are in an oblique line in

cell lc, 2, and 3, one spot in the discal cell near the brown base, and a patch in the corner of cell 6. In cell

7 at the apex, there is a small brown spot, like the previous ones, and in cell 6, the narrow uneven border

begins, ending at vein 1b. Upperside dark-yellow, forewing with brown-powdered [refers to the following

list], the apical spots ending at the costal margin, such long spot in cells 4 and 5, and a dark brown cross

vein. Hindwing with a brown costal margin, narrow in cells 4 and 5, then rapidly widening outer border,

and a broad inner margin. Fringes of the forewing light brown, and of the hindwing yellow.” The

description does not mention a diffuse discal spot in hindwing cell 5 (1.e., Mi-Mz2) beneath, present in the

syntype, but all its other characters are in very good agreement with the description.

Second, according to its labels, this candidate syntype specimen from the Weymer collection was

seen by Plétz, who identified it at the time as “zabulon Bd.” (“best[immt]. v[on]. Pl6étz’). Subsequently,

Pl6tz likely changed his mind because, in his publication with the key describing H. erratica, he placed it

after his “zabulon”’, which was actually Lon hobomok (T. Harris, 1862) (type locality in USA:

Massachusetts) (Pl6tz 1883). This is also corroborated by the opinion of Godman (1907), who inspected

the original Plétz drawings of “zabulon” (t[afel]. 655) “from Buffalo” and concluded that they “represent

A. hobomok.” Thus, Pl6tz’s “zabulon” was L. hobomok, and Pl6tz probably proposed the name erratica

for the true L. zabulon, represented by this specimen, after he realized that two species were involved (see

specimen labels below). Third, the specimen bears a label with “Erratica Plotz il.” in Weymer’s

handwriting, meaning that this name was given to Weymer by Pl6tz before publication of the name

(therefore “1. I.”, for “in litteris”). Fourth, Godman (1907), who inspected Plétz original drawing of H.

erratica (tlafel]. 656), identified it as male “Atrytone zabulon” in accord with the identity of the syntype.

We were not able to find other syntypes, and to stabilize nomenclature, N.V.G. hereby designates

the sole syntype in the MFNB collection, a male with the following seven printed (but 2", 3", and 4"

handwritten) labels, the 1‘ red and others white: [ Typus ], [ zabulon Bd. | n° 92 best. v. Plétz | ist mogl

| {QR Code} http://coll.mfn-berlin.de/u/ | 44a0bc |, and [ DNA sample ID: | NVG-18052B03 | c/o Nick V.

Grishin | as the lectotype of Hesperia erratica Plétz, 1883. The last two lines on the 2™ label are

abbreviated and should read “n® 92 bestimmt von Pl6tz | ist méglicherweise andere Art’, which we

translate as “n® 92 identified by Pl6tz | is possibly a different species”, an indication that Plétz would

change his opinion about the determination of this specimen as “zabulon.” The COI barcode sequence of

H. erratica lectotype, sample NVG-18052B03, GenBank OR837740, 658 base pairs, is:

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTCTTAGATTACTAATTCGAACTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACT

ATCGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTCTTATACTAGGAGCTCCTGATATAGCATTTCCACGAA

TAAATAACATAAGATTTTGATTATTACCTCCATCATTAACATTATTAATTT CAAGAAGAATTGTCGAAAATGGTGCTGGTACTGGATGAACAGTTTACCCCCCTTTATCAGCAAATATTGC

TCACCAAGGTTCTTCCGTAGATT TAGCAATCTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAACTTTAT TACAACAATTATTAATATACGAATTAGAAATTTATCT

TTTGATCAAATACCATTATTTATTTGAGCTGTAGGAATTACAGCATTATTATTACTACTTTCTTTACCTGTT TTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATT TAAATACAT

CTTTCTTTGACCCAGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT

brrahite Mof. ve fel? ra http://coll.mfn-berlin.de/u/

tal Lib Gusfenet Bertie 44a0bc

wae Ss 8

ee. went — ane

5 Yu

3 S

6 2

—~ oy

DNA sample ID:

NVG—18052B03

c/o Nick V. Grishin

1cm

Fig. 50. Primary type specimens of Lon in dorsal (left) and ventral (right) views, data in text: a) lectotype of Hesperia erratica,

which is a specimen of Lon zabulon; b) holotype of Lon co sp. n.; and c) holotype of Lon ma sp. n. Larger scale bar refers to

specimens and smaller scale bar refers to labels, which are reduced in half compared to specimens.

Hesperia erratica Plétz, 1883 (type locality in the USA, not Guatemala) is confirmed

as a junior subjective synonym of Lon zabulon (Boisduval & Le Conte, [1837])

Genomic tree of specimens identified as Lon zabulon (Boisduval & Le Conte, [1837]) (type locality in

North America, possibly USA: Georgia) reveals that the lectotype of Hesperia erratica Plétz, 1883 (type

locality in Guatemala, sequenced as NVG-18052B03, Fig. 50a) is in the clade with specimens from the

USA (Fig. 51 violet) and not with specimens from Mexico and Central America, including El Salvador

and Costa Rica (Fig. 51 blue, a species different from L. zabulon, see below). Therefore, we confirm H.

erratica aS a junior subjective synonym of L. zabulon but propose that its type locality given as

‘Guatemala’ in the original description and on the lectotype labels was erroneous and should be corrected

to the USA. Sequencing of L. zabulon specimens across the range will allow us to determine the type

locality more precisely.

Even from the wing patterns of the lectotype, as also hinted in the original description of H.

erratica, it is more likely to be from the United States than Guatemala. First, orange-yellow on the dorsal

forewing is more extensive than in Central American specimens, i.e., the triplet of subapical spots is

connected to the doublet of submarginal spots (Fig. 50a), while in Central American specimens, they are

typically well-separated from each other (Fig. 50b). This character is also described for H. erratica by

Pl6tz (1883) as a “long spot in cells 4 and 5”, meaning that there is a yellow background (1.e., “upperside

dark-yellow’’) that is formed by subapical and submarginal yellow spots together with the rest of the wing

(except the marginal brown border) and there is a separate brown spot on this background. Instead,

specimens from Central America would be described as having 3 yellow subapical and 2 submarginal

spots on a brown background by the apex. Second, the ventral hindwing brown border by the outer

margin is described by Pl6tz as “narrow uneven” (Fig. 50a), which is more typical for specimens from the

US. This border is usually broader and more even in Central American specimens (Fig. 50b).

Looking more into the discrepancy about the type locality, we find that only two species of

Hesperiidae proposed by Pl6tz have the type locality listed as “Guatemala.” In addition to H. erratica, the

second one is Achlyodes gorgona Pl6tz, 1884, a junior subjective synonym of Gesta invisus (Butler & H.

Druce, 1872). A possible syntype of A. gorgona is from the Méschler collection (now in MFNB). It was

collected in Guatemala in 1884 according to its dedicated locality/collector/date green label, which is

likely correct. The type(s) of H. erratica would have been from an earlier collection event because the

name was published in 1883. Moreover, unlike A. gorgona, it lacks a dedicated locality label. Therefore,

it is unclear whether the type locality in Guatemala is accurate for H. erratica. Localities for the

Specimens collected in the US were known to be incorrect or missing. At least two mistakes have been

documented. First, Goniloba parumpunctata Herrich-Schaffer, 1869 (type locality not stated in the

original description, but later assumed to be in South America, possibly Venezuela), which is a junior

subjective synonym of Lerema accius (J. E. Smith, 1797) (type locality in USA: Georgia) had the locality

of the lectotype (male) and at least one female paralectotype deduced to be in eastern US by genomic

sequence comparison (Zhang et al. 2023a). Second, Pyrgus argina Pl6étz, 1884 (type locality given as

“Brisbane” [Australia]), which is a junior subjective synonym of Amblyscirtes hegon (Scudder, 1863)

(type locality in USA: New Hampshire, White Mountains), is only known from the USA (Evans 1949).

Lon zabulon|20059G01|USA:MD

dogn zabulon|9209|USA:AR

bon zabulon (=erratica)|18052B03|LT

Lon zabulon|SAMN18587728|USA:FL

Lon co|22056F05|PT|Mexico:Tam

son co|18115B03|HT|Mexico:Gro

Lan co|22056E08|PT|Mexico:Oax

iposton co|18115B04|PT|Mexico:Oax

Loon co|18115B02|PT|Mexico:Pue

idgon co|19068D12|PT|Mexico:Ver

5 gon co|18115B05|PT|Mexico:Chia

Lon co|18115B06|PT|EI Salvador

Lon co|18115B07|PT|Costa Rica

Lon ma|18115B09|HT|Panama|1976

Lon ma|18115B08|PT|Panama|1981

“y, Lon zabulon|20059G01|USA:MD,Montgomery Co.|1999 b

2z— Lon zabulon|SAMN18587728|USA:FL,Alachua Co.

Lon zabulon|9209|USA:AR,Montgomery Co.|2017

Lon zabulon (=erratica)|18052B03|LT|USA|old

Lon co|18115B02|PT|Mexico:Pue|1975

Lon co|22056E08|PT|Mexico:Oax|1989

Lon co|18115B03|HT|Mexico:Gro|1982

Lon co|19068D12|PT|Mexico:Ver|1987

Lon co|18115B04|PT|Mexico:Oax|1992

Lon co|18115B05|PT|Mexico:Chia|1959

Lon co|22056F05|PT|Mexico:Tam|1965

Lon co|18115BO06|PT|E! Salvador|1972

Lon co|18115B07|PT|Costa Rica|1985

Lon ma|18115BO09|HT|Panama|1976

Lon ma|18115B08|PT|Panama|1981

Lon zabulon|SAMN18587728|USA:FL,Alachua Co.

Lon zabulon|9209|USA:AR,Montgomery Co.|2017

Lon zabulon (=erratica)|18052B03|LT|USA|old

Lon co|18115B02|PT|Mexico:Pue|1975

Lon co|22056E08|PT|Mexico:Oax|1989

Lon co|18115B03|HT|Mexico:Gro|1982

Lon co|19068D12|PT|Mexico:Ver|1987

Lon co|18115B05|PT|Mexico:Chia|1959

Lon co|18115B04|PT|Mexico:Oax|1992

Lon co|18115BO06|PT|EI Salvador|1972

Lon co|22056F05|PT|Mexico:Tam|1965

Lon co|18115B07|PT|Costa Rica|1985

Lon ma]18115B09|HT|Panama|1976

Lon ma|18115B08|PT|Panama|1981

0,002 0.002

Fig. 51. Phylogenetic trees of selected Lon species inferred from protein-coding regions of a) the nuclear genome (autosomes),

b) the Z chromosome, and c) the mitochondrial genome: L. zabulon (violet), L. co (blue), and L. ma (red). The sequence of

SAMN18587728 is taken from the alignment provided in Kawahara et al. (2023).

Lon co Grishin, new species

http://zoobank.org/AA859D 18-CFC6-47F8-9032-AB5B6D79EB69

(Figs. 50b, 51 part, 52)

Definition and diagnosis. Genomic trees of specimens identified as Lon zabulon (Boisduval & Le Conte,

[1837]) (type locality in North America, possibly USA: Georgia) reveal their partitioning into three

clades: from the USA, which is L. zabulon in accord with its phenotype and the type locality, and two

others that do not have names (Fig. 51). One of these clades consists of specimens from Mexico and

Central America (Fig. 51 blue) and differs from L. zabulon by Fst/Gmin/COI barcode of 0.49/0.01/3% (20

bp) thus representing a new species. This species differs from L. zabulon in reduced orange-yellow areas

on wings, e.g., broader brown borders and a smaller, disconnected triplet of subapical spots and a doublet

of submarginal spots on forewing; ventral hindwing with broader and more even outer border and larger

spots (Fig. 50b); the process of aedeagus is more robust (Fig. 52a, e-j). Definitive identification is

provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome:

aly596.8.5:A189G, aly596.8.5:A192T, aly806.32.1:T876C, aly806.32.1:A1101G, aly1097.21.1:G46A and in

COI barcode: T82C, G101A, T292C, C376T, T457C, T478C.

Barcode sequence of the holotype. Sample NVG-18115B03, GenBank OR837741, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGTACAGAATTAGGTAACCCTGGATCTTTAATTGGGAATGATCAAATTTATAATACT

ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCTGATATAGCTTTTCCTCGAA

TAAATAATATAAGTTTTTGAATATTACCCCCCTCACTAACATTATTAATCT CAAGAAGAATTGTAGAAAACGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTATCATCTAATATTGC

TCATCAAGGATCTTCAGTTGATT TAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATCATTAATATACGAAT TAAAAACTTAATG

TTTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATT TAAACACTT

CATTTTTTGATCCAGCAGGGGGAGGAGATCCAATTTTATATCAACACTTATTC

Type material. Holotype: & deposited the National Museum of Natural History, Washington, DC, USA

_—— s

4.4.2

Fig. 52. Genitalia of Lon co sp. n. paratypes, data in text: a-b) NVG-22056F05 complete genital capsule (right valva tilted

ventrad) and e—p) NVG-22056E08 partly disassembled: c) left valva, c) right valva, e-j) aedeagus, k) tegumen and uncus, I)

genital ring (uncus, tegumen, vinculum, and saccus rotated to align with the pane of the ring), m—p) juxta. Views: dorsal (a, e,

m), left lateral (b, f; n), ventral (g, k, 0), right ventrolateral (h), right lateral (c, d, 1), and posterior (j, 1, p). Directions: posterior

on the right (a, b, e-1, m—o), posterior on the left (c, d), posterior on top (k), dorsal on top (b, c, d, f, j, 1, n, p), ventral on top (i).

[USNM], illustrated in Fig. 50b, bears six printed labels: five white [ MEX:Guerrero, | 5-7 km NW |

(Boisduval & Le Conte) | & | det. J. M. Burns 1992 ], [ DNA sample ID: | NVG-18115B03 | c/o Nick V.

Grishin |], [ USNMENT | {QR Code} | 01531551 ], and one red [HOLOTYPE ¢& | Lon co | Grishin ].

Paratypes: 8¢'c: Mexico: Io Tamaulipas, 11 km NW Gomez Farias, 6 km W Rancho Cielo, el. 5200-

5500 ft, 9-Jul-1965, genitalia vial NVG231115-03 (NVG-22056F05) [TMMC]; 1o& Veracruz, 10 km W

Coscomatepec, el. 1800 m, 12-Aug-1987, Brown & Powell leg, genitalia vial J. M. Burns X-2953 (NVG-

19068D12, USNMENT 01559668) [USNM]; Ich Puebla, 6 mi N Chapulco, el. 7000', 4-Oct-1975, J.

Powell, T. Eichlin & T. Friedlander leg. (NVG-18115B02, USNMENT 01531550) [USNM]; Oaxaca, 5-

10 mi N of Oaxaca, el. 6000-7000 ft, J. Kemner leg.: 1h 22-Aug-1992 (NVG-18115B04, USNMENT

01531552) [USNM] and 1¢ 30-Aug-1989, genitalia vial NVG23 1115-02 (NVG-22056E08) [TMMC]; Ico

Chiapas, 12 km S of Las Casas, 26-28-Mar-1959, T. C. Emmel leg. (NVG-18115B05, USNMENT

01531553) [USNM]; 1o& El Salvador, 2 mi down from Cerro Verde summit, 20-Aug-1972, C. F. & S.

Hevel leg. (NVG-18115B06, USNMENT 01531554) [USNM]; Ic Costa Rica, Puntarenas Prov., Monte-

verde, el. 1300 m, 18-May-1985, J. A. Chemsak leg. (NVG-18115B07, USNMENT 01531555) [USNM].

Type locality. Mexico: Guerrero, 5—7 km NW of Taxco.

Etymology. The name is the last syllable of the country name of the type locality: [Mexi]co. The name is

a noun in apposition.

Distribution. Mexico to Costa Rica.

Lon ma Grishin, new species

http://zoobank.org/74F97D 16-BF2C-414A-B090-BEDAEED53343

(Figs. 50c, 51 part)

Definition and diagnosis. Genomic trees of specimens identified as Lon zabulon (Boisduval & Le Conte,

[1837]) (type locality in North America, possibly USA: Georgia) reveal their partitioning into three

clades: from the USA, which is L. zabulon in accord with its phenotype and the type locality, and two

others that do not have names (Fig. 51). One of these clades (Fig. 51 blue) is described as a new species

above. The second clade consists of specimens from Panama (Fig. 51 red) and differs from L. zabulon by

Fs/Gmin/COI barcode of 0.50/0.009/2.3% (15 bp) and from L. co sp. n. by 0.47/0.008/3.2% (21 bp), thus

representing a new species. This species differs from L. zabulon in being brighter colored and more

orange; the orange-yellow patch on dorsal hindwing smaller, more like a patch than the entire hindwing

being orange with brown borders, brown border wider; beneath brown spots larger; and from L. co sp. n.

in more extensive orange-yellow areas on the forewing, e.g., submarginal and subapical forewing spots

larger, on ventral side subapical triplet of spots more orange, like submarginal doublet, not yellower than

it; and the absence of pale ray along dorsal hindwing 1b vein that is usually expressed in L. co sp. n. and

L. zabulon. Definitive identification is provided by DNA, and a combination of the following characters is

diagnostic in the nuclear genome: aly525.115.3:G328A, aly2336.10.2:C108T, aly2336.10.2:G116A, aly923.

19.4:T246G, aly923.19.4:C393T and in COI barcode: T79C, T169C, T206C, A349G, A577G.

Barcode sequence of the holotype. Sample NVG-18115B09, GenBank OR837742, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGTACAGAATTAGGCAATCCTGGATCTTTAATCGGAGATGATCAAATTTATAACACT

ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTACCACTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAA

TAAATAATATAAGTTTTTGAATATTACCCCCTTCACTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTGTCATCTAATATTGC

TCATCAAGGATCCTCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTAATG

TTTGACCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATGTTACTTACTGATCGAAATTTAAATACTT

CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACACTTATTC

Type material. Holotype: & deposited in the National Museum of Natural History, Washington, DC,

USA [USNM], illustrated in Fig. 50c, bears four printed (date handwritten) labels: three white

18115B09 | c/o Nick V. Grishin |, [ USNMENT | {QR Code} | 01531557 |, and one red [ HOLOTYPE ¢&

| Lon ma | Grishin |. Paratype: 1c Panama, Chiriqui, Volcan Baru, el. 1759 m, GPS 8.683, —82.500, 14-

Feb-1981, G. B. Small leg. (NVG-18115B08, USNMENT 01531556) [USNM].

Type locality. Panama: Chiriqui, Volcan Bart, elevation ca. 1800 m.

Etymology. The name is the last syllable of the country name of the type locality: [Pana]ma. The name ts

a noun in apposition.

Distribution. Currently known only from Chiriqui, Panama.

Neotype designation for Cobalus vitellina Herrich-Schaffer, 1869

Cobalus vitellina Herrich-Schaffer, 1869 was described within the identification key from an unstated

number of specimens without locality data (Herrich-Schaffer 1869). The description was rather general

and can apply to several species. Our translation from German of relevant segments assembled from the

Herrich-Schaffer key is: “forewing cell 3 with a pale spot before its middle, discal cell unmarked;

hindwing above with three yellow spots in cells 3—5, on the underside with a continuous yellow band.”

Primary types for several names proposed in the same work are curated in MFNB. These types came from

the Herrich-Schaffer collection (label “Coll. H.—Sch.”) through the Staudinger collection (label “Coll.

Staudinger’) and frequently bear identification labels in Herrich-Schaffer handwriting. To confidently

infer the taxonomic identity of C. vitellina, we searched for such specimens in MFNB that agreed with the

original description. We were not able to find syntypes of C. vitellina and turned to additional resources,

such as publications and specimens collected around the time of C. vitellina description identified as this

Species or agreeing with the original description.

According to Godman (1907), Pl6tz illustrated “nearly all” species described by Herrich-Schdaffer.

While these drawings are not located to this day, Godman found specimens in his collection that, in his

opinion, matched each drawing closely and obtained drawing copies of species he could not identify

(1907). While there is no certainty that Plétz illustrated Herrich-Schaffer syntypes and not some other

Specimens determined by him or by Herrich-Schaffer to be these species, we use Ploétz’s (1883)

description of C. vitellina, which he placed in the genus Hesperia Fabricius, 1793 (type species Papilio

comma Linnaeus, 1758), to learn more about this taxon. Pl6tz’s description of his drawings (rather than

actual specimens) is more detailed than Herrich-Schaffer’s and gives “Mexico” as the locality. We

translate the description from German as: “Ventral side red-brown, forewing with basal half black,

hindwing infused with rust-red, past the middle with a distorted rust-yellow band, which in cell Ic

projects a ray towards the fringe. Dorsal side brown, forewing with deep red-yellow spots in cells 1-3 and

6-8; a small dot in cell 4. Hindwing with 3 yellow spots in cells 3—5 and yellow fringes. Antenna half as

long as the forewing.” Both this description and Godman’s (1907) assessment, which noted that Pl6étz

illustrated both a male and female from Mexico, agree with H. vitellina being either conspecific with or

closely related to Lon melane (W. H. Edwards, 1869) (type locality in USA: California). Moreover,

Draudt (1921-1924) frequently used (inferior) copies of Pl6étz’s drawings as illustrations (Nakahara et al.

2022), and his figures of melane (plate 182e) might be copied from Pl6tz’s H. vitellina, which Draudt

synonymized with L. melane. The dorsal side shows a female, which is either an atypical specimen or not

this species (instead reminding of Buzyges rolla (Mabille, 1883)) because the spots in cells M3-CuA, and

CuAj-CuA2 are nearly aligned with each other (in Lon species, these two spots do not overlap in most

Specimens), unless this is an imperfection of the reproduction from the original. The ventral side is of a

male and is identifiable as L. melane or its close relative.

Furthermore, we found two specimens of interest in MFNB. The first specimen (NVG-

21116G04), from the Mdéschler collection collected in Mexico in 1876 and identified by Méschler as

“vitellina’, agrees with all characters of this taxon presented above, except that the three spots on the

dorsal hindwing are barely visible. This specimen cannot be a syntype because it was collected after the

description of C. vitellina. The second specimen (NVG-22091C05) is from Herrich-Schaffer’s collection,

also from Mexico, and bears the identification label “marmorosa HS” in Herrich-Schaffer’s handwriting.

This specimen is one of those Godman (1900) mentioned within his treatment of “Atrytone melane” and

identified as such. It is probably not a syntype of C. vitellina either because it possesses four (or even

five), and not three, as per the original description, yellow spots on the dorsal hindwing. This is a boldly

patterned specimen with a very wide ventral hindwing orange-yellow band occupying nearly a third of the

wing area, and it is possible that Herrich-Schaffer viewed it as a new species that he planned to call

1cm

Fig. 53. Neotype of Cobalus vitellina Herrich-Schaffer, 1869 in dorsal (left) and ventral (right) views, data in text.

“marmorosa”’, a name that was never published. Nevertheless, both specimens (NVG-21116G04 and

NVG-22091C05) fall within the current concept of “Paratrytone melane vitellina” as outlined by Evans

(1955) and have not been questioned since (Mielke 2005).

Not finding syntypes, we proceeded with the neotype designation because there was an

exceptional need to clarify both the taxonomic identity and the type locality of C. vitellina. Although the

name has been consistently applied to the Mexican subspecies of L. melane, the potential for

destabilization of nomenclature arises due to the existence of additional species in this group in Mexico

and Central America (see below) unless the name C. vitellina is objectively defined by the neotype that

also provides details about the type locality. A number of Hesperiidae species from Mexico described in

the second half of the 19 century were likely based on specimens from Oaxaca, possibly collected by

Deppe in 1824—1829. Therefore, we selected a neotype from Oaxaca. Hereby, N.V.G. designates a

specimen in USNM illustrated in Fig. 53 (DNA sample NVG-18115F05) as the neotype of Cobalus

vitellina Herrich-Schaffer, 1869. This neotype corroborates the current application of the name for a

relative of L. melane from Mexico, as stated by Plotz (1883) and Godman (1907), supported by Evans

(1955), and followed since in all literature (Mielke 2005).

This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is

designated to clarify the taxonomic identity of Cobalus vitellina Herrich-Schaffer, 1869, which is

necessary because additional species are present among its close relatives, and to define the type locality

that was not stated in the original description; 75.3.2. The characters to differentiate this taxon from others

were given in the original description (Herrich-Schaffer 1869), further elaborated by Plétz (1883). We

regard them as follows: forewing brown with orange yellow spots in cells R3-R4, R4a-Rs, Rs-Mi, M3-CuAi,

CuAi-CuA2, and CuA2-1A+2A, and a dot in cell Mo-Ms3, discal cell unmarked; forewing beneath with

nearly black basal half; hindwing above brown with three yellow spots in cells Mi-M2, M2-M3, and M3-

CuA1; hindwing beneath rust-colored with a continuous orange-yellow band; antenna about half of the

forewing in length; 75.3.3. The neotype specimen is a male bearing three labels: [ MEXICO: OAXACA |

Nick V. Grishin |, [ USNMENT | {QR Code} | 01531599 | and illustrated in Fig. 53; the neotype has a

tear along SC vein from costa on the right forewing; 75.3.4. We carefully searched for syntypes of C.

vitellina in the MFNB collection (see above) because most of the Herrich-Schaffer Hesperiidae types are

in this collection, and a study by Hauser et al. (2003) did not locate the syntypes in Stuttgart. We also

checked the ANSP collection, where several Herrich-Schaffer types of Caribbean taxa are curated. We

failed to find syntypes of C. vitellina among Hesperiidae holdings in these collections and, therefore,

believe that they were lost; 75.3.5. The neotype closely agrees with the original description of C. vitellina

in all characters, as evidenced by comparing the neotype illustrated in Fig. 53 with the characters for this

taxon given in the original description (Herrich-Schaéffer 1869) and listed above (75.3.2.); 75.3.6. The

neotype is from Mexico: Oaxaca, ca. 3 mi E of La Trinidad, 8500 ft, and the type locality was not

specified in the original description but was stated as “Mexico” by Plétz (1883); 75.3.7. The neotype is in

the National Museum of Natural History, Washington, DC, USA (USNM). The COI barcode sequence of

C. ageete neotype: sample NVG-18115F05, GenBank OR837743, 658 base pairs, is:

AACCTTATATTTTAT TTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGAI ['TACTAATTCGTACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAACACT

ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTCCCATTAATATTAGGTGCCCCTGATATAGCTTTCCCCCGAA

TAAATAATATAAGTTTTTGAATATTACCCCCCTCATTAACATTATTAATTT CAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTATCATCTAATATTGC

ACACCAAGGCTCTTCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAAAAATTTAATG

TTTGATCAAATACCTTTATTCGTATGATCTGTAGGTATTACAGCCTTATTATTACTTTTATCTTTGCCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACTT

CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Lon melane melane|15039A05|LT|USA:CA

Lon melane melane|15039A05|LT|USA:CAl|old b Z-chr ¥ pepe aunts

on melane melane :

Lon melane melane|17111G12|USA:CA, Yolo Co.|1994

Lon melane melane|17111HO01|USA:CA,San Luis Obispo Co.|1994

Lon melane melane|22058D03|USA:CA,Los Angeles Co.|1987

Lon melane melane|22094E08|USA:CA,Los Angeles Co.|2009

Lon melane melane|22094E06|USA:CA,San Mateo Co.|1971

Lon melane melane|22094E09|USA:CA,Napa Co.|1977

Lon melane melane|22094E07|USA:CA,Madera Co.|1982

Lon melane sur|22101HO9|PT|Mexico:BCS|1941

Lon melane melane|22094E06|USA:CA,San Mateo Co. C tito

Lon melane melane|22094E09|USA:CA,Napa Co.|1977

Lon melane melane|22058D03|USA:CA,Los Angeles Co. gon melane melane|22094E06|USA:CA

Lon melane melane|22094E07|USA:CA,Madera Co. melane qyon melane melane|22094E09|USA:CA

Lon melane melane|22094E08|USA:CA,Los Angeles Co. ialarte Lon melane melane|17111HO1|USA:CA

a nuclear

melane

Lon melane melane|17111HO1|USA:CA,San Luis Obispo Co.

Lon melane sur|22101H10|HT|Mexico:BCS|1941

Lon melane sur|22101HO9|PT|Mexico:BCS|1941

Lon melane melane|15039A05|LT|USA:CA|old

Lon vitellina|20059C10|USA:TX,Brewster Co.

Lon vitellina|20063G11|Mexico:Dur|1981

Lon vitellina|20063G08|Mexico:Chih|1994

Lon vitellina|18115F04|Mexico:Hid|1990

Lon vitellina]18115F07|Mexico:Ver|1992

Lon vitellina]20063G09|Mexico:Coah|2003

Lon vitellina|19013A11|Mexico:NL|1979

Lon vitellina|21116G04|Mexico|1876

Lon vitellina]20063G10|Mexico:NL|2007

Lon vitellina|18115FO5|NT|Mexico:Oax|1992

Lon chia|18115F06|PT|Mexico:Chia|1988

Lon chia|18115F08|PT|Mexico:Chia|1992

Lon chia]22105HO5|HT|Mexico:Chia|1969

Lon chia|22056D01|PT|Mexico:Chia|1987

Lon chia|20062F09|PT|Mexico:Chia|1988

Lon chia|18115FO9|PT|EI Salvador|1972

Lon melane melane|22058D03|USA:CA

Lon melane melane|17111G12|USA:CA

sur Lgn melane sur|22101HO9|PT|Mexico:BCS

Lon melane sur|22101H10|HT|Mexico:BCS

Lon vitellina]18115F04|Mexico:Hid|1990

Lon vitellina|20063G08|Mexico:Chih|1994

Lon vitellina|18115F05|NT|Mexico:Oax|1992

Hion vitellina|20059C10|USA:TX, Brewster Co.

Lon vitellina]21116G04|Mexico|1876

Lon vitellina]19013A11|Mexico:NL|1979

ton vitellina|20063G11|Mexico:Dur|1981

Von vitellina|18115F07|Mexico:Ver|1992

Yon vitellina|20063G09|Mexico:Coah|2003

Lon vitellina|20063G10|Mexico:NL|2007

5¢0n Chia|18115F06|PT|Mexico:Chia|1988

son chia]20062F09|PT|Mexico:Chia|1988

Lon melane sur|22101H10|HT|Mexico:BCS|1941

Lon vitellina|20059C10|USA:TX,Brewster Co.|2005

Lon vitellina]21116G04|Mexico|1876

Lon vitellina]18115FO07|Mexico:Ver|1992

Lon vitellina]20063G10|Mexico:NL|2007

Lon vitellina|19013A11|Mexico:NL|1979

Lon vitellina|20063G08|Mexico:Chih|1994

Lon vitellina|20063G09|Mexico:Coah|2003

Lon vitellina]18115F04|Mexico:Hid|1990

Lon vitellina|20063G11|Mexico:Dur|1981

Lon vitellina]18115FO5|NT|Mexico:Oax|1992

Lon chia|18115FO6|PT|Mexico:Chia|1988

Lon chia|18115F08|PT|Mexico:Chia|1992

Lon chia|22056D01|PT|Mexico:Chia|1987

Lon chia|20062F09|PT|Mexico:Chia|1988

Lon chia|22105HO5|HT|Mexico:Chia|1969

Lon chia|18115FO9|PT|EI Salvador|1972

hon chia|18115F08|PT|Mexico:Chia|1992

9%,on chia|22056D01|PT|Mexico:Chia|1987

Lon chia]22105HO5|HT|Mexico:Chia|1969

Lon chia|18115FO9|PT|EI Salvador|1972

0.003

Fig. 54. Phylogenetic trees of selected Lon species inferred from protein-coding regions of a) the nuclear genome (autosomes),

b) the Z chromosome, and c) the mitochondrial genome. Different taxa are shown in different colors: L. melane (blue, with L.

melane sur ssp. n. in cyan), L. vitellina (violet), L. chia sp. n. (red), and L. poa (green). The names of new taxa by

corresponding tree branches are highlighted in yellow.

Lon vitellina (Herrich-Schiaffer, 1869) and Lon poa (Evans, 1955)

are Species distinct from Lon melane (W. H. Edwards, 1869)

Genomic trees reveal that Cobalus vitellina Herrich-Schaffer, 1869 (type locality in Mexico: Oaxaca) and

Paratrytone melane poa Evans, 1955 (type locality Costa Rica: Mount Pods), currently treated as

subspecies of Lon melane (W. H. Edwards, 1869) (type locality in USA: California, likely San Francisco

Bay area), are genetically differentiated from it at the species level (Fig. 54), e.g., Fst/Gmin/COI barcode

difference from L. melane of 0.57/0.002/3.2% (21 bp) for C. vitellina and 0.66/0.001/2.3% (15 bp) for P.

melane poa. TYherefore, we propose that Lon vitellina (Herrich-Schaffer, 1869), stat. rest. and Lon poa

(Evans, 1955), stat. nov. are species distinct from Lon melane (W. H. Edwards, 1869).

Lon melane sur Grishin, new subspecies

http://zoobank.org/A41D2EC4-85A8-4728-AD8E-233BF09A90DB

(Figs. 54 part, 55)

Definition and diagnosis. Genomic sequencing of the two specimens from Baja California Sur, Mexico,

identified as a possible subspecies or a distinct geographical segregate of “Paratrytone melane” in

previous works (Powell 1958; MacNeill 1962; Brown et al. 1992) reveals that they are indeed closely

related to Lon melane (W. H. Edwards, 1869) (type locality in USA: California, likely San Francisco Bay

area) (Fig. 54): e.g., their COI barcodes differ by 0.3—0.6% (2—4 bp), and, therefore, we consider them to

be conspecific with it. However, the BCS specimens differ from the nominotypical ZL. melane in reduced

fulvous overscaling at wing bases above, smaller orange spots on the forewing, more diffuse and

brownish instead of orange dorsal hindwing spots, and weakly spotted more uniformly colored ventral

hindwing. Therefore, they represent a distinct subspecies, which is new. A more detailed description of

this subspecies was given by MacNeill (1962: 110-111), who called it “Paratrytone melane subsp.”

without proposing a formal name. Definitive identification is provided by DNA, and a combination of the

following characters is diagnostic in the nuclear genome: aly770.31.1:A393C, aly3721.1.4:G45A, aly93.14.

4:C408T, aly322.23.3:A87G, aly65.5.1:T199C and in COI barcode: T56C, T379A, T418C, T530C, C646C.

Fig. 55. Holotype of Lon melane sur ssp. n. in dorsal (left) and ventral (right) views, data in text.

Barcode sequence of the holotype. Sample NVG-22101H10, GenBank OR837744, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGACTATTAATTCGTACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT

ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGT CCCATTAATATTAGGTGCCCCTGATATAGCTTTCCCTCGAA

TAAATAATATAAGTTTTTGAATACTACCCCCTTCATTAACATTATTAATTT CAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCTTTATCATCTAATATTGC

TCATCAAGGCTCTTCAGTTGATT TAGCAATCTTTTCACTTCATTTAGCTGGAATCTCATCTATTTTAGGAGCTATTAACTTTATTACAACAATTATCAATATACGAATTAAAAATT TAATG

TTTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCCCTATTATTACTTTTATCTTTACCCGTTTTAGCTGGAGCTATTACTATATTACTTACCGATCGAAATT TAAATACTT

CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material. Holotype: & deposited in the California Academy of Sciences, San Francisco, CA, USA

[CAS], illustrated in Fig. 55, bears eight labels: seven white [ La Laguna, | Sierra Laguna, | L.Cal.X-14-

| DNA sample ID: | NVG-22101H10 | c/o Nick V. Grishin |, [| {QR Code} CASENT | 8566940 |, and one

red [ HOLOTYPE oc | Lon melane | sur Grishin |. Paratype: Ic same data as the holotype (NVG-

22101H09, CASENT 8566939).

Type locality. Mexico: Baja California Sur, Sierra de La Laguna.

Etymology. The name, a masculine noun in apposition, is the last word in the type locality state name,

also meaning that this is the southernmost subspecies of L. melane.

Distribution. Mountains of the Cape region in Baja California Sur, Mexico.

Lon chia Grishin, new species

http://zoobank.org/E4498D7B-4A5E-44 1 1-9CB0-E336A A043 11F

(Figs. 54 part, 56)

Definition and diagnosis. The genomic tree reveals that specimens identified as Lon poa (Evans, 1955)

(type locality Costa Rica: Mount Poas), stat. nov. partition into two clades (Fig. 54). One clade includes

specimens from Costa Rica and Panama, being the true LZ. poa by locality and phenotype. The other clade

is genetically differentiated from the first one with Fs/Gmin/COI barcode difference of 0.41/0.004/0.9% (6

bp) and represents a new species. This species keys to “Paratrytone melane poa” M.23.1(c) in Evans

(1955) and is distinguished from the true L. poa by less extensive yellow overscaling on the ventral side

of wings, in particular, on the hindwing; this overscaling is whiter, and the ground color in redder and

browner than yellower. As a result, there is less contrast between the darker inner half and subapical half

of the ventral forewing, which is paler in the apical half and contrasting dark brown towards the inner

margin in L. poa. Definitive identification is provided by DNA, and a combination of the following

characters is diagnostic in the nuclear genome: aly3177.11.6:A36C, aly3177.11.6:A39G, aly128.24.1:

C189T, aly128.24.1:A235C, aly318.14.6:G672A and in COI barcode: T4C, T346C, TS505C, A550A, 586T.

Barcode sequence of the holotype. Sample NVG-22105H05, GenBank OR837745, 658 base pairs:

AACCTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGATTATTAATTCGTACAGAATTAGGTAATCCTGGATCTTTAAT TGGAGATGATCAAATTTATAACACT

ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGT CCCATTAATATTAGGTGCCCCTGATATAGCTTTCCCCCGAA

TAAATAATATAAGTTTTTGAATATTACCCCCCTCATTAACATTATTAATTT CAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTATCATCTAATATTGC

ACACCAAGGCTCTTCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAACTTTATTACAACAATTAT TAATATACGAAT TAAAAATTTAATG

TTTGATCAAATACCTTTATTCGTATGATCTGTAGGTATTACAGCCTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATT TAAATACTT

CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Dye

1cm

Fig. 56. Holotype of Lon chia sp. n. in dorsal (left) and ventral (right) views, data in text.

Type material. Holotype: & deposited in the California Academy of Sciences, San Francisco, CA, USA

[CAS], illustrated in Fig. 56, bears five labels, the first two handwritten, others printed: four white

| Rancho Belen, Chis. | Mex. IV-17-69 | Robert Wind ], [P. m. poa], [DNA sample ID: | NVG-

22105H05 | c/o Nick V. Grishin |, [ {QR Code} CASENT | 8568431 |, and one red [ HOLOTYPE @ |

Lon chia | Grishin ]. Paratypes: 5¢'ch 19: Mexico, Chiapas: 1o& Comitan, Laguna Chamula, el. 7100 ft,

13-May-1987, C. J. Durden leg. (NVG-22056D01) [TMMC]; San Cristobal, La Almolonga, ca. 7500 ft:

Ilo 3-May-1988, J. Kemner leg. (NVG-18115F06, USNMEND 01531600) [USNM]; 1c 9-Jul-1988, C. J.

Durden leg. (NVG-20062F09) [TMMC]; Io 5-Jul-1992, J. Kemner & A. Vasquez leg. (NVG-18115F08)

[USNM]; 1o& Guatemala, Quiche department, above Chichicastenango, 11-Jan-1990, C. J. Durden leg.

(NVG-22056C06) [TMMC]; and 19 El Salvador, 2 mi down from Cerro Verde summit, 20-Aug-1972, G.

F. & S. Hevel leg. (NVG-18115F09, USNMENT 01531603) [USNM].

Type locality. Mexico: Chiapas, ca. 20 km S of San Cristobal, Rancho Belén.

Etymology. Like poa formed from “Mt. Poas”, the name chia is formed from Chiapas, for the type

locality of this species. The name is a noun in apposition.

Distribution. Confirmed from Mexico: Chiapas, Guatemala, and El Salvador.

Lerodea? rupilius Schaus, 1913 is a subspecies of

Atrytonopsis edwardsi W. Barnes & McDunnough, 1916

Lerodea? rupilius Schaus, 1913 (type locality given as “Guapiles” [Costa Rica] in the original description)

was regarded as nomen dubium by Burns (1983), who concluded that its syntype in USNM was “phony”:

it differed in some aspects from the original illustration in Schaus (1913) and was labeled from “Guadljara

Atrytonopsis edwardsi edwardsi|11277|USA:TX,Jeff Davis Co.|2018 b

Atrytonopsis edwardsi edwardsi|15101B09|LT|USA:AZ,Pima Co.

Atrytonopsis edwardsi edwardsi|11795|USA:TX,Jeff Davis Co.|2018 mite

Atrytonopsis edwardsi edwardsi|21108F05|Mexico:Son|1961

Z chr

Atrytonopsis edwardsi edwardsi|15101B09|LT|USA:AZ,Pima Co.|old

Atrytonopsis edwardsi edwardsi|21108F05|Mexico:Son|1961

Atrytonopsis edwardsi edwardsi|17114C03|USA:TX,Jeff Davis Co.|1972

Atrytonopsis edwardsi edwardsi|22065A03|USA:TX,Jeff Davis Co.|2004

; Atrytonopsis edwardsi rupilius [not nom. dub.]|15101C11|LT|Mexico:Jallold

Atrytonopsis edwardsi rupilius [was edwardsi]|19042C08|Mexico:Jal|1966

Atrytonopsis ovinia (=zaovinia)|15101D01|HT|Mexico:Pue|1911

Atrytonopsis ovinia|19042C06|Mexico:Pue|1964

Atrytonopsis ovinia|19042C07|Mexico:Pue|1964

Atrytonopsis ovinia|19042C05|Mexico:Gro|1956

Atrytonopsis ovinia|20062E11|Mexico:Oax|1988

Atrytonopsis ovinia|18118H11|Mexico:Oax|1992

Atrytonopsis ovinia|19024G02|Costa Rica|1993

Atrytonopsis ovinia]18119A01|Mexico:Chia|1975

Atrytonopsis ovinia]19042C04|Mexico:Gro|1958

Atrytonopsis ovinia]18118H12|Mexico:Chia|1992

0.002

0.02

Atrytonopsis edwardsi edwardsi|11277|USA:TX,Jeff Davis Co.

Atrytonopsis edwardsi edwardsi|11795|USA:TX,Jeff Davis Co.

Atrytonopsis edwardsi edwardsi|22065A03|USA:TX,Jeff Davis Co.

Atrytonopsis edwardsi rupilius [not nom. dub.]|15101C11|LT|Mex:Jal

iAtrytonopsis ovinia (=zaovinia)|15101D01|HT|Mexico:Pue|1911

Atrytonopsis edwardsi edwardsi|17114C03|USA:TX,Jeff Davis Co.

Atrytonopsis edwardsi rupilius [was edwardsi]|19042C08|Mexico:Jal

Atrytonopsis ovinia|19042C06|Mexico:Pue|1964

Atrytonopsis ovinia|19042C07|Mexico:Pue|1964

Atrytonopsis ovinia|19042C05|Mexico:Gro|1956

jAtrytonopsis ovinia|19042C04|Mexico:Gro|1958

Atrytonopsis ovinia|20062E11|Mexico:Oax|1988

iooAtrytonopsis ovinia|18118H11|Mexico:Oax|1992

Atrytonopsis ovinia|18119A01|Mexico:Chia|1975

Atrytonopsis ovinia|18118H12|Mexico:Chia|1992

Atrytonopsis ovinia|19024G02|Costa Rica|1993

100

Fig. 57. Phylogenetic trees of Atrytonopsis edwardsi (blue, with A. e. rupilius in red) and Atrytonopsis ovinia (violet) inferred

from protein-coding regions of a) the Z chromosome and b) the mitochondrial genome.

Mex” and not from “Guapiles.” However, our inspection of the syntype reveals that it agrees closely with

the original description and bears labels in a style typical of all syntypes by Schaus. One of them is the

identification label in his handwriting with this species’ name and the word “type.” It is difficult for us to

imagine that this specimen is not a true syntype, provided that all other species Schaus proposed based on

USNM material have extant syntypes in the collection. However, illustrations of specimens were not

known to be particularly accurate, and we hypothesize that there was a mistake in stating the locality of a

syntype in the original description: Guadljara was erroneously replaced with Guapiles in the publication

(Schaus 1913), maybe because both words start with “Gua”. Therefore, we regard this female “type,”

possibly the only specimen Schaus based his description of L. rupilius on, as a true syntype. To stabilize

nomenclature, N.V.G. hereby designates this specimen in the USNM collection bearing the following four

labels, 3" red and others white: [ Guadljara | Mex ], [ Lerodea ? | rupilius | type Schs ], [ Type | No. 16817

| U.S.N.M. J, [ GENITALIA NO. | X-1060 | J. M. Burns 1981 | as the lectotype of Lerodea ? rupilius

Schaus, 1913.

Morphologically, Burns (1983) identified the lectotype of L. rupilius as Atrytonopsis edwardsi W.

Barnes & McDunnough, 1916 (type locality in USA: Arizona, Pima Co.), therefore, ZL. rupilius is not a

junior subjective synonym of AZtrytonopsis ovinia zaovinia Dyar, 1913 (type locality in Mexico:

Puebla)—currently a junior subjective synonym of Atrytonopsis ovinia (Hewitson, 1866), (type locality in

Nicaragua)—as treated by Evans (1955). Genomic analysis confirms this assessment and places the

lectotype as sister to another specimen from Mexico: Jalisco (Fig. 57), thus also confirming the type

locality as Mexico: Jalisco, Guadalajara. The two specimens from Jalisco (Fig. 57 red) are genetically

differentiated from A. edwardsi specimens collected in the USA: Arizona and Texas and Mexico: Sonora

(Fig. 57 blue), forming a separate clade. Due to this genetic differentiation, we propose that L. rupilius is

a subspecies of Atrytonopsis edwardsi W. Barnes & McDunnough, 1916: Atrytonopsis edwardsi rupilius

(Schaus, 1913), comb. nov., stat. nov. Despite a large gap in their distributions, we note that neither COI

barcodes nor the whole mitochondrial genomes differentiate these subspecies, and we also see

mitochondrial introgression from A. ovinia to A. edwardsi (Fig. 57b, red and violet within the blue clade).

Vidius tanna (de Jong, 1983) comb. nov.

Genomic sequencing of the holotype of Cobalopsis tanna de Jong, 1983 (type locality in Suriname),

currently kept in its original genus, reveals that it is not monophyletic with Cobalopsis Godman, 1900

(type species Pamphila edda Mabille, 1891, which is a junior subjective synonym of Hesperia autumna

Pl6tz, 1882) and instead originates within Vidius Evans, 1955 (type species Narga vidius Mabille, 1891)

(Fig. 58). Therefore, we transfer this species from Cobalopsis to Vidius forming a new combination

Vidius tanna (de Jong, 1983), comb. nov.

a Vidius vet ee ieee ae b ro idius vidius|18043G12|PLT|Brazil:SP|old

Vidius vidius|18012H08|Brazil:PR|old ; idius vidius|18012H08|Brazil:PR|old

50 Vidius dagon|19018G12|Brazil:GO|1956 0.02 fidius dagon|19018G12|Brazil:GO|1956

Weoius dagon|19017F01|Brazil:GO|1969

Nidius fraus|19018G08|Guatemalal|old

Vidius fraus|19018G09|Costa Ricalold

Vidius catocala|15036G03|LT|no datalold

Vidius catocala|21047H03|Peru|1981

idius cocalus|21047HO7|Peru:MD|1981

idius cocalus|21047H08|Peru:MD|1981

Wisius pompeoides|21047H05|Brazil:MG|1970

idius pompeoides|21047H06|Peru:Loreto|1971

Vidius tanna [not Cobalopsis]|22011B07|HT|Suriname

Nastra Ilherminier|3491|USA:TX,Hardin Co.|2015

Nastra perigenes|17111E06|USA:TX,Cameron Co.|1963

yeaa em autumna|15035A06|ST|Panama|1876

Obalopsis autumna|22109A04|Mexico:Ver|1973

1@obalopsis nero|19021C12|Panama|1979

Cobalopsis nero|19021D02|French Guiana|1993

gbalopsis valerius|17099E10|Guyana|1999

obalopsis valerius|19021D07|Panama|1973

1@aobalopsis dictys|19019H01|Panama|1979

Cobalopsis dictys|21013C10|Guatemala|old

* Vidius dagon|19017F01|Brazil:GO|1969

oo Vidius fraus|19018G08|Guatemalalold

idius fraus]|19018G09|Costa Ricalold

> Vidius catocala|15036G03|LT|no data|old

° Vidius catocala|21047H03|Peru|1981

) Vidius cocalus|21047H0O7|Peru:MD|1981

*Vidius cocalus|21047H08|Peru:MD|1981

oWidius pompeoides|21047H05|Brazil:MG|1970

Vidius pompeoides|21047H06|Peru:Loreto|1971

Vidius tanna [not Cobalopsis]|22011B07|HT|Suriname|1963

Nastra Iherminier|3491|USA:TX,Hardin Co.|2015

Nastra perigenes|17111E06|USA:TX,Cameron Co.|1963

Cobalopsis autumna|15035A06|ST|Panama|1876

**Cobalopsis autumna|22109A04|Mexico:Ver|1973

> Cobalopsis nero|19021C12|Panama|1979

° Cobalopsis nero|19021D02|French Guiana|1993

Cobalopsis valerius|17099E10|Guyana|1999

Cobalopsis valerius|19021D07|Panama|1973

Cobalopsis dictys|19019H01|Panama|1979

Cobalopsis dictys]21013C10|Guatemala|old

100

Fig. 58. Phylogenetic trees of Vidius (blue, with V. tanna comb. nov. in red) and Cobalopsis (violet) inferred from protein-

coding regions of a) the nuclear (autosomes) and b) the mitochondrial genomes.

ACKNOWLEDGMENTS

This study is a direct continuation of the work we initiated with the late Paul A. Opler, our close

collaborator on genomic projects. We are most grateful to Paul and his wife Evi for participating in these

projects, sharing knowledge, discussions, insights, critiques, and numerous specimens they collected for

genomic research, which we used in this and future studies. We acknowledge Ping Chen and Ming Tang

for their excellent technical assistance. We are grateful to David Grimaldi and Courtney Richenbacher

(AMNH: American Museum of Natural History, New York, NY, USA), Jason Weintraub (ANSP: The

Academy of Natural Sciences of Drexel University, Philadelphia, PA, USA), Blanca Huertas, David Lees,

Alberto Zilli, and Geoff Martin (BMNH: Natural History Museum, London, UK), Chris Grinter, Denise

Montelongo, David Bettman, Vince Lee, and the late Norm Penny (CAS: California Academy of

Sciences, San Francisco, CA, USA), Jim Fetzner, Bob Androw, Vanessa Verdecia, Cat Giles, and the late

John Rawlins (CMNH: Carnegie Museum of Natural History, Pittsburgh, PA, USA), the late Paul Opler,

Chuck Harp, and the late Boris Kondratieff (CSUC: Colorado State University Collection, Fort Collins,

CO, USA), Jason Dombroskie (CUIC: Cornell University Insect Collection, Ithaca, New York, USA),

Crystal Maier and Rebekah Baquiran (FMNH: Field Museum of Natural History, Chicago, IL, USA),

Weiping Xie and Giar-Ann Kung (LACM: Los Angeles County Museum of Natural History, Los

Angeles, CA, USA), John R. MacDonald and Richard L. Brown (MEM: Mississippi Entomological

Museum, Starkville, MS, USA), Théo Léger, Viola Richter, Christoph L. Hauser, and Wolfram Mey

(MFNB: Museum fiir Naturkunde, Berlin, Germany), Andrei Sourakov, Andrew D. Warren, Debbie

Matthews-Lott, Riley J. Gott, and Keith R. Willmott (MGCL: McGuire Center for Lepidoptera and

Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA), Rodolphe Rougerie (MNHP:

Muséum National d'Histoire Naturelle, Paris, France), Matthias Nuss and Manuela Bartel (MTD: Museum

fir Tierkunde, Dresden, Germany), Larry F. Gall (PMNH: Peabody Museum of Natural History, Yale

University, New Haven, CT, USA), Rob de Vos (RMNH: Naturalis Biodiversity Center, Leiden,

Netherlands), Martin Wiemers and Christian Kutzscher (SDEI: Senckenberg Deutsches Entomologisches

Institut, Miincheberg, Germany), Michael Falkenberg (SMNK: Staatliches Museum fiir Naturkunde,

Karlsruhe, Germany), Edward G. Riley, Karen Wright, and John Oswald (TAMU: Texas A&M

University Insect Collection, College Station, TX, USA), Alex Wild (TMMC: University of Texas

Biodiversity Center, Austin, TX, USA), Jeff Smith and Lynn Kimsey (UCDC: Bohart Museum of

Entomology, University of California, Davis, CA, USA), Robert K. Robbins, John M. Burns, and Brian

Harris (USNM: National Museum of Natural History, Smithsonian Institution, Washington, DC, USA),

and Axel Hausmann, Andreas Segerer, and Ulf Buchsbaum (ZSMC: Zoologische Staatssammlung

Miinchen, Germany), for granting access to the collections under their care, sampling specimens, and

stimulating discussions; to Dave Ahrenholz, Rich Bailowitz, Brian Banker, Gian C. Bozano, Jim P.

Brock, Ernst Brockmann, Bill R. Dempwolf, Mike Fisher, Howard Grisham, Cris S. Guppy, Robb

Hannawacker, Steve M. Spomer, and Mark Walker for specimens and leg samples, to Gerardo Lamas and

Jonathan P. Pelham for discussions, advice, helpful suggestions, patiently answering numerous questions,

and sharing their research files, to Ernst Brockmann for the help with deciphering abbreviations in

German, and to Bernard Hermier and Gerardo Lamas for critical review of the manuscript and many

helpful corrections. We are indebted to the California Department of Fish and Game for collecting permit

SC13645, Texas Parks and Wildlife Department (Natural Resources Program Director David H. Riskind)

for the research permit 08-02Rev, to U. S. National Park Service for the research permits: Big Bend

(Raymond Skiles) for BIBE-2004-SCI-0011 and Yellowstone (Erik Oberg and Annie Carlson) for YELL-

2017-SCI-7076, and to the National Environment & Planning Agency of Jamaica for the permission to

collect specimens. We acknowledge the Texas Advanced Computing Center (TACC) at The University of

Texas at Austin for providing HPC resources. This study was supported in part by the HHMI Investigator

funds and by grants from the National Institutes of Health GM127390 and the Welch Foundation I-1505

to N.V.G.

LITERATURE CITED

Bachtrog, D., K. Thornton, A. Clark, and P. Andolfatto. 2006. Extensive introgression of

mitochondrial DNA relative to nuclear genes in the Drosophila yakuba species group. Evolution

60(2): 292-302.

Bethune-Baker, G. T. 1908. Descriptions of new species of butterflies of the division Rhopalocera from

Africa and from New Guinea. Proceedings of the Zoological Society of London 1908: 110-126.

Brown, J. W., H. G. Real, and D. K. Faulkner. 1992. Butterflies of Baja California. Faunal survey,

natural history, conservation biology. The Lepidoptera Research Foundation, Inc.; Beverly Hills. v

+ 129 pp., 8 pls., 9 figs., maps.

Burns, J. M. 1983. Superspecies Atrytonopsis ovinia (A. ovinia plus A. edwardsi) and the nonadaptive

nature of interspecific genitalic differences (Lepidoptera: Hesperiidae). Proceedings of the

Entomological Society of Washington 84(3): 547-567.

Burns, J. M., D. H. Janzen, M. Hajibabaei, W. Hallwachs, and P. D. Hebert. 2008. DNA barcodes

and cryptic species of skipper butterflies in the genus Perichares in Area de Conservacion

Guanacaste, Costa Rica. Proceedings of the National Academy of Sciences of the United States of

America 105(17): 6350-6355.

Callaghan, C. J., and G. Lamas. 2004. Riodinidae. /n: Lamas, G. (Ed.). Checklist: Part 4A.

Hesperioidea - Papilionoidea. Association for Tropical Lepidoptera; Scientific Publishers;

Gainesville. 439 pp.

Cassie, B., J. Glassberg, A. Swengel, and G. Tudor. 2001. North American Butterfly Association

(NABA) checklist & English names of North American butterflies. Second Edition. North

American Butterfly Association; Morristown, NJ. 37 pp.

Cong, Q., J. Shen, D. Borek, R. K. Robbins, P. A. Opler, Z. Otwinowski, and N. V. Grishin. 2017a.

When COI barcodes deceive: complete genomes reveal introgression in hairstreaks. Proceedings

of the Royal Society B: Biological Sciences 284(1848): 20161735.

Cong, Q., J. Shen, W. Li, D. Borek, Z. Otwinowski, and N. V. Grishin. 2017b. The first complete

genomes of metalmarks and the classification of butterfly families. Genomics 109: 485—493.

Cong, Q., J. Shen, J. Zhang, W. Li, L. N. Kinch, J. V. Calhoun, A. D. Warren, and N. V. Grishin.

2021. Genomics reveals the origins of historical specimens. Molecular Biology and Evolution

38(5): 2166-2176.

Cong, Q., J. Zhang, and N. V. Grishin. 2019a. Genomic determinants of speciation. bioRxiv

BIORXIV/2019/83 7666.

Cong, Q., J. Zhang, J. Shen, X. Cao, C. Brevignon, and N. V. Grishin. 2020. Speciation in North

American Junonia from a genomic perspective. Systematic Entomology 45(4): 803-837.

Cong, Q., J. Zhang, J. Shen, and N. V. Grishin. 2019b. Fifty new genera of Hesperiidae (Lepidoptera).

Insecta Mundi 0731: 1—56.

Cramer, P. 1775-1780. De uitlandsche Kapellen voorkomende in de drie Waereld-Deelen Asia, Africa

en America. Papillons exotiques des trois parties du monde I'Asie, |'Afrique et l'Amérique. S.J.

Baalde; Utrecht, Barthelemy Wild and J. Van Schoonhoven & Comp.; Amsteldam.

Davey, J. W., M. Chouteau, S. L. Barker, L. Maroja, S. W. Baxter, F. Simpson, R. M. Merrill, M.

Joron, J. Mallet, K. K. Dasmahapatra, and C. D. Jiggins. 2016. Major improvements to the

Heliconius melpomene genome assembly used to confirm 10 chromosome fusion events in 6

million years of butterfly evolution. G3 (Bethesda) 6(3): 695-708.

Draudt, M. W. K. 1921-1924. B. Grypocera, breitképfige Tagfalter. /n: Seitz, A. (Ed.). Die Gross-

Schmetterlinge der Erde. Alfred Kernen; Stuttgart, pp. 833-1011, 1046-1139, pls 113B, 160-193.

Evans, W. H. 1949. A catalogue of the Hesperiidae from Europe, Asia, and Australia in the British

Museum (Natural History). The Trustees of the British Museum (Natural History); London. xix +

502 pp., 53 pls.

Evans, W. H. 1952. A catalogue of the American Hesperiidae indicating the classification and

nomenclature adopted in the British Museum (Natural History). Part II. Pyrginae. Section I. The

Trustees of the British Museum (Natural History); London. v + 178 pp., pls. 10—25.

Evans, W. H. 1953. A catalogue of the American Hesperiidae indicating the classification and

nomenclature adopted in the British Museum (Natural History). Part III. Pyrginae. Section 2. The

Trustees of the British Museum (Natural History); London. v + 246 pp., pls. 26—53.

Evans, W. H. 1955. A catalogue of the American Hesperiidae indicating the classification and

nomenclature adopted in the British Museum (Natural History). Part IV. Hesperiinae and

Megathyminae. The Trustees of the British Museum (Natural History); London. v + 499 pp., pls.

54-88.

Fruhstorfer, H. 1918. Revision der Gattung Castalius auf Grund der Morphologie der

Generationsorgane. Tijdschrift voor Entomologie 61(1/2): 17-44.

Geyer, C. 1837. 5: 43, pl. 196, figs. 983-984. Jn: Hiibner, J. (Ed.). Zutrage zur Sammlung exotischer

Schmetterlinge, bestehend in Bekanntmachung einzelner Geschlechter neuer oder seltener

nichteuropdischer Arten. Jacob Hiibner; Augsburg.

Godman, F. D. 1900. sections on Hesperiidae. /n: Godman, F. D., and O. Salvin (Eds.). Biologia

Centrali-Americana. Insecta. Lepidoptera-Rhopalocera. Dulau & Co., Bernard Quaritch; London,

pp. 2(157): 485-500, pls. 93-94.

Godman, F. D. 1907. Notes on the American species of Hesperiidae described by Pl6tz. Annals and

Magazine of Natural History (7)20(16): 132-155.

Hall, J. P. W. 2005. A Phylogenetic Revision of the Napaeina (Lepidoptera: Riodinidae: Mesosemiini).

The Entomological Society of Washington; Washington, DC. 236 pp. + 8 pls.

Hauser, C. L., D. Bartsch, J. Holstein, and A. Steiner. 2003. The Lepidoptera type material of G. A.

W. Herrich-Schaffer in the Staatliches Museum fiir Naturkunde, Stuttgart. Stuttgarter Beitrage zur

Naturkunde, Ser. A. 657: 1-78.

Hebert, P. D., A. Cywinska, S. L. Ball, and J. R. deWaard. 2003. Biological identifications through

DNA barcodes. Proceedings of the Royal Society B: Biological Sciences 270(1512): 313-321.

Herrich-Schaffer, G. A. W. 1869. Prodromus systematis lepidopterorum. Correspondenz-Blatt des

zoologisch-mineralogischen Vereines in Regensburg 23(12): 184-204.

Higgins, L. G. 1960. A revision of the Melitaeine genus Chlosyne and allied species (Lepidoptera:

Nymphalidae). Transactions of the royal entomological Society of London 112(14): 381—467.

Holland, W. J. 1891. Asiatic Lepidoptera. List of the diurnal Lepidoptera taken by Mr. William Doherty

of Cincinnati in Celebes, June and July 1887, with descriptions of some apparently new forms.

Proceedings of the Boston Society of Natural History 25: 52-82.

ICZN [International Commission on Zoological Nomenclature]. 1999. International code of

zoological nomenclature. Fourth edition. International Trust for Zoological Nomenclature;

London. xxx + 306 pp.

Kawahara, A. Y., C. Storer, A. P. S. Carvalho, D. M. Plotkin, F. L. Condamine, M. P. Braga, E. A.

Ellis, R. A. St Laurent, X. Li, V. Barve, L. Cai, C. Earl, P. B. Frandsen, H. L. Owens, W. A.

Valencia-Montoya, K. Aduse-Poku, E. F. A. Toussaint, K. M. Dexter, T. Doleck, A. Markee,

R. Messcher, Y. L. Nguyen, J. A. T. Badon, H. A. Benitez, M. F. Braby, P. A. C. Buenavente,

W. P. Chan, S. C. Collins, R. A. Rabideau Childers, E. Dankowicz, R. Eastwood, Z. F. Fric,

R. J. Gott, J. P. W. Hall, W. Hallwachs, N. B. Hardy, R. L. Hawkins Sipe, A. Heath, J. D.

Hinolan, N. T. Homziak, Y. F. Hsu, Y. Inayoshi, M. G. A. Itliong, D. H. Janzen, I. J.

Kitching, K. Kunte, G. Lamas, M. J. Landis, E. A. Larsen, T. B. Larsen, J. V. Leong, V.

Lukhtanov, C. A. Maier, J. I. Martinez, D. J. Martins, K. Maruyama, S. C. Maunsell, N. O.

Mega, A. Monastyrskii, A. B. B. Morais, C. J. Muller, M. A. K. Naive, G. Nielsen, P. S.

Padron, D. Peggie, H. P. Romanowski, S. Safian, M. Saito, S. Schroder, V. Shirey, D. Soltis,

P. Soltis, A. Sourakov, G. Talavera, R. Vila, P. Vlasanek, H. Wang, A. D. Warren, K. R.

Willmott, M. Yago, W. Jetz, M. A. Jarzyna, J. W. Breinholt, M. Espeland, L. Ries, R. P.

Guralnick, N. E. Pierce, and D. J. Lohman. 2023. A global phylogeny of butterflies reveals

their evolutionary history, ancestral hosts and biogeographic origins. Nature Ecology & Evolution

7(6): 903-913.

Lamas, G. 2004. Checklist: Part 4A. Hesperioidea-Papilionoidea. Association for Tropical Lepidoptera;

Scientific Publishers; Gainesville. 439 pp.

Li, W., Q. Cong, J. Shen, J. Zhang, W. Hallwachs, D. H. Janzen, and N. V. Grishin. 2019. Genomes

of skipper butterflies reveal extensive convergence of wing patterns. Proceedings of the National

Academy of Sciences of the United States of America 116(13): 6232-6237.

Lukhtanov, V. A., A. Sourakov, and E. Zakharov. 2016. DNA barcodes as a tool in biodiversity

research: testing pre-existing taxonomic hypotheses in Delphic Apollo butterflies (Lepidoptera,

Papilionidae). Systematics and Biodiversity 14: 599-613.

MacNeill, C. D. 1962. A preliminary report on the Hesperiidae of Baja California (Lepidoptera).

Proceedings of the California Academy of Sciences (4)30(5): 91-116.

Mayr, E. 1982. Of what use are subspecies? The Auk 99(3): 593-595.

Mielke, O. H. H. 2005. Catalogue of the American Hesperioidea: Hesperiidae (Lepidoptera). Sociedade

Brasileira de Zoologia; Curitiba, Parana, Brazil. xiii + 1536 pp.

Minh, B. Q., M. A. Nguyen, and A. von Haeseler. 2013. Ultrafast approximation for phylogenetic

bootstrap. Molecular Biology and Evolution 30(5): 1188-1195.

Monroe, B. L. 1982. A modern concept of the subspecies. The Auk 99(3): 608-609.

Nakahara, S., A. Zilli, J. V. Calhoun, M. Espeland, P. S. Padron, and N. V. Grishin. 2022. Resolving

two centuries of mistaken identity: Reinterpretation of Papilio marcus Fabricius, 1787

(Lepidoptera: Nymphalidae, Hesperiidae). Zootaxa 5195(3): 241-255.

Nguyen, L. T., H. A. Schmidt, A. von Haeseler, and B. Q. Minh. 2015. IQ-TREE: a fast and effective

stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and

Evolution 32(1): 268-274.

Pelham, J. P. 2008. Catalogue of the Butterflies of the United States and Canada. Journal of Research on

the Lepidoptera 40: 1-658.

Pelham, J. P. 2023. Catalogue of the Butterflies of the United States and Canada. Revised 23 February

2023. <http://www.butterfliesofamerica.com/US-Can-Cat.htm> (Last accessed November 2023).

Plétz, C. 1883. Die Hesperiinen-Gattung Hesperia Aut. und ihre Arten. Stettiner entomologische Zeitung

44(4/6): 195-233.

Powell, J. A. 1958. Additions to the knowledge of the butterfly fauna of Baja California Norte. The

Lepidopterists' News 12(1/2): 26-32.

Rambaut, A. 2018. FigTree, version 1.4.4. Available at http://tree.bio.ed.ac.uk/software/figtree/ (Last

accessed November 2023).

Robbins, R. K., Q. Cong, J. Zhang, J. Shen, R. C. Busby, C. Faynel, M. Duarte, A. R. P. Martins, C.

Prieto, G. Lamas, and N. V. Grishin. 2022. Genomics-based higher classification of the species-

rich hairstreaks (Lepidoptera: Lycaenidae: Eumaeini). Systematic Entomology 47(3): 445-469.

Robbins, R. K., and P. M. Henson. 1986. Why Pieris rapae is a better name than Artogeia rapae

(Pieridae). Journal of the Lepidopterists' Society 40(2): 79-92.

Rosa, A. H. B., N. Seraphim, P. A. Machado, P. E. Gueratto, T. Sobral-Souza, and A. V. L. Freitas.

2023. Eucorna sanarita (Schaus) (Riodinidae: Riodininae): Distribution, systematic position, and

conservation of a threatened brazilian butterfly in the Atlantic Forest biodiversity hotspot. Journal

of Insect Conservation 27(1): 167-179.

Santos, F. L. d., F. M. Dias, L. A. Leite, D. R. Dolibaina, M. M. Casagrande, and O. H. Mielke.

2014. Taxonomic notes on some species of Euselasia Hubner, [1819] from the "Uriiformes"

group, with the description of the immature stages of Euselasia satyroides Lathy, 1926, stat. rev.

(Lepidoptera: Riodinidae: Euselasiinae). Zootaxa 3869(5): 501-522.

Schaus, W. 1913. New species of Rhopalocera from Costa Rica. Proceedings of the zoological Society of

London 1913(3): 339-367.

Scott, J. A. 1986. The Butterflies of North America: A Natural History and Field Guide. Standford

University Press; Stanford, CA. xii + 583 pp.

Seraphim, N., L. A. Kaminski, P. J. Devries, C. Penz, C. Callaghan, N. Wahlberg, K. L. Silva-

Brandao, and A. V. L. Freitas. 2018. Molecular phylogeny and higher systematics of the

metalmark butterflies (Lepidoptera: Riodinidae). Systematic Entomology 43(2): 407-425.

Shen, J., Q. Cong, D. Borek, Z. Otwinowski, and N. V. Grishin. 2017. Complete genome of Achalarus

lyciades, the first representative of the Eudaminae subfamily of skippers. Current Genomics 18(4):

366-374.

Shen, J., Q. Cong, L. N. Kinch, D. Borek, Z. Otwinowski, and N. V. Grishin. 2016. Complete genome

of Pieris rapae, a resilient alien, a cabbage pest, and a source of anti-cancer proteins.

F1000Research 5: 2631.

Warren, A. D., K. J. Davis, E. M. Stangeland, J. P. Pelham, K. R. Willmott, and N. V. Grishin.

2023. Illustrated Lists of American Butterflies. [23-VI-2023] <https://www.butterfliesofamerica.

com/>.

Westwood, J. O. 1851. 2(48): 431-442, pls. 72-73. In: Doubleday, E. (Ed.). The genera of diurnal

Lepidoptera: comprising their generic characters, a notice of their habits and transformations, and

a catalogue of the species of each genus. Longman, Brown, Green & Longmans; London.

Zhang, J., Q. Cong, J. M. Burns, and N. V. Grishin. 2022a. Checking the checkered taxonomy of

Pl6tz's checkered skippers (Hesperiidae: Pyrgini). The Taxonomic Report of the International

Lepidoptera Survey 10(5): 1-31.

Zhang, J.. Q. Cong, and N. V. Grishin. 2023a. Thirteen new species of butterflies (Lepidoptera:

Hesperiidae) from Texas. Insecta Mundi 0969: I-58.

Zhang, J., Q. Cong, J. Shen, E. Brockmann, and N. V. Grishin. 2019a. Genomes reveal drastic and

recurrent phenotypic divergence in firetip skipper butterflies (Hesperiidae: Pyrrhopyginae).

Proceedings of the Royal Society B: Biological Sciences 286(1903): 20190609.

Zhang, J., Q. Cong, J. Shen, and N. V. Grishin. 2022b. Taxonomic changes suggested by the genomic

analysis of Hesperiidae (Lepidoptera). Insecta Mundi 0921: 1-135.

Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2019b. Changes to North American

butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8(2): 1-11.

Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2019c. Genomics of a complete butterfly

continent. bioRxiv BIORXIV/2019/829887.

Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2020. Genomic evidence suggests further

changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8(7):

1-40.

Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2021. Genomics-guided refinement of

butterfly taxonomy. The Taxonomic Report of the International Lepidoptera Survey 9(3): 1-54.

Zhang, J., Q. Cong, J. Shen, L. Song, and N. V. Grishin. 2022¢c. Genomic DNA sequencing reveals

two new North American species of Staphylus (Hesperiidae: Pyrginae: Carcharodini). The

Taxonomic Report of the International Lepidoptera Survey 10(4): I-13.

Zhang, J., Q. Cong, J. Shen, L. Song, and N. V. Grishin. 2023b. Butterfly classification and species

discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11(3):

1-93.

Zhang, J., Q. Cong, J. Shen, L. Song, P. A. Opler, and N. V. Grishin. 2023c. Additional taxonomic

refinements suggested by genomic analysis of butterflies. The Taxonomic Report of the

International Lepidoptera Survey 11(1): 1-25.

Zhang, J., D. R. Dolibaina, Q. Cong, J. Shen, L. Song, C. G. C. Mielke, M. M. Casagrade, O. H. H.

Mielke, and N. V. Grishin. 2023d. Taxonomic notes on Neotropical Hesperiidae (Lepidoptera).

Zootaxa 5271(1): 91-114.

Zhang, J., J. Shen, Q. Cong, and N. V. Grishin. 2019d. Genomic analysis of the tribe Emesidini

(Lepidoptera: Riodinidae). Zootaxa 4668(4): 475—488.

The Taxonomic Report

is a platinum open access peer-reviewed publication of

The International Lepidoptera Survey (TILS)

The International Lepidoptera Survey is registered as a non-profit Limited Liability Company (LLC) in

the state of Virginia, U.S.A. The Taxonomic Report (TTR), ISSN 2643-4776 (print) / ISSN 2643-4806

(online) is published for the purpose of providing a public and permanent scientific record. Articles are

peer-reviewed but not necessarily through the anonymous editor-mediated review process. Typically, the

authors are encouraged to solicit reviews of their manuscripts from knowledgeable lepidopterists before

submission. TTR appears in digital, open-access form, is disseminated as a hardcopy to select institutional

repositories, and is available as printed copy upon request at the discretion of authors and/or the editor.

Printing and postage charges may apply. An initial run of 25 copies is printed on paper to meet ICZN

Code recommendation 8B. All published TTR articles are freely available at the archival TTR website

(http:/lepsurvey.carolinanature.com/report.html) and via the following digital repositories:

Internet Archive (https://archive.org/)

Biodiversity Heritage Library (https://www.biodiversitylibrary.org)

Zobodat (https://www.zobodat.at/)

Zenodo (https://zenodo.org)

Digital Commons (https://digitalcommons.unl.edu)

TILS Purpose

TILS is devoted to the worldwide collection of Lepidoptera for the purpose of scientific discovery,

determination, and documentation, without which there can be no preservation.

TILS Motto

“As a world community, we cannot protect that which we do not know”

Articles for publication are sought

Manuscripts may deal with any area of research on Lepidoptera, including faunal surveys, conservation

topics, life histories and foodplant records, matters of nomenclature, descriptions of new taxa, methods,

etc. Taxonomic papers are particularly welcome. There are no publication charges for authors. Before

submitting a manuscript, email TTR editor, Harry Pavulaan, 606 Hunton Place NE, Leesburg, VA,

20176, USA at intlepsurvey@gmail.com (cc: to harrypav@hotmail.com if you do not receive a reply

within one week) to initiate discussion on how to best handle your material for publication, and to discuss

peer review options.

Visit The International Lepidoptera Survey on the World Wide Web at:

http://lepsurvey.carolinanature.com

Join the discussion at our list serve on Groups.1o at:

https://groups.io/g/TILS

You can subscribe by sending an email to: TILS+subscribe@groups.io

Join The International Lepidoptera Survey on Facebook at:

https://www.facebook.com/groups/1072292259768446