Volume 3

21 May 2001

Number

The Taxonomic Report

OF THE INTERNATIONAL LEPIDOPTERA SURVEY

CLARIFICATION OF AND COMMENTS ON NORTHERN SPEYERIA

HYDASPE SUBSPECIES (LEPIDOPTERA: NYMPHALIDAE)

NORBERT G. KONDLA

Box 244, Genelle, British Columbia VOG 1G0 Canada

ABSTRACT. The geographic distribution and use of three northern S. hydaspe subspecies names is reviewed. This

is necessary due to literature errors about the type locality of subspecies rhodope (Edwards, 1874). The correct placement

of the rhodope type locality renders the name S. hydaspe sakuntala (Skinner, 1911) of interior British Columbia as a junior

synonym of S. hydaspe rhodope. The name S. hydaspe minor (McDunnough, 1927) is available for the coastal populations

by those who recognize these as different from those of the interior.

Additional keywords: gregsoni Gunder, 1932, skinneri Holland, 1931.

OVERVIEW OF PERTINENT NAMES

The subspecies name rhodope (Edwards 1874) has frequently been used for the Speyeria hydaspe

(Boisduval, 1869) populations on Vancouver Island and nearby coastal areas of British Columbia (Guppy

and Shepard 2001, Howe 1975, Layberry etal. 1998). Dornfeld (1980) viewed rhodope as being a butterfly

of coastal Washington and British Columbia. Hinchliff (1996) also treated rhodope as a coastal taxon.

Miller and Brown (1981) and Guppy and Shepard (2001) both use the vague phrase “Fraser River

Lowlands” to designate the type locality. Both the distribution noted above and the putative type locality are

incorrect.

Edwards (1874) described rhodope from three males and one female “taken in British Columbia, in

1873, by G.R. Crotch”. Edwards described a butterfly that is deep red fulvous on the dorsum with the basal

portions of both wings dark brown. The ventral hind wings were described as deep red. However, Crotch

referred to these butterflies as purple. This may be attributable to differing color perception or the effect of

viewing under natural versus artificial light. This may also be due to the type series consisting of both the

red and purple color morphs mentioned later in this review. The male wing expanse was given as 2.2

inches for the male and as 2.4 inches for the female.

Skinner (1911) described sakuntala from four males and one female taken at Ainsworth, BC; Kaslo,

BC; and Laggan, Alberta. Skinner does not give a size for sakuntala but McDunnough (1927) says that the

wing expanse is 2 inches. Skinner unfortunately does not mention the origin of the comparative “ rhodope ”

material he used to compare with his new subspecies. So we cannot be certain that he even compared

sakuntala with rhodope in the traditional use of the name. He did mention comparison with a large series of

rhodope which may have been in the Academy of Natural Sciences of Philadelphia. He also mentioned

submitting the specimens for study by C. Gordon Hewitt, Dominion Entomologist in Ottawa, Ontario.

Hewitt had access to the butterfly collection that is now referred to as the Canadian National Collection

(CNC). The CNC holdings of S. hydaspe collected prior to 1911 totaled some 67 specimens; so

Hewitt appears to have had a reasonable amount of material to work with. What is clear, is that Skinner

described the red phenotype of the species that flies in the west Kootenay area of southeastern British

Columbia. Skinner was candid enough to state: “What relation it bears to rhodope in nature can’t be

foretold, but it is sufficiently distinct to call attention to it in the hope that future study will establish its true

relationship”.

The level of differences described by Skinner between sakuntala and rhodope fall within the

normal range of variation I have observed from specimens collected near the sakuntala type locality. I have

examined more than 200 specimens of sakuntala from the general area of the type locality and have noted

the following: size is variable from small to large; dorsal color is variable from light to dark; ventral

hind wing discal area and ventral fore wing apical area color comes in two color morphs - red and purple.

These color morphs are illustrated in Figures 1 to 4.

Figs. 1-6:1-4: Speyeria hydaspe rhodope color morphs (ventral surface); 5-6: S. hydaspe minor. Fig. 1. S. h. rhodope, d: red

morph: 31 July 1999, Km 3 Conkle Lake road near Rock Creek, British Columbia. Fig. 2. S. h. rhodope, d: purple morph: 31

July 1999, Km 3 Co nkl e Lake road near Rock Creek, British Columbia. Fig. 3. S. h. rhodope, 9: red morph: 11 July 2000, Km

4 West Erie Forest Service road near Erie Lake, British Columbia. Fig. 4. S. h. rhodope, 9: purple morph: 11 July 2000, Km 4

West Erie Forest Service road near Erie Lake, British Columbia. Fig. 5. S. h. minor, d : 24 July 2000, Shorts Creek canyon, near

Fintry, British Columbia. Fig. 6. S. .h. minor, d: 4 August 2000, Evelyn Creek, YalakomForest Service road, NW of Lillooet,

British Columbia. All leg. N. Kondla except 5 & 6 leg. D. Threatful. Photos by N. Kondla. (All specimens natural size.)

McDunnough (1927) described minor as an altitudinal infrasubspecific form on the basis of 3 males

and two females from Mt. McLean; one male from Lillooet and one male from Anderson Lake, British

Columbia. The wing expanse given for minor is 1 finches. Dos Passos and Grey correctly attributed

authorship of minor to McDunnough. I accept this as being compliant with the ICZN provisions on this

matter (see Articles 10.2 and 45.6.4.1 of the ICZN fourth edition).

SYSTEMATIC ANALYSIS OF THESE NAMES

Miller and Brown (1981) gave the type locality of rhodope as “Fraser River lowlands” and

asserted that this was designated by Brown in 1965. They went on to say that a previous designation by dos

Passos and Grey “is rejected”. There are significant errors in, and thus systematic problems created by, this

view advanced by Miller and Brown (1981). In actuality, Brown (1965) did not designate a type locality.

All he said was that “topotypical rhodope hails from the forested, broad river bottoms of the Fraser River

system”. This assertion is categorically incorrect and demonstrates that Brown had an inadequate

understanding of the geography and history of British Columbia.

Brown (1965) quotes Edwards in Butterflies of North America that rhodope was collected by G.R.

Crotch “on the way from Bates (commonly called 100-mile House) to Beaver Lake”. Brown asserts that

Beaver Lake is about 15-20 miles west of Quesnel Lake. I have confirmed this approximate location of

Beaver Lake by checking official British Columbia government geographical information. Crotch stated in a

letter to Edwards that “the small Argynnis with purple beneath was only found in the forest on the way from

Bates’s to Beaver Lake”. So the type material was collected in the uplands of the Cariboo district, an

unknown distance east of the Fraser River along the old trail used to access the Cariboo mining areas. The

type locality of rhodope , in the words of the collector of the butterflies and in the words of the describer of

the subspecies, is therefore some 300-400 kilometres from the coast. There is no evidence whatsoever that

the butterflies were collected in the “forested, broad river-bottoms of the Fraser River system” as alleged

by Brown (1965). In fact the above evidence prohibits this speculation.

Dos Passos and Grey (1947) designated a lectotype from one of the Crotch specimens and correctly

fixed the type locality of rhodope as Cariboo District, British Columbia. Article 76.2 of the ICZN

(International Code of Zoological Nomenclature) clearly states that: “The place of origin of the lectotype

becomes the type locality of the nominal species-group taxon, despite any previously published statement of

the type locality.” Miller and Brown (1981) did not correctly grasp the type locality of the lectotype, so

their “rejection” of the dos Passos and Grey type locality is completely without merit.

McDunnough (1927) also correctly identified the type area as being along the old Cariboo trail at

about 2500 feet elevation. The Cariboo Wagon Road was built in the years 1862-1864 and was the route to

access the Cariboo gold fields. It is an upland road that did not get into the “lowlands” of the Fraser River.

He correctly points out that sakuntala is a variable form and that Skinner’s “points of distinction do not

always hold”. Further, he thought that minor would probably be found “all throughout the Cascade and

Coast ranges at suitable elevations” and also observed that Vancouver Island material “may possibly be

slightly darker in color”.

This leaves us in a situation where the official type locality of subspecies rhodope is within the

range of subspecies sakuntala as mapped by Guppy and Shepard (2001). The subspecies sakuntala

(Skinner, 1911) therefore falls as a junior synonym of rhodope Edwards, 1874. If there is a bona fide

subspecies difference between the coastal and interior populations; then this at first glance leaves the

coastal populations without a subspecies name. But the name minor (McDunnough, 1927) is available to

apply to the coastal populations until such time as future study presents a convincing case for taking a

different approach. Some individuals may chose to simply treat all of the northern populations as

subspecies rhodope as was done by Scott (1986). However, subspecific differences between coastal and

3

interior butterflies are the norm in this region rather than the exception. Thus, I am reluctant to simply

consider all these populations as taxonomically the same.

An examination of a small series of coastal specimens suggests that the coastal populations of

British Columbia may merit recognition as a separate subspecies from rhodope of the interior. The primary

points of distinction appear to be a darker dorsum, especially darker wing basal areas, and a distinctly

maroon color to the ventral hindwing. A typical specimen of minor is illustrated in Figure 6. However,

butterflies fitting the maroon ventrum phenotype also occur as far east as the west side of the Okanagan

valley (Figure 5) and even into southeastern British Columbia as evidenced by the specimen used to

illustrate sakuntala in Guppy and Shepard (2001).

At present it seems best to view minor as occupying the south coastal area of British Columbia and

extending an unknown distance into the interior. Note however that none of the three ventral views of S.

hydaspe specimens illustrated by Guppy and Shepard (2001) show the ventral colors that are congruent

with the respective original descriptions of the names attached to the illustrations. I have only seen the red

ventrum phenotypes from southwestern Alberta.

There are two final names that warrant brief mention. The taxon gregsoni (Gunder 1932) was

described as a transitional form from one melanic female collected on Mt. Washington, Vancouver Island.

It has been consistently and correctly recognized as an infrasubspecific entity (dos Passos and Grey 1947,

dos Passos 1964, Miller and Brown 1981) since it was described. The only point of clarification needed is

that the name is associated with the taxon minor and is not associated with rhodope , unless, of course, one

lumps all BC populations under rhodope. The taxon skinneri (Holland 1931) was proposed as a

replacement name for sakuntala , wrongly thought to be preoccupied. It should be placed in the synonymy of

rhodope rather than its traditional location in the synonymy of sakuntala.

Of course this entire discussion is predicated on the assumption of a nominal species S. hydaspe in

this part of North America. I am not aware of any rearing studies to show that the phenotypic variation

described herein is in fact variation within one species. Phenotypic variation within populations presently

mapped as one subspecies in Guppy and Shepard (2001) exceeds the differences between some named

subspecies in California (Emmel 1998, Howe 1975). Thus, rearing and breeding studies should be

undertaken. If these have already been done, the results should be published.

CONCLUSION

The coastal populations that are called rhodope in Guppy and Shepard (2001) are not such because

1) the type locality is some hundreds of kilometres from the nearest population of rhodope as mapped in

their book and because 2) the coastal putative rhodope populations are separated from the type locality by

populations of subspecies minor. The subspecies name minor is available for application to the areas

mapped as rhodope and minor in Guppy and Shepard (2001) and the name rhodope definitely applies to the

areas mapped as sakuntala in the same book. The name rhodope could also be justifiably used for all

British Columbia populations since nobody has ever demonstrated that there are reasonably consistent

differences between coastal and interior populations.

Field work is needed to document the distribution of the ventral color morphs in southern British

Columbia. It should not be too difficult to eventually accumulate adequate study material because this

butterfly does not have the most limited distribution of any Speyeria in BC as alleged by Guppy and

Shepard (2001). Rather the maps in said book clearly show that it is the second most widespread Speyeria

in the province. Rearing and examination of gene chemistry may be needed to determine if the variation

described herein has any taxonomic significance. The taxonomy of S. hydaspe in Alberta and British

Columbia should be reassessed once this work has been completed.

ACKNOWLEDGEMENTS

I thank Ron Gatrelle and Crispin Guppy for reviewing drafts of this paper. David Threatful shared study

specimens. John Calhoun assisted with access to literature. J. Donald Lafontaine provided historical information on C.

Gordon Hewitt. Annabelle Jessop provided data on S. hydaspe specimen holdings of the Canadian National collection.

LITERATURE CITED

BROWN, F.M. 1965. The Types of the Nymphalid Butterflies Described by William Henry Edwards. Part I.

Argynninae. Transactions of the American Entomological Society 91:233-350.

DORNFELD, E.J. 1980. The Butterflies of Oregon. Forest Grove, Oregon: Timber Press. 276 pp.

DOS PASSOS, C.F. 1964. A Synonymic List of the Nearctic Rhopalocera. Lepidopterists' Society Memoir

No.l. 145 pp.

DOS PASSOS, C.F. and L.P. GREY. 1947. Systematic Catalogue of Speyeria (Lepidoptera, Nymphalidae) with

Designation of Types and Fixations of Type Localities. American Museum Novitates No. 1370. 30 pp.

EDWARDS W.H. 1874. Descriptions of New Species of Diurnal Lepidoptera Found in North America.

Transactions of the American Entomological Society 5:13-19.

EMMEL, T.C. (ed.). 1998. Systematics of Western North American Butterflies. Gainesville, Florida: Mariposa Press.

878 pp.

GUNDER, J.D. 1932. New Rhopalocera (Lepidoptera). Canadian Entomologist 64:276-284.

GUPPY, C.S. and J.H. SHEPARD. 2001. Butterflies of British Columbia.Vancouver: UBC Press. 414 pp.

HINCHLIFF, J. 1996. The Distribution of the Butterflies of Washington. Corvallis, Oregon: The Evergreen Aurelians.

162 pp.

HOLLAND, W.J. 1931. The Butterfly Book. Rev. ed. Garden City, NY: Doubleday. 424 pp.

HOWE, W.H. 1975. (Editor) The Butterflies of North America. Doubleday and Co., Inc. 632 pp.

INTERNATIONAL COMMISSION ON ZOOLOGICAL NOMENCLATURE. 1999. International Code of

Zoological Nomenclature, Fourth Edition (1 January 2000). London, UK: The International Trust for Zoological

Nomenclature. 306 pp.

LAYBERRY, R. A., P. W. HALL and J. D. LAFONTAINE. 1998. The Butterflies of Canada. Toronto: University

of Toronto Press. 280 pp.

McDUNNOUGH, J.H. 1927. The Lepidoptera of the Seton Lake region British Columbia. Canadian

Entomologist 56:152-162.

MILLER, L.D. and F.M. BROWN. 1981. A Catalogue/Checklist of the Butterflies of America North of

Mexico. Memoir no. 2. The Lepidopterists' Society 280 pp.

SCOTT, J.A. 1986. The Butterflies of North America: A Natural History and Field Guide. Stanford, California:

Stanford University Press, 583 pp.

SKINNER, H. 1911. A new Argynnis and a new Parnassius (Lep.). Entomological News 22:108.

The Taxonomic Report

is a publication of The International Lepidoptera Survey (TILS).

(A Tax Exempt Non-Profit Scientific Organization)

The Taxonomic Report is projected for publication at the rate of 8-10 issues a year. Subscription/ dues for

Volume Three are $45 US for domestic and $55 US for overseas subscribers. The subscription year follows the

calendar year. All issues are mailed 1 st class. At the end of each year, subscribers receive that year’s volume on a

record-only compact disc (CDR) for permanent archiving and reproduction for personal use (i.e. a museum or

university may make as many copies as needed in whatever format desired). Non-members may receive individual

issues in print any time for $10 per issue. Individual issues on CDR to non-members are $25 per issue post paid.

Subscriptions and individual issue orders should be made payable to TILS; and mailed to: Treasurer, 126 Wells

Road, Goose Creek, SC USA 29445-3413.

Volume 3

5 June 2001

Number 2

The Taxonomic Report

of the international LEPIDOPTERA SURVEY

AN EXAMINATION OF SOUTHEASTERN U.S. SATYRIUM

(LYCAENIDAE: THECLINAE).

PART ONE:

AN OBSCURE NEW SUBSPECIES OF SATYRIUMEDWARDSII

RONALD R. GATRELLE 1

126 Wells Road, Goose Creek, South Carolina 29445-3413

ABSTRACT. Satyrium edwardsii meridionale is described as a new subspecies from Aiken County, South Carolina.

This scarce colony is the southeastemmost known population of this butterfly in the United States. It was discovered by the

author in 1990 near Aiken State Park in Aiken County, South Carolina. This site is in South Carolina’s upper Coastal Plain in

the southern part of the state adjacent to Georgia. It is known from only one male and one female at the type locality.

Because it was known from only one pair, the author thought it best to wait until more specimens became available before

describing this as a new subspecies. In 2000 the author located a series of several very similar edwardsii from Cobb County,

Georgia in the FSCA collection Gainesville, Florida. Also, in recent years populations of S. edwardsii have been discovered

in the southern Sandhills (upper Coastal Plain) of North Carolina that may well prove to belong to this subspecies as well.

This was seen as sufficient evidence to confirm the southernmost populations as a phenotypically distinct subspecies

paralleling the normal subspecific pattern of all other eastern U.S. Satyrium of northern and southern clinal subspecies.

Compared to the nominate subspecies, meridionale is much larger, has bolder marking on the ventral hindwing margins,

much longer tails and the spots of the postmedian band tend to be less round. It is sympatric with Satyrium calamus nr.

falacer, Satyrium liparops liparops, Satyrium titus mopsus, and two other undetermined and/or undescribed Satyrium

species or subspecies at the type locality. The holotype is currently deposited in the Museum of the Hemispheres collection,

Goose Creek, South Carolina, USA.

Additional key words: Ancient populations, relict refugium species, biogeographical evolution.

ORIGINAL DESCRIPTIONS

In 1867 Grote and Robinson published an article in the Transactions of the American Entomological

Society titled Descriptions of American Lepidoptera - No. 2. In this they describe two new hairstreak

butterflies under the names Thecla lorata and Thecla henrici. Their henrici is what we know today as

Deciduphagus henrici (Grote and Robinson, 1867). Their lorata has always been placed in the synonymy

of Satyrium calanus (Hiibner, 1809). In their treatment of lorata they compare it against “ Thecla calanus”.

The problem here is that what they call lorata is actually what we know today as Satyrium calanus falacer

(Godart, 1822), and what they call calanus is what we know today as Satyrium edwardsii - as traditionally

attributed to Grote and Robinson per this 1867 paper.

There are serious problems with the Grote and Robinson article relative to the name edwardsii,

primarily because edwardsii was not actually described in this paper. What they gave was clearly intended

as a redescription of Hubner’s calanus, which they misunderstood. The name edwardsii was mentioned

only twice in this paper. First, in Grote & Robinson’s list of calanus synonyms, and second as an anecdotal

1 Research Associate, Florida State Collection of Arthropods, Gainesville, Florida.

aside relative to an (at the time) unpublished manuscript name of Saunders. Two years later Saunders

published this name himself in The Canadian Entomologist (1869) - where he likewise sank it as a calamus.

In this paper, Grote and Robinson only give a semi-redescription of calamus (as compared to their lorata)

based on two momem dubium specimens from Mr. Saunders. These two specimens (at least the male) are

likely what we have come to know as edwardsii. I say likely, as there are one or two other undescribed

eastern U.S. Satyrium that Saunders may have had in hand. These have red antennal clubs in females (as did

the Saunders’ female) and/or expanded orange at the hindwing anal angle (Figs. 4 & 9).

Some of these problems were recognized by Michener and dos Passos, who, in 1942 reviewed this

situation and designated a neotype which they deposited in the American Museum of Natural History, New

York. (I have not had the opportunity to examine the neotype.) In their paper, Michener and dos Passos

attribute the name edwardsii to Grote and Robinson. This, however, is contrary to the International Code of

Zoological Nomenclature Articles 11, 12.2, 12.2.1 and 12.3. Michener and dos Passos’ attribution of

edwardsii is stated as follows.

The specific name edwardsii has usually been credited to Saunders. Apparently it was first used in print by Grote and

Robinson (1867) who credited it to Saunders, saying that it was to their knowledge previously unpublished, and placing it as a

synonym of calamus. As shown by Scudder (1870) the calamus of Grote and Robinson was the species now called edwardsii.

Their placement of the name edwardsii under their calamus is as definite an indication of the species involved as a

bibliographic citation, and hence the name edwardsii was nomenclatorially validated by and must be credited to Grote and

Robinson, as stated by Barnes and Benjamin (1926, Bull. So. Calif. Acad. Sci., XXV, p. 94).

Saunders in 1869 was the next to use his name edwardsii, and he also placed it as a synonym of the calamus of Grote and

Robinson.

Finally Scudder in 1870 realized that calamus Grote and Robinson was not calamus Hiibner and proposed to call the

former edwardsii Saunders. It was Scudder who first clearly stated the characters of edwardsii, and the species might

reasonably be credited to him .

Figures 1-13. Satyrium species. Fig. 1. d S. e. edwardsii : 7 July 1993, Jones Gap, Macon Co., NC. Fig. 2. Holotype d S. e. meridionals : 1

June 1990, Aiken Co., SC. Fig. 3. <? Satyrium undescribed: 21 May 1977, Aiken Co., SC. Fig. 4. <? Satyrium undescribed: 19 June 1976,

Aiken Co., SC. Fig. 5. 3 S. calamus falacer : 17 May 1991, Aiken Co., SC. Fig. 6. ? S. e. edwardsii : 8 July 1973, Sherbom, MA. (leg.

Winter). Fig. 7. Allotype ? S. e. meridionals : same data as fig. 2. Fig. 8. ? Satyrium undescribed: same data as fig. 3. Fig. 9. ? Satyrium

undetermined/undescribed: 21 May 1977, Aiken Co., SC. Fig. 10. ? S. calamus falacer : same data as fig. 5. Fig. 11. Paratype ? S. e.

meridionale : Cob Gb„ GA. (leg. Towers). Fig. 12. ? S. caryaevorum : 6 July 1993, Jones Gap, Macon Co., NC. Fig. 13. ? Satyrium

undetermined: same data as fig. 12 except 7 July. All leg R. Gatrelle except 6 & 11. All specimens actual size. Photos by Joe Mueller. (The

short tails on Fig. 11 are an optical illusion. They droop downward on the mounted specimen, and are as long as those of Fig. 7.)

The key phrase here by which they attribute the name is “...as definite an indication of the species

involved as a bibliographic citation...” The error here is that there can be no “bibliographic citation”

where there is no valid publication to cite (12.2.1). The fact that Grote and Robinson had an actual

Saunders specimen in hand is disallowed by 12.3 as a mechanism of validation. Edwardsii Grote and

Robinson is a nomen nudum and thus not an available name from either Saunders, or Grote and Robinson

1867.

In 1869 Saunders published this name himself. However, he gave no description, and established no

type. He simply gave it as a Synonymic listing under calanus - this would not seem to meet the rules of

availability (Articles 10-20). Scudder, as pointed out by Michener and dos Passos themselves, in 1870 was

the first to actually fully describe and illustrate edwardsii. His action validated the name to his authorship

and date (see ICZN Glossary under nomen nudum). Thus, the correct nomenclatorial citation is Satyrium

edwardsii (Scudder, 1870).

NORTHERN NOMINATE EDWARDSII

The name Satyrium edwardsii was affixed by the Michener and dos Passos’ neotype to populations

in southeastern Canada, type locality Queenstown, Ontario. The male specimen Grote and Robinson had in

hand was also listed as from Canada. The female in Grote and Robinson’s possession in 1867 was from

Philadelphia, Pennsylvania. I do not think this specimen was what we now call edwardsii because they

stated that the underside of the antennal club was “fulvous beneath.” I have not observed this feature in

edwardsii. I have collected specimens of a “falacer” in Iowa with ventrally very orange clubs in the female.

Nominate edwardsii is a smallish, short tailed taxon. The nominate subspecies’ range extends from

Canada into the New England states and down the Appalachian Mountains, in this typical form, to extreme

southwestern North Carolina (Fig. 1). I have personal experience with nominate edwardsii in Macon

County, North Carolina at Jones Gap between 3800 to 4200 ft. elevation. Macon County abuts Rabun

County, Georgia and Oconee County, South Carolina.

Layberry et al (1998) states that the larval hosts of nominate edwardsii in southeastern Canada are

Black Oak (Quercus velutina Lam.), White Oak (Q . alba L.) and Red Oak (Q . rubra L.). Gochfeld and

Burger (1997) list Scrub Oak (Q. ilicifolia Wang.) as the primary larval host in New Jersey with Black Oak

as a possible host. Allen (1997) also lists Q. ilicifolia as the primary host for West Virginia, but adds that

Black Jack Oak ( Q . marilandica Muenchh.) is also used there. Of these known hosts, only ilicifolia is not

known from the southern Appalachian Mountains of North Carolina, Georgia, and South Carolina.

However, since Black, White, and Red oaks are not primary larval hosts in the northern Appalachians of

West Virginia or the coastal state of New Jersey, marilandica is the only frequently utilized northern U.S.

edwardsii host that also occurs in the southern Appalachian area.

SOUTHERN NON-MONTANE EDWARDSII

Specimens of edwardsii from the deep South have rarely been encountered. One of the main reasons

for this is, undoubtedly, the historical lack of collectors in the South. Nevertheless, this species is probably

truly rare in the coastal region of the South from South Carolina westward. Harris (1972) gives several

records from throughout the Piedmont region of Georgia, with the southernmost being in Bibb County on the

edge of the upper coastal plain. While Harris lists Q. ilicifolia as a host, he was surely only repeating this

as referenced in the literature to northern populations as this tree does not occur in Georgia. It is interesting

that one of his locations is at Blackjack Mountain (Cobb County) which is very probably named after the

Black Jack Oak - which is a known edwardsii host in West Virginia and coastal North Carolina.

3

On 1 June 1990, while collecting specimens of various Satyrium species near the southern boundary

of Aiken State Park, in Aiken County, South Carolina, I was surprised to find a courting pair of Satyrium

edwardsii (Figs. 2 & 7). This area is part of the Sandhills region of North Carolina, South Carolina and

Georgia in the upper coastal plain of these states. This particular location is only 27 miles from the Georgia

line at the Savannah River and 30 miles from the lower coastal plain region of South Carolina. The area

where this pair was taken is at the junction of two habitats. They were collected in dry sandhill habitat but

less than 100 yards from where there is a dramatic shift to the wet Edisto River basin. The sandhill area is

dominated by Turkey Oak ( Quercus laevis Walter). However, there is also a good bit of Black Jack Oak in

this immediate area.

It was apparent immediately that this pair was very large and phenotypically distinct from northern

nominate Satyrium edwardsii. I looked further that day and again the next year but located no farther

specimens in that general area. In 1999 this area began to be developed into residential acreage. Today, in

2001, the literal spot of collection is in tact but the surrounding immediate area is largely decimated.

With the increase in popularity of butterfly watching, several healthy populations of S. edwardsii

have now been discovered in the North Carolina upper coastal plain (Scotland, Moore and Cumberland

counties) adjacent to South Carolina. Unfortunately, I know of no specimens that have been collected from

these taxonomically important populations. The prevailing attitude among many butterfly watchers (at least

in the eastern US) is apparently that all butterfly species and subspecies have been discovered and thus

there is no need for any more scientific (or recreational) collecting. This is not the true. These populations

need to be collected in long enough series to determine their taxonomic status. They may be too far “north”

to be the new subspecies described herein, however, they are definitely too far “south” to be nominate

edwardsii. They are either the new subspecies (which is very likely) or a blend zone phenotype nr. the new

subspecies.

In 2000 while researching other taxa, I came across a series of nine edwardsii collected in Cobb

County, Georgia. These were obviously not nominate edwardsii. Most were identical to the Aiken

phenotype, but a couple were somewhat atypical in size. I borrowed these and gave them, and this whole

situation, a lot of thought.

DESCRIPTION OF A NEW EDWARDSII SUBSPECIES FROM THE DEEP SOUTH

Clinal subspecies are the most common but, generally, they are also the least evolutionarily distinct.

Satyrium calamus calamus and calamus falacer (Godart, [1824]), S. liparops liparops (LeConte, 1833) and

liparops strigosum (Harris, 1862), S. titus titus (Fabricius, 1793) and titus mopsus (Hubner, 1818), and

Fixsemia favomius favomius (J.E. Smith, 1797) and favomius omtario (W.H. Edwards, 1868) are all well

established, and almost universally accepted, north/south clinal hairstreak subspecies pairs in eastern North

America. It is therefore not only not surprising but to be expected that Satyrium edwardsii follows this

same pattern in eastern North America.

While no other records exist for edwardsii in coastal South Carolina, the several records from

Georgia and coastal North Carolina leave no doubt that edwardsii is a breeding resident in the deep South.

The lack of discovery of additional colonies in this area is just that - a lack of discovery due to few

historical workers in this region. Now that this taxon is being recognized as a distinct subspecies, this will

doubtless spur more interest in it, and inevitably, the discovery of more colonies in the South. My opinion

is that it is an uncommon to rare component of the fauna of the deep South and should be considered as a

candidate for special attention by wildlife agencies - though far from threatened or endangered. The type

locality is already largely destroyed by housing and ranching development.

The Sandhills as a whole are massive and thus an enormous area of suitable habitat exists in which

this taxon may very well occur. I have located one area in Orangeburg County, South Carolina in particular

that looks promising in regard to the discovery of this new taxon there. Five other Satyrium have already

been found there plus a rare and unusually marked colony of Fixsenia favonius that is definitely not the

nominate subspecies and may represent the southern most known colony of subspecies Ontario (W.H.

Edwards, 1868)

Kimble (1965) mentions three edwardsii specimens in the American Museum of Natural History

labeled from Florida and collected by Palm. One is labeled “Kissimmee”. This is in the Orlando area and

is well into peninsular Florida. John Calhoun (1997) examined these specimens and has determined that

they are typical of northern nominate edwardsii and that they are surely mislabeled. If edwardsii was to

occur in Florida, the panhandle would be the most likely area. It would also be the new subspecies

described herein.

Satyrium edwardsii meridionale Gatrelle, new subspecies

Diagnosis and description. The male (Fig. 2) and female (Fig. 7) of meridionale are marked much alike. Dorsally,

most Satyrium edwardsii edwardsii and S. edwardsii meridionale are virtually identical. The only difference being the size

and frequency of the red spot on the hindwing margin at the tail (Fig. 11). Two of the three known females of meridionale

have this spot, but it is small and faint. All 8 male meridionale have this spot but it is likewise very small and faint. In

nominate edwardsii this spot is not always present but is commonly very prominent, especially in females. Ventrally,

nominate edwardsii has the postmedian band consistently formed of distinctly round or ovoid spots with prominent white

outlines. In meridionale these spots are ovoid to connected bars and are not as prominently outlined with white, especially on

the forewings. Typical of, and consistent with, southern Satyrium subspecies, the markings along the outer margin of the

hindwings of meridionale are enlarged, elongated and thus have bolder red-orange marking in this area. The tails are nearly

twice as long on meridionale as in edwardsii for both sexes (unfortunately the tails are missing on the holotype). The wing

expanse of mounted specimens of nominate edwardsii varies from 20 to 30 mm. (small males to large females). In the

meridionale type series the expanse ranges from 26 to 35 mm. (small male to largest female). Meridionale basically

averages 5 mm. larger in each sex - which is quite a bit for a small species. Summation of meridionale characters: large

size, frequent but faint marginal red spot on DHW, spots of ventral postmedian bands tending to become bars and less boldly

outlined with white, very long tails, expanded red and larger spots on VHW margin, VHW blue spot tending to have prominent

gray-blue inner cap. The male stigma of edwardsii (including meridionale ) is much narrower than the stigma of either

calanus or caryaevorum and serves as the best character to separate males of these taxa when their postmedian VHW bands

are atypical.

Types. Holotype d (Fig. 2): SOUTH CAROLINA: Aike n County, along south boundary of Aik en State Park, 1 June

1990 (leg. R. Gatrelle). Allotype 9 (Fig. 7): SOUTH CAROLINA: Aiken County, along south boundary of Aiken State Park,

1 June 1990 (leg. R. Gatrelle). Paratypes : 7c? d, 29 9: All GEORGIA: Cobb County, Pine Mountain various dates: 4dd,

19, 10 June 1973; \d, 30 May, 1977; Id, 2 June, Id, 19,5 June 1979. All paratypes leg. A Towers. The holotype and

allotype are currently deposited in the Museum of the Hemispheres, Goose Creek, SC. All paratypes are deposited in the

Florida State Collection of Arthropods, Gainesville, Florida.

Etymology. Meridionale is a neuter latinization meaning characteristic of the south or southern. Its common name

is Sand hill Hairstreak.

Remarks. It must be remembered that the further south one goes below New Jersey that the ranges of edwardsii and

meridionale shift in opposition from north - south to west - east. I have examined all the edwardsii specimens in the FSCA

Gainesville and the MOTH collection here in Goose Creek. Some of the more pertinent specimens are from Massachusetts,

Missouri and New Jersey. Massachusetts specimens are typical edwardsii in size and markings. A series from Oak Ridge,

New Jersey are beginning to show an inclination to meridionale in that some are larger - though not as large as meridionale.

The postmedian spots on these New Jersey specimens are still very round and their tails on the short side. I would still refer

to these as the nominate subspecies and not a blend zone population. The blend zone will be in Virginia and/or North Carolina

east of the mountain region of those states. I also expect the blend zone in the coastal area of those states to be rather large.

This remains to be determined and I would be happy to receive specimens (and return them) to help assess where this area is.

It is my expectation that the populations in the North Carolina Sandhills near South Carolina will be referable to meridionale

but this remains in question. Missouri specimens are typical of edwardsii in the western part of its range. They are larger

than typical Canadian and Appalachian specimens, but are very characteristically marked and with shorter tails. True

meridionale is strictly a taxon of the deep South. Intermediate populations should be referred to as nr. (near) edwardsii or

nr. meridionale whichever is more appropriate for a given area. I am not entirely comfortable with the series from Cobb

County. Both females paratypes from there are very large as are most of the males. But one male is atypically small.

Specimens in this area are certainly near the northern edge of meridionale’s range.

DISCUSSION

As stated earlier, clinal subspecies are usually the least evolutionarily distinct. While it is clear that

S. edwardsii meridionale is a clinal subspecies, its geographical location in the Sandhills region indicates

evolutionary significance as well. Twenty million years ago, this area was the coast of southeastern North

America before the current lower coastal plain was geologically formed. The sands of the Sandhill region

were once dune and beach deposits. While the area of central Florida is often referred to in lit as a refugium

area from which various unique taxa arose during times of glacial retreat and advance, the Sandhills region

is a much older area that provided the same type of evolutionary opportunity. Indeed there remain today a

few butterflies that are still endemic to this region of origin. They are Neonympha mitchellii francisi,

Parshall & Krai, 1989, Neonympha helicta helicta (Hubner, 1806), Chlosyne ismeria ismeria (Boisduval

& LeConte, 1833), Chlosyne gorgone gorgone (Hubner, 1810), and Poanes aaroni minimus Gatrelle,

2000. In addition, the Satyrium that are sympatric with meridionale at its type locality exhibit

morphological characters that seem to point to the possibility that this area was the evolutionary origin of

the eastern North American Banded Hairstreak group of Satyrium species.

A coworker and I are in the process of working out just what these other entities at the meridionale

type locality are. One is what we currently understand to be calanus m.falacer (Figs. 5 & 10). The other

two may be forms of one variable undescribed species - or, one an undescribed southern subspecies of

Satyrium caryaevorum (McDunnough, 1942) (Figs. 3 & 8) and the other an undescribed species that is the

(or a) link to the ancient ancestor of all three of these taxa (Figs. 4 & 9). It should also be mentioned that S.

titus mopsus and S. liparops liparops are sympatric with these other Satyrium at the type locality and that

Satyrium kingi kingi (Klots & Clench, 1952) has a colony one mile from the type locality in the Edisto

River basin.

The undescribed species at this site is of special interest here as many specimens of it have the red

bar at the anal angle expanded to almost as prominent as in species edwardsii (see enlarged insets on Figs.

4 & 9). Also, as mentioned in the description above, one of the distinguishing characters of meridionale is

the tendency of the ventral postmedian band to be composed of dashes and away from spots as in nominate

edwardsii. All of which points to the phenotypic evolutionary closeness of all the taxa at this site.

A few other unusual taxa occur here most notably: Atrytone arogos arogos (Boisduval & LeConte,

1852) (only known South Carolina colony), Lycaena phlaeas americana Harris, 1862, and the southern

subspecies of Mitoura hesseli Rawson & Ziegler, 1950 (in press)(only known South Carolina colony).

None of these occur in Aiken State Park but are all found immediately outside of it on private property.

Thus, unless steps are taken to protect these unusual populations they are all at severe risk of destruction via

development. It is also the type locality of Neonympha helicta helicta by way of neotype designation.

I think it is very likely that the range of meridionale will eventually be determined to extend from

the southern sandhills of North Carolina south through this region in South Carolina and Georgia, then

westward through the similar Black Belt region of Alabama and Mississippi to southeast coastal Texas.

However, it may not extend westward beyond the Mississippi River valley.

ACKNOWLEDGMENTS

I thank Don Lafontaine for copies of old literature and David Wright and Harry Pavulaan for their input.

LITERATURE CITED

ALLEN, T.J. 1997. The Butterflies of West Virginia and Their Caterpillars. Univ. of Pitts. Press,

Pittsburgh, 388 pp.

CALHOUN, J.V. 1997. Updated List of the Butterflies and Skippers of Florida (Lepidoptera: Papilionoidea

and Hesperioidea). Holo. Lepid. 4 (2), pp. 39-50. Gainesville, Florida.

6

GOCHFELD, M. & J. BURGER. 1997. Butterflies of New Jersey - A Guide to Their Status, Distribution,

Conservation, and Appreciation. New Brunswick: Rutgers Univ. Press, 327 pp.

GROTE, A.R., & C.T. ROBINSON. 1867. Descriptions of American Lepidoptera, No. 2. Trans, of the

Amer. Ent. Soc. 1 (2): 171-192.

HARRIS, L., Jr. 1972. Butterflies of Georgia. Univ. of Okla. press, Norman OK. 326 pp.

LAYBERRY, ROSS A., PETER W. HALL & J. DONALD LAFONTAINE. 1998. The Butterflies of

Canada. Univ. of Toronto Press, Toronto, Canada, 279 pp.

MICHENER, C.D. & C.F. DOS PASSOS. 1942. Taxonomic Observations on Some North American

Strymon with Descriptions of New Subspecies (Lepidoptera: Lycaenidae). Amer. Mus. Nov. (1210).

American Museum of Natural History, New York, 7 pp.

The Taxonomic Report

is a publication of The International Lepidoptera Survey (TILS).

(A Tax Exempt Non-Profit Scientific Organization )

The Taxonomic Report is projected for publication at the rate of 8-10 issues a year. Subscription/

dues for Volume Three are $45 US for domestic and $55 US for overseas subscribers. The subscription

year follows the calendar year. All issues are mailed 1 st class. At the end of each year, subscribers receive

that year’s volume on a record-only compact disc (CDR) for permanent archiving and reproduction for

personal use (i.e. a museum or university may make as many copies as needed in whatever format desired).

Non-members may receive individual issues in print any time for $10 per issue. Individual issues on CDR

to non-members are $25 per issue post paid. Subscriptions and individual issue orders should be made

payable to TILS; and mailed to: Treasurer, 126 Wells Road, Goose Creek, SC USA 29445-3413.

Articles for publication are sought. They may deal with any area of taxonomic research on

Lepidoptera. Before sending a manuscript, simply write TILS at the above address to set up discussion on

how to best handle your research for publication.

Everyday around the world, in jungles and urban areas alike, insect species and subspecies are

becoming extinct. Every year scores of taxa are lost that have not even been scientifically discovered and

documented. Thus, their extinction is unnoticed because their existence is unknown. They are unknown

simply because they have not been collected and systematically identified. Without systematic taxonomy

there is nothing. Without the collection, and exchange of specimens (information) there will be no

systematic taxonomy. Without amateur collectors the majority of the undiscovered species/subspecies will

vanish before they are discovered. Be it butterflies or moon rocks, collecting is the first step of access to all

other scientific information - and protection.

Donations are needed to support and further our efforts to discover and protect butterflies

worldwide. All donations are US tax deductible. Please help generously.

Donations should be mailed to: Treasurer, 126 Wells Rd., Goose Creek, SC 29445.

Checks should be made payable to: TILS. Please indicate if you need an individual receipt.

Catch us on the web at: www.tils-ttr.org

Volume 3

5 July 2001

Number 3

The Taxonomic Report

OF THE INTERNATIONAL LEPIDOPTERA SURVEY ,

AN EXAMINATION OF SOUTHEASTERN U.S. SATYRIUM

(LYCAENIDAE: THECLINAE).

PART TWO:

THE IDENTIFICATION AND DELIMITATION OF NOMINATE SATYRIUM LIPAROPS

AND THE DESCRIPTION OF A NEW SUBSPECIES FROM

WEST CENTRAL PENINSULAR FLORIDA.

RONALD R. GATRELLE 1

126 Wells Road, Goose Creek, South Carolina 29445-3413

IDENTIFYING NOMINATE SATYRIUMLIPAROPS

The name Thecla liparops was introduced into the scientific literature by Le Conte in 1833. This

name was based on a painting by John Abbot (Figs. 10/15) which in turn was based on that population of

this taxon that is resident to the region of upper Screven County, Georgia. Abbot’s paintings are exquisite

and life like. Unfortunately, the figures in the original description are not Abbot’s originals but poor copies.

In the publication process of that time copyists were employed who were obviously greatly inferior in their

artistic ability to that of John Abbot. These copies are almost cartoon like and while usually recognizable,

are inaccurate representations of the taxon being presented. But even the finest paintings and photographs of

butterflies relay nothing to us of the natural degree of variation that occurs in a given wild population.

Scientific names are not really names. They are technical labels which are affixed to organisms to

distinguish and organize them according to their present relationships with near relatives as attained by their

past evolutionary path. Each unique identifying label (name) is affixed to a specific population and can not

be moved by subsequent workers to apply to another population of a different evolutionary station - be it

another species or subspecies. The linguistic identity of an organism is understood by these Latinized

scientific labels. The biological identity of these same organisms is understood by the designation of a type

specimen. In the case of Le Conte’s liparops there is no type. It is the custom of some to consider an

original illustration (painting) as the type. (This is a scientific absurdity in my view. The fact that this has

been allowed by the ICZN (International Code of Zoological Nomenclature) is one of the primary factors

that has made it difficult for today’s taxonomists to deal with sibling and cryptic species.)

Figures 1-23. Satyrium liparops subspecies. Figs. 1-4. aliparops. Figs. 5-9. strigosum. Figs. 11-14, 16-19. liparops.

Figs. 20-23. floridensis. Figs. 10/5. Copies of Abbot paintings from Le Conte’s original 1833 description. Figs. 1-2. D/V

c? aliparops: Colorado, Jefferson Co., Chimney Gulch, 4 July 1981 (leg. M. Fisher). Figs. 3-4. D/V 9 aliparops : Colorado,

Douglas Co., Baldwin Gulch, 12 July 1975 (leg. M. Fisher). Figs. 5-6. D/V d* strigosum : Massachusetts, Sherbom, 2 July

1973 (leg. Willis). Fig. 7. V <? strigosum: Michigan, Cass Co., Wakelee, 1 July 1973 (leg. unknown). Figs. 8-9. D/V 9

strigosum : Massachusetts, Sherborn, 5 July 1973 (leg. Willis). Figs. 11-12. D/V NEOTYPE d* S. 1. liparops: Georgia,

Screven Co., Millhaven Plantation nr. Brier Ck., 9 June 1994 (leg. Gatrelle). Figs. 13-14. D/V 9 liparops: Florida, Liberty

Co., nr. Torreya St. Pk., 10 May 1975 (leg. Gatrelle). Figs. 16-17. D/V d liparops: South Carolina, Orangeburg Co., nr. Bull

Swamp, 24 May 2001 (leg. Gatrelle). Figs. 18-19. D/V9 liparops: South Carolina, Charleston Co., Hwy 17 at Boone Hall

Plantation, 19 May 1974 (leg. Gatrelle). Figs. 20-21. D/V HOLOTYPE d* S. 1. floridensis : Data on text page 7. Figs. 22-23.

D/V Allotype 9 S. 1. floridensis: Data on text page 7. (All photos by Joe Mueller. Specimens X 1.25. D=dorsal, V=ventral.)

In examining the taxon Satyrium liparops liparops (Leconte, 1833) we must first determine which

geographic population (and thus what evolutionary entity) this label was affixed to. Then we must examine

a large enough sample of specimens from that region to understand what the normal morphological

parameters are within which this biological entity is defined. The only person to undertake this was the late

Harry Clench in 1972. Clench’s paper is foundational to this current study. I shall only give some summary

and highlights of it here and urge the reader to consult the entire paper.

In his 1972 paper titled: The Boundary Between Satyrium liparops and its Subspecies strigosum

(Lepidoptera: Lycaenidae), Clench gives a thorough account of how this species was originally described.

He explains why Boisduval did not want his name associated with this new species and how it became

attributed to Le Conte alone. Clench establishes that the type locality should be Screven County, Georgia

where Abbot lived and collected his liparops specimens. Clench stated the following on page 12.

The type locality of liparops is given in the original description simply as “Georgie.” Klots (1951) designated

Screven Co., Georgia, without explanation, but presumably because Abbot lived there. There is interesting

confirmation of this, however, in the common name that Abbot gave to liparops (see above [Abbot called liparops the

Ogeechee Brown hair streak butterfly]). Ogeechee is the name of the river that forms the southwestern boundary of

Screven County; it is also the name of a small creek that courses through the middle of the county; and finally, it is the

name of a small town, also in the county. We many never know which of the three Abbot had in mind, but he

undoubtedly found his liparops somewhere in Screven County.

I will add that Abbot’s residence was near Brier Creek (which is actually a small river) just to the

north of the town of Sylvania. Ogeechee Creek flows just to the west of Sylvania. It is my opinion that it is

this local Ogeechee near his home that Abbot was referring to. The significance here is that this places the

type locality not only in Screven County but in its northern half. The southern two thirds of Screven County

lies in the lower coastal plain and is dominated by coastal maritime forest and swamps. The

northern/northwestem area of the county is in the upper coastal plain (Harris, 1972) and is dominated by the

Sandhills Region which is largely xeric in nature. I agree with Klots and Clench that Abbot’s liparops was

found in and reared from a population near his home in upper Screven County, Georgia.

Clench discussed the absence of a type specimen and would have designated a neotype but did not

because he felt none of the specimens he had found were geographically close enough to where Abbot first

found liparops to be a proper biological representative of this taxon. The closest geographic specimen he

had found in 1972 was from 10 miles north of Savannah, Georgia, in Chatham County. This was about 35

miles from Screven County (and 50 from the type locality as delimited by this paper). This was very

perceptive on the part of Clench as he stated the following on page 3.

The nature of this change [in phenotype] is such that 35 miles is by no means close enough for the [Chatham Co.]

specimen to be reliably representative.

This sentence clearly relays Clench’s technical view that a neotype must not come from the coast of

eastern Georgia and that is must come from far enough inland to be a true representative of the original

Screven County population. It goes without saying that it would be totally improper, in Clench’s learned

opinion, to designate a neotype from southern Georgia or farther to the south in Florida. If Clench would

have thought that proper he would have done so as he had several specimens from those areas. His

Chatham county specimen was also in “poor” condition and possessed a small to medium sized red spot on

the dorsal forewing - a character which Clench considered transitional to subspecies S. 1. strigosum

(Harris, 1862). It is apparent to me that Clench suspected that the population which is true liparops in

Screven County would turn out to not be a large patched population. He was correct - it is not.

I have collected one specimen of liparops in Screven County. The specimen (Figs. 11-12) is a male

and was collected 9 June 1994 along the west side of Brier Creek on Millhaven Plantation in the northern

portion of the county. I am aware of no other specimen from Screven County. I here designate this unique

specimen as neotype of Thecla liparops Le Conte, 1833. This is both necessary and appropriate to provide

3

a biological entity and biogeographical population on which the name liparops liparops is based. I have

placed a red label on this specimen that reads (all hand written): NEOTYPE, Thecla /zparops, Le Conte

1833, designated by R. Gatrelle in TTR 3:3, June 2001. There is a white data label on the specimen with

the hand written information of its origin as follows: 9 June 1994, Screven Co., GA, Millhaven Plantation

nr. Brier Ck. A third small white label states: Ronald R. Gatrelle collector. This action further defines and

restricts the type locality of Satyrium liparops to the northern third of Screven County.

In his paper, Clench focused solely on the size of the fulvous patch in defining subspecies liparops

and strigosum. As we shall see this was an error. One of the more significant statements Clench made in his

paper is his acknowledgement that other morphological features (which he totally omitted fromhis analysis)

are less variable then the fulvous spot. He states on pagel3.

For present purposes I have adopted the development of the fulvous forewing patch as the primary trait separating

the two subspecies, but it should be borne in mind that other relevant characters also exist, and some, at least, do not

vary in the same geographic pattern.

These unidentified characters are: tail length, ventral ground color, degree of contrast between the

white in the stripes and the ground color, and the pattern and amount of red along the margin of the ventral

hind wings. In distinguishing liparops liparops and liparops strigosum these characters are more

consistently different between the two subspecies and thus more indicative of their evolutionary subspecific

relationship. Had Clench fully incorporated these characters into his analysis he would not only have come

away with a much different diagram of the ranges of liparops and strigosum but an entirely different

definition of these taxa. He would have determined that the fulvous patch, while a very pretty and noticeable

character, was nonetheless merely a variable character in both liparops liparops and liparops strigosum

that occurred most often in the extreme southeastern part of the range of liparops liparops. In other words,

the size and frequency of the red fulvous patch in liparops and strigosum is only a minor secondary

character with the above mentioned set of characters being the primary differentiating subspecific elements.

The fulvous patch is present in all subspecies of liparops. It is smallest and least frequent (unusual

or rare) in subspecies S. 1. strigosum and S. I aliparops ( Michener and dos Passos, 1942). It is

occasional to frequent in subspecies liparops. It is largest and most frequent (usual) in the Canadian

subspecies S. I fletcheri (Michener and dos Passos, 1942) and (always present) in the new subspecies

described herein from west central Florida. In this new Floridian taxon this area is a yellowish burnt-

orange while in all the other subspecies it is a red, or rust, orange (when present).

Clench gives a thorough and accurate historic biogeographical assessment of liparops in the

Southeast and correctly determines that two subspecies are present and that they, as evidenced by a narrow

step cline, are the product of two distinct subspecific evolutionary paths that have now come into hybrid

contact. He and I are in agreement on this. We differ on two points. One I have already dealt with, which is

that Satyrium liparops liparops is most properly defined by the set of characters mentioned above and not by

its variable fulvous patch - which is, unfortunately, the only character he took into consideration. The other

is that the discovery of a massive population further to the south in Florida adds a previously missing and

significant piece to this species subspecific evolutionary puzzle that dramatically changes the area and

context of his step cline.

In 1973, the year after Clench published this paper, Dr. Larry N. Brown (1976) discovered a

population of liparops well to the south of the then known range of this taxon in Citrus County, Florida. This

population is now known to be a large and robust one that also encompasses the Withlacoochee State Forest

in Hernando County. Over the years various collectors have often found liparops in this region in large

numbers. However, there has never been a taxonomic assessment of this population against nominate

liparops. I have done this and determined that this population in west central Florida is quite distinct

phenotypically and evolutionally and warrants recognition as a subspecific entity.

In reference to Clench’s paper, this population represents his hypothesized relict from the Florida

refugium rather than those he understood as such in northeast Florida and southeast Georgia. This discovery

of the true Wisconsin glacial relict in conjunction with a proper phenotypic definition of nominate liparops

and a comparison of this relict’s unique phenotype against true nominate liparops from Screven County,

Georgia, necessitates that the step cline is actually further to the southeast of where Clench estimated it was.

The tension zone area and population is in fact that which Clench called nominate liparops. This is not a

radical position as Clench made it very clear in his paper that his findings were very subjective due to the

limited number of specimens in his sample and resultant imprecise information he had to work with. The

tenuous geographic placement of his step cline in his own mind is evidenced by the following from his page

16.

Satyrium liparops is altogether too rare to expect anything that approaches this ideal in the near future. Mr.

Neel’s samples, however, are remarkably large for such a scarce species, and they are well disposed. Accordingly I

have attempted such a map, even though it has to be approximate rather than precise and definitive.

There is one other very important factor in all this that is not detectable through museum specimens

or laboratory analysis. Collectors often pick over specimens they find in the field and only take those which

possess some special feature that they are looking for. When these specimens are viewed as a museum

series they thus give the wrong impression as to what the actual variation in size and appearance is of the

wild population from which they were taken. When collectors “go after” southeastern liparops they are

usually “looking” for those specimens with the showy orange patch on the forewings. They may either not

curate or not even catch those specimens which lack this character.

I have not only viewed curated specimens of liparops from various areas of Florida (and collected

it in the panhandle), I have spoken with those who have witnessed the natural variation of this entity in the

field. Those who have collected the Citrus/Hemando region liparops have told me that all the specimens

they have seen have the orange patch in both sexes and that it is usually very large. (This is several hundred

total specimens witnessed over 20 years.) The field observations of Jeff Slotten are uniquely pertinent to

our understanding of where the step cline zone between liparops and the new Floridian subspecies lies.

Slotten is a well known lepidopterist and long time resident of Gainesville, Alachua County,

Florida. Alachua County lies in the middle of what Clench speculated would be the range of nominate

liparops as he misunderstood it. Slotten has a great deal of field experience with liparops in Alachua,

Citrus and Hernando counties. Jeff states that in the Citrus and Hernando County area he has only seen

individuals with prominent orange patches on the dorsal fore wings. However, in Alachua County he has

seen many specimens with very restricted or no orange on the dorsal fore wings. He has also told me that the

Citrus- Hernando population has a brighter patch than those in his home county of Alachua. Thus, the blend

zone between the west central Florida subspecies and true nominate liparops begins somewhere to the

south of Gainesville, and in conjunction with Clench’s analysis, continues to the northeast into southeast

Georgia.

In light of what we now know of the range and variation of liparops in Florida, we see that what

Clench defined was not the southern most evolutionary subspecific unit of liparops but the tension zone

between true nominate liparops of the southern US mainland and the then unknown subspecies that inhabits

west central peninsular Florida.

There are three primary evolutionary units within the species liparops. Two of these units have each

evolved into two subspecies while the third has one. The new subspecies described herein from Florida

comprises one unit and is evolved from the Florida refugium as hypothesized by Clench. Liparops liparops

and liparops strigosum form another unit with strigosum having arisen from liparops with liparops being a

very old taxon of the Sandhill refugium from Georgia to Mississippi. The third unit is comprised of liparops

aliparops and liparops fletcheri (Michener and Dos Passos, 1942) with fletcheri having arisen out of

aliparops with aliparops arising from a western or southwestern refugium. Fletcheri and strigosum, as

residents of glaciated North America, are the most recently evolved taxa.

DIFFERENTIATING LIPAROPS AND STRIGOSUM

When producing his 1972 paper, no South Carolina or Mississippi specimens where known to

Clench. While in press, he received a letter from myself and a drawing of a female liparops I had collected

here in Charleston, South Carolina. He included a footnote on this at the bottom of his page 16. On his page

22 he also mentions that after the manuscript had been completed he received a series of nine liparops

collected along the coast of Mississippi by Kergosien. My specimen had a medium sized fulvous patch; five

of the nine Mississippi specimens had no patch. However, four of the Mississippi specimens did have small

red patches. Most importantly however, Clench remarked that all specimens had long tails and more

extensive orange lunules on the underside of their hindwings than northern populations. These are two of the

main characters that differentiate southern liparops from northern strigosum.

Since the early seventies, I have collected and observed scores of nominate liparops in Charleston,

Berkeley, Jasper, Aiken and Orangeburg counties South Carolina. All of these populations are nominate

liparops. I have also personally collected nominate liparops in Liberty County, Florida (Figs. 13-14). Red

patched individuals occur in all these populations with great regularity. This patch, when present, is usually

small to medium sized but some individuals have large prominent red fulvous patches.

Nominate liparops ranges from the coast of South Carolina across the southern states and probably

into eastern Texas. Specimens I have collected, or observed in other collections, from the mountains of

western North Carolina and extreme northern Georgia are near subspecies strigosum. In these specimens the

tails are markedly shorter and the red of the ventral hindwing margins reduced - however the white lines on

the ventral are still fairly prominent and the ground color variable. It is my opinion that these populations

are part of the blend zone between these two subspecies.

Strigosum was described from Massachusetts. This is fortunate as the populations of strigosum

there are very distinct from southern liparops. The blend zone between strigosum and liparops is expected

to be wide. It is inevitable that various workers will define the characters and region of integration between

liparops and strigosum differently. Thus, it is pointless for me to do so here. I will simply say that my view

is that this blend zone is likely wide and covers much of southern Virginia and northern North Carolina.

Photos of liparops I have seen from southeastern North Carolina indicate that these may well be good

liparops liparops.

True strigosum from the New England states is very different from liparops of the deep south. The

tails on liparops liparops are doubled and quite long even on males (Figs. 11-14,16-19). In strigosum

males have very small tails and often only one on each hindwing, and while females have two tails they are

still very short compared to the two southern subspecies (Figs. 5-9). Table I gives the minimum and

maximum measurements of tails on specimens I have seen from the region of their respective original

descriptions. The strigosum measurements are from 10 specimens from Sherbom, Massachusetts; those for

liparops are from a series of 65 specimens from Charleston, Aiken and Orangeburg counties South Carolina

and the one male from Screven County, Georgia; those for floridensis are from the 28 specimens that

compose the type series from Hernando County, Florida.

TABLE L LENGTH

SUBSPECIES

ui-1.50 CU2-3.50

cui -2.50 CU2-5.20

cui-2.50 CU2 -4.50

In addition to tail length, three ventral features differentiate subspecies liparops and strigosum. In

liparops the white lines that highlight the bands are much bolder, the red spots along the outer margin of the

ventral hindwings are consistently larger, and the ventral ground color in liparops is a dark purplish brown

in fresh males and deep brown in females while in strigosum the ground is a lighter warmer brown.

6

Satyrium liparops floridensis

The relict subspecies of liparops in west central Florida is unique in the yellowish burnt-orange

color of its dorsal fulvous patch. Specimens in the tension zone of the step cline to liparops liparops

occasionally have this color, or very close to it, on their forewings also. However, in the tension zone many

individuals are also found with little or no fulvous and others in which the fulvous is a dusky red-orange as

in the more northern races (see Slotten’s comments on page 5). This is the only subspecies of liparops that

always has fulvous on the forewings. In Clench’s 1972 paper the maximum size of the fulvous area in

specimens he had before him was 6x7 millimeters. Several specimens in the type series have this patch up

to 8 X 9 millimeters. These specimens are the same overall size as nominate liparops from Charleston,

South Carolina. Likewise, as seen in Table I, the tails on this new subspecies are extremely long also even

though the adult size is basically the same as in subspecies liparops.

In this new subspecies the red markings on the ventral hindwings are not greatly different from those

of nominate liparops - being only somewhat more expansive. While I consider the amount of red on the

ventral surface to be a subspecific character between liparops and strigosum, I considerer this feature of

minimal import in assessing the two southern subspecies.

The major feature of the ventral surface is the dramatic contrast between the dark chocolate brown

ground color and the vivid white striping of the banding in both sexes. In subspecies aliparops,fletcheri

and strigosum this white banding is occasionally almost obsolete in many specimens, especially in

aliparops. These differences are readily observed from the specimens figured on page two and further

verbal description would add nothing more to them.

There can be no question about the subspecific distinctness of this Floridian segregate. Further, the

location and population to which the name liparops is affixed, by the rules of science, renders that name

totally unavailable for this unique and beautiful entity. It is my privilege to have been able to work out the

taxonomy of this subspecies and give it a scientific identity (name). Many others have much more

experience with this in the field than I, beginning with Dr. Larry N. Brown on 15 May 1973.1 had thought

about naming it after one of the fine field lepidopterists familiar with it. But that would be unfair to the ones

not so acknowledged. I therefore simply affix an identity to it in reference to the state of Florida from which

it arose evolutionally and to which it is presently confined.

Satyrium liparops floridensis Gatrelle, new subspecies

Description. Male (Figs. 20-21). Head, thorax, abdomen and appendages as in nominate liparops. Forewings:

dorsally, uniform dark brown ground with large median yellowish burnt-orange patch occupying over half the surface of the

wing; an elongate stigma is situate along the coastal margin; ventrally, ground color deep chocolate brown (purplish in fresh

specimens), white dash lines prominent and far apart with the areas between the lines the same color as ground or only

slightly darker and otherwise unmarked. Hindwings : dorsally, ground same as on forewing and unmarked except rarely with a

slight amount of red orange scaling along the outer margin in cell Cul; tails black with white tips very long and double with

one shorter at vein Cul and one longer at Cu2 with the longest usually over 5 millimeters long; along the entire outer margin

is a series of red spots with those is cells Cul and Cu2 capping black and blue marginal spots respectively, there is also a

thing white line ah along the margin just inside the brown fringe; there is a large black dot at the anal angle capped with white

and then red orange. Female (Figs. 22-23). In all aspects as in the male with the following exceptions. Forewings : dorsal,

lacks stigma; the fulvous patch tends to be more reddish but is likewise large; ventral, often with a series of small diffuse red

spots along the outer margin; ground color sometimes slightly lighter than in male. Hindwings: dorsally, the red orange

scaling along the outer margin is more frequent and larger to actually form a spot; longest tail often 6 millimeters long;

ventrally, the marginal red markings more pronounced than in male.

Types. ALL: FLORIDA. Holotype S (Figs. 20-21): Citrus Co., Withlacoochee St. Forest, Rd. 11, 2 May 1985 (leg.

Baggett). Allotype 9 (Figs. 22-23): Hernando Co., Withlacoochee St. Forest, 29 April 1979 (leg. Slotten). Paratypes: 8 d d\

18 9?: Hernando Co., Withlacoochee St. Forest: Id*, 6 9 9, 29 April 1979 (leg. Slotten); 5 <S d\ 3 9 9, 20 April 1980 (leg.

Baggett); 29 9, 25 April 1981 (leg. Baggett); ld\ 2 9 9, 1 May 1983 (leg. Godefroi); 1 9,28 March, 1 9,29 March, 1 9,22

April 2000 (leg. Slotten). Citrus Co., Withlacoochee St. Forest: 2 9 9,2 May, 1 d\ 27 April 1985 (leg. Baggett). The Holotype

and allotype are currently deposited in the Museum of the Hemispheres (MOTH), Goose Creek, South Carolina. The 26

paratypes are deposited as follows: MOTH, Goose Creek, SC. (5), FSCA, Gainesville, Florida (16), personal collection of

Jeff Slotten (5).

Type locality. Withlacoochee State Forest, Citrus County, Florida.

Etymology. Named after the state of Florida. I recommend Sparkleberry Hairstreak as its common name as this

shrub is both a primary larval host and usual adult nectar source at the type locality.

Remarks. It would not be unexpected to eventually find that floridensis ranges across mid Florida to the Atlantic

coast. The historic record from Flagler County, Florida, while farther to the north and on the east coast may be of this

subspecies. I say this as it is very typical for taxa to range farther north on the east coast of Florida than on its west coast.

However, the geologic history of Florida is such that at one time the west coast area extended vastly to the west into what is

now the Gulf of Mexico. There is indication that some taxa on the east and west coasts of Florida evolved from different

routes. Sparkleberry ( Vaccinium arboreum Marshall) is the primary host of S. liparops floridensis in the Withlacoochee

State Forest area. This butterfly is local but may be fairly common where found.

ACKNOWLEDGMENTS

I thank Jeff Slotten for his special contributions toward the success of this research through his field

experience with this species throughout Florida. I also thank the late Harry Clench with whom I often

corresponded and who shared much information with me on Southeastern Hairstreaks. I also thank the late J.

F. Gates Clarke of the Smithsonian (USNM) for supplying a color photograph of the original Abbot figure.

Dr. Clarke was also a big help to me when I began investigating the Butterflies and Skippers of this region

25 years ago.

LITERATURE CITED

CLENCH, H. K. 1972. The Boundary Between Satyrium liparops and its Subspecies strigosum (Lepidoptera:

Lycaenidae). Annals of the Carnegie Museum, Pittsburgh. Vol. 44, pp. 11-24.

BROWN, L. N. 1976. A Population of the Striped Hairstreak, Satyrium liparops liparops (Lycaenidae), in West-

Central Florida. Journal of the Lepid. Soc. Vol. 30:3, page 213.

HARRIS, L., Jr. 1972. Butterflies of Georgia. Univ. of Okla. press, Norman OK. 326 pp.

The Taxonomic Report

is a publication of The International Lepidoptera Survey (TILS).

(A Tax Exempt Non-Profit Scientific Organization)

The Taxonomic Report is projected for publication at the rate of 8-10 issues a year. Subscription/ dues for

Volume Three are $45 US for domestic and $55 US for overseas subscribers. The subscription year follows the

calendar year. All issues are mailed 1 st class. At the end of each year, subscribers receive that year’s volume on a

record-only compact disc (CDR) for permanent archiving and reproduction for personal use (i.e. a museum or

university may make as many copies as needed in whatever format desired). Non-members may receive individual

issues in print any time for $10 per issue. Individual issues on CDR to non-members are $25 per issue post paid.

Subscriptions and individual issue orders should be made payable to TILS; and mailed to: Treasurer, 126 Wells

Road, Goose Creek, SC USA 29445-3413.

Volume 3

12 August 2001

Number 4

AN EXAMINATION OF THE MITOURA (LYCAENIDAE) IN THE

SOUTHEASTERN UNITED STATES: WITH THE DESCRIPTION OF

A NEW SUBSPECIES OF MITOURA HESSELI.

RONALD R. GATRELLE

126 Wells Road, Goose Creek, South Carolina 29445

ABSTRACT. Four subspecies of Mitoura grynea occur in the United States east of the Mississippi River. The

nominate subspecies occupies this entire area except for Florida and the coastal regions of South Carolina and Georgia. M

g. grynea is usually associated with Juniperus virginiana. A neotype is designated for Lycus gryneus from Aiken County,

South Carolina. M. grynea smilacis is endemic to the southeastern coastal islands and coastal mainland from about

Brunswick Georgia north to the Santee River delta of South Carolina. Smilacis ’ range corresponds to that of Juniperus

silicicola in that area. A neotype is designated for M grynea smilacis from Chatham County, Georgia. M. grynea sweadneri

is endemic to eastern Florida (especially along the coast) from about Jacksonville southward. M g. sweadneri rarely has any

fulvous scaling above. Sweadneri’s range corresponds to that of Juniperus silicicola in that area. A fourth subspecies is

discussed but not described. This entity inhabits west central Florida. This subspecies tends to have yellowish red fulvous

above and yellowish green ground below Mitoura hesseli is represented in the eastern and southern United States by two

subspecies. Mitoura hesseli hesseli ranges from Maine south through Virginia to northern North Carolina. Mitoura hesseli

angulata Gatrelle is described from Aiken County, South Carolina. It is larger, ventrally darker, has a more angulate ventral

median band and longer tails than nominate hesseli. M. h. angulata ranges from the southern sandhills of South Carolina

southward into northern Florida. The populations in southeastern North Carolina are intermediate. The neotypes of grynea

and smilacis and the holotype of angulata are currently deposited in the Museum of the Hemispheres, Goose Creek, South

Carolina.

Additional key words. Genitalia, host associations, isolation.

MITOURA GRYNEA

MITOURA GRYNEA GRYNEA

With Mitoura grynea (Hiibner, 1819) we again come to a taxon which was likely discovered by

John Abbot in eastern Georgia. This is somewhat problematic as Mitoura grynea smilacis (Boisduval and

Le Conte, 1833) is also an Abbot species from this same region (Forbes, 1960). There are no type

specimens for either of these taxa. In order to insure the continued prevailing usage of these names,

neotypes are designated herein for both of these taxa.

The first name applied to this hairstreak was Papilio damon Stoll, 1782 (Figs. 19-20). This name,

however, was preoccupied by a European Blue of the same name. Both Hiibner’s Lycus gryneus and

Polyommatus damastus Godart, 1824 were new names proposed for the preoccupied damon (Forbes,

1960). The type specimen of damastus is extant in the National Museum of Natural History, Paris. This

specimen however, is a Calycopis cecrops (Fabricius, 1793) and not a grynea (see Johnson, 1991).

The original description of Papilio damon by Stoll is typical of the very brief descriptions of that

day. It is given in both Dutch and French. Here is the Dutch version followed by the English translation.

Fig. C. D. Damon. Behoort onder het Gezin der Schildrups - Pagies {Pap. Pleb. Rural.) en heft de groene

kleur op de onderzyde der vleugelen satynagtig glanzig. Men vindtze in Virginien.

Figs. C and D Damon. ... of the shield larvae - Belongs to the family Pap. Pleb. Rural and has a green color

on the underside of the wings that shines like satin. It occurs in Virginia.

As can be seen from the reproduction of the original figures, Stoll’s insect is what we are familiar

with today as Mitoura grynea. Stoll’s figures were based on specimens from Virginia.

Lycus gryneus Hiibner, was introduce in 1819 without description by the following simple caption

which simply references Hiibner’s name gryneus to Stoll’s description and figures. I have not been able to

locate a Hiibner figure of this and am not sure if there is one or not. This however, is of little consequence

and I have thus not pursued that aspect at length.

732. L. Gryneus. Damon Cram. 390. C. D.

To this point in time, all of the southern U.S. Hiibner names I have investigated over the years have

been based on material collected by John Abbot in Georgia. Abbot collected many species near his home in

what is today’s Burke and Screven counties, Georgia. He also collected at least a few of his new species

only in the coastal area of Georgia. We know this because the species he painted either do not occur in

Burke or Screven counties at all, or if they do, not in the subspecies he depicted. The most certain

exclusively coastal Abbot taxa are: Problema bulenta (Boisduval and Le Conte, 1834), Euphyes arpa

(Boisduval and Le Conte, 1834), Anthocharis midea midea (Hiibner, 1809), Satyrium calanus calanus

(Hiibner, 1809), Fixsenia favonius favonius (J.E. Smith, 1797), Hemiargus ceraunus antibubastus

(Hiibner, 1818) and Mitoura grynea smilacis (Boisduval and Le Conte, 1833).

The lepidopteran fauna changes greatly over the 60 miles from the Georgia coast to Screven and

Burke counties. This is a result of the differing geologic and ecological development of these areas. Several

species occur as one subspecies along the coast and another inland with less than 40 miles between them.

One such subspecies pair is Mitoura grynea grynea and Mitoura grynea smilacis.

The grynea in Burke County are part of the subspecific entity that has long been referred to as

nominate grynea over most of eastern North America. I have not yet found grynea in Screven County though

it is likely there. The grynea that occurs along the immediate coast of Georgia and its coastal islands is

subspecies smilacis. The Abbot painting of smilacis in its original description is clearly the coastal

segregate. Thus, this name is not a problem (we shall deal with this later). Stoll’s grynea, depicted under

the name damon, is clearly the northem/inland subspecies.

The problem is that it is possible that Hiibner’s name grynea may have actually been based on

Georgia’s coastal population too. This is a real possibility as species grynea is much more common along

the coast than inland. If this were to be the case, and because coastal smilacis is a very good subspecies,

this would mean that, 1) smilacis would be a junior synonym of grynea, 2) the name grynea would then be

restricted to the subspecies along the coast of Georgia and South Carolina, and 3) would require that the

grynea populations in the rest of eastern and Midwestern North America be given another epithet. This

would cause serious instability in the longstanding usage, and understanding, of the name grynea.

Regardless of whether or not there is a Hiibner depiction of grynea , and regardless of what it may

look like if there is one, the proper course of action is to focus on Hiibner’s equating of his name grynea

with Stoll’s name damon and therefore maintain Hiibner’s application of the name grynea to the

inland/northem traditional subspecies. This situation requires the designation of neotypes for both grynea

and smilacis to maintain nomenclatorial stability. I herein do this which maintains stability without

sacrificing the integrity of the two biological subspecies concerned.

The primary consideration was where to affix the type locality. I have various specimens from

Virginia which would accommodate the Stoll location (Figs. 22-24). However, the name was Hiibner’s and

based on Abbot material. It was thus appropriate to align the type locality with the work of Hiibner and

Abbot and use a southern location. I have observed just a few grynea in Burke County (I have not been at

the right place at the right time) and collected only one. Unfortunately, it is in poor condition and not

suitable for a neotype. It is definitely the nominate grynea phenotype however. A small series of grynea

which I have collected in neighboring Aiken County, South Carolina are of the same biogeographic

population as those in adjoining Burke County. I have therefore chosen to designate a specimen from Aiken

County, South Carolina as the neotype. The neotype of Lycus gryneus Hiibner, 1819 is a male (Figs. 29-30)

with the following labels and data. A red label with the hand printed words: NEOTYPE. Lycus gryneus

Hiibner, 1819 designated by R. Gatrelle in TTR 3:4 August 2001. A white label with the hand printed

words: March 29, 1988, Aiken State Park, Aiken County, SC. A small white label machine printed with:

collector, Ronald R. Gatrelle; and hand printed: d M. grynea. This specimen is currently deposited in the

International Lepidoptera Survey’s Museum of the Hemispheres, Goose Creek, South Carolina.

This same action was taken by H. A. Freeman (1952) in designating a neotype for Megathymus

yuccae (Boisduval and Le Conte, 1834) from Aiken County. This name was based originally on Burke/

Screven County specimens collected by Abbot. Therefore this action is not without precedent.

INTERMEDIATE POPULATIONS

I have discussed the geological formation of the Sandhill region and coastal area of Georgia and

South Carolina in other papers on the taxa in this area (Gatrelle, 1998, 1999, 2001). Before the arrival of

Europeans in this area, much of the butterfly fauna of the Sandhill region was isolated from the fauna of the

coastal marshes and pine-hardwood islands along the coastal plain of Georgia and South Carolina by a

dense jungle of swamp forests that lay between these two areas. Over the last 400 years this barrier has

effectively been removed by the activities of man. This alteration has allowed several sister subspecies to

extend their ranges toward each other in this area. This will eventually culminate in the contact of these

taxa and ultimately the genetic mixing of both. This in turn will result in the eventual extinction (by

absorption) of the coastal subspecies and the likely morphological altering of the inland ones.

M. grynea grynea (inland) and M. grynea smilacis (coastal) are subspecies of differing evolutional

lineages which are extending their ranges closer to each other due to the above ecological alteration. Any

area where they meet is thus a tension zone rather than a blend zone. The tension zone between grynea and

smilacis is very narrow. The populations I have experience with that pertain to this geographic change

from smilacis to grynea are in Bryan County, Georgia and Barnwell, Berkeley and Dorchester counties

South Carolina. This change in subspecies correlates with the range of their host trees in this same area:

Juniperus silicicola for smilacis and Juniperus virginiana for grynea (Radford et. al. 1968).

Bryan County, Georgia is a narrow and long county that runs from the Georgia coast inland to

Bulloch County. On its eastern side it borders Chatham and Effingham counties. There is a sizable colony of

M. grynea smilacis in the northeast comer of Fort Stewart Army base just inside Bryan County near the

junction of Bryan, Effingham and Chatham counties. Both J. virginiana and J. silicicola were present in this

area when I collected there in 1977. Dr. R. T. Arbogast directed me to this site. Dr. Arbogast was a long

time resident of Savannah and collected in that area of Bryan County often. This colony is the furthest

known inland colony of smilacis in northeast coastal Georgia. This area is only 60 miles south of where I

observed nominate grynea in Burke County. This indicates that intermediate populations may well occur in

Screven County which is only 30 miles from this colony.

Dorchester County, South Carolina is to the northwest of Charleston County. Givhans Ferry State

Park straddles Dorchester and Colleton counties and is 30 miles inland. In 1976 I located a small smilacis

colony in the Dorchester portion of the park about three Juniperus trees on a bluff overlooking the Edisto

River. The trees were quite old and I was not sure if they were virginiana or silicicola. My opinion is that

they were virginiana. I say were, as they were victims of Hurricane Hugo in 1989. The bulk of the

specimens from this colony were typical smilacis but some specimens I examined exhibited phenotypic

3

characters that leaned toward grynea. I consider this colony still taxonomically referable to as smilacis

(Fig. 39). The importance of the presence of specimens with some intermediate characters here (Fig. 40)

serves to demonstrate that true smilacis does not extend inland far from the coast.

Smilacis extends up the Cooper River into Berkeley County to Moncks Comer. There was once a

very large J. silicicola forest on the west bank of the Cooper River just south of Moncks Comer. This site

is now largely gone as it was destroyed in the construction of an upscale waterfront subdivision without

regard for the site’s unique native flora and fauna. As this colony was not far from my home I was able to

study it frequently. It had two full broods with the first peaking in late April (numbering in the thousands by

conservative estimates) and the second emerging from July to September. Dorsally red individuals were

very frequent. About 10% of the specimens at this site have the ventral median line tending toward

subspecies grynea (Fig. 42). I reared specimens from this colony twice on a Chamaecyparis thyoides L. I

have planted in my yard. I do not know how far north smilacis ’ range extends along the coast. 1

In 1977 and 1988 I collected and/or examined specimens of grynea (Figs. 35-36) in and around

Barnwell State Park in Barnwell County, South Carolina. The colony in this area is subspecies grynea.

However, some of the specimens there exhibit ventral characters that lean toward smilacis - smaller basal

hindwing spots and a straighter median band. Barnwell County is just across the Savannah River from

Burke County, Georgia and approximately 75 miles from the coast. The area is 24 miles south of the grynea

type locality at Aiken State Park in adjoining Aiken County.

As can be seen, I have not located a colony that is intermediate to subspecies grynea and smilacis.

What I have noted is that a small number of smilacis specimens in the Berkeley and Dorchester County

populations lean to grynea and that a few specimens of grynea in the Barnwell population lean toward

smilacis. The Dorchester County colony showed the most variation.

MITOURA GRYNEA SMILACIS

Thecla smilacis Boisduval & Le Conte, 1833. Here translated from the original French into English.

It has the carriage and size of Thecla Acaciae of Europe. The top of the wings is the same brown-blackish, with a

small whitish matte [flat finish] near the middle of the superior [upper] part; the lower wings have toward the end [tip]

two small pitted tails at the crest white as in similar species.

The lower part of the wings is of a less brilliant green than in the rubi, often washed with a little reddish, marked

beyond the middle of a transverse white stripe, winding and wavy on the upper wings, winding on the lowers, bordered

in front by a rust-colored faded imperceptibility with a green color. Between this stripe and the base of the lower

wings have another short transversal stripe, sinuate, of the same color. The borders of these two wings is marked by

two or three ashy crescents of which the intermediary is black in front, and the third aligned with two or three small

rust-colored spots, more or less distinct. The anal area is black, and near the fringe there is a small white marginal

line, almost nothing on the uppers.

The caterpillar is green, with blackish head and feet. It is marked with four rows of red spots, of which the two

dorsals are formed with similar spots, and one on each side formed with spots a little larger.

The chrysalis [pupa] is a grayish-brown, with the abdomen more light and reddish.

It is found in Georgia on the smilax. It is at present very rare in collections.

This species forms a small group with the Thecla chlorion and simaethis.

A most interesting aspect of this description is that the larval host is given as smilax and that it is

named after this plant. The genus Smilax is a modest sized assemblage of dioecious, herbaceous or woody

vines. While vines of this genus are frequently found growing in Red Cedar trees, grynea larvae do not feed

1 In editing this manuscript, Harry Pavulaan relayed that in 1999 he collected a female Mitoura in a stand of J. silicicola at

the inland edge of a salt marsh near Ocean Isle Beach in Brunswick County, North Carolina. He stated that the individual

tended more in overall phenotypic characters toward smilacis than nominate grynea. He also confined the individual on both

male and female branches of J. virginiana for a period of 14 days where she refused to oviposit.

upon it. The genus was described by Linnaeus so the name was known to be associated with these vines

well before the smilacis description in 1833.

The distinguishing subspecific taxonomic markings of smilacis are found on the ventral hindwings

and the dorsal forewings. The two markings at the base of the ventral hindwings of smilacis may be absent

(infrequent), dots (frequent) or aligned straight bars (frequent). They are never as in typical eastern grynea

where this lower marking is usually offset marginally in the shape of a V (Fig. 24). In the description

above, these two markings are described by the words: short, stripe and sinuate. In the copy of Abbot’s

painting they are two dots and in line (Fig. 21). Those smilacis specimens that have these markings present

as dots or absent are in this respect marked like subspecies M. grynea sweadneri F. H. Chermock, 1940.

Smilacis also resembles sweadneri in that the hindwing median line is straight or only slightly

wavy. This is very different than in grynea where this line is very crooked (Figs. 30 & 36). This difference

between grynea and both smilacis and sweadneri is produced by the alignment of the intercellular median

mark between veins Ml and M3. In grynea this line tends to lay horizontal along M3 and then bend upward

at its mesial end to veins M2 and Ml. In both smilacis and sweadneri the line in this interspace is vertical

(Figs. 26 & 28). These differences between smilacis and grynea and similarities between smilacis and

sweadneri point to smilacis ’ evolutionary closeness to sweadneri and distance from grynea.

Smilacis is virtually unknown in collections. To many workers, it was only known from the original

description and figures. It was therefore assumed by most of the older workers that smilacis lacked fulvous

above. This also led a number of the older taxonomists to simply consider smilacis a “form” of grynea that

lacked fulvous above. In actuality smilacis frequently has a good amount of red fulvous scaling on the

dorsal forewings, especially in females (Fig. 33). I have collected scores and observed hundreds of

smilacis along the north coast of Georgia and south coast of South Carolina. Fulvous specimens are more

numerous than all dark specimens in the spring brood, and in the summer and fall broods about a third of the

specimens are very fulvous above. The name smilacis is absolutely not based on a form.

While many smilacis look very much like sweadneri ventrally, their dorsal forewings are most often

marked like subspecies grynea. Individuals of subspecies sweadneri rarely have any fulvous above and if

so it is limited to a very faint patch of a few scales. This phenotypic feature points to smilacis ’ evolutionary

distance from sweadneri and toward grynea. What we have then is a taxon that is morphologically as

unique as any of the many other North American subspecies now considered as part of species grynea.

Mitoura grynea smilacis is endemic to a very narrow and unique semi subtropical coastal life zone

that extends from the Santee River delta of South Carolina in the north then south to Jacksonville, Florida.

That area is composed of hundreds of barrier islands and salt marsh where smilacis and its larval host,

Juniperus silicicola, are both common. This does not mean that this unique subspecies is without peril. On

Edisto Island, Colleton County, South Carolina, there was once a thriving abundant population. It is now

scarce there due to beach area housing development. This type of expensive development is a plague to

flora and fauna along the entire southeastern seaboard. Further, in this zone, smilacis probably does not

range south of Brunswick, Georgia as it blends to subspecies sweadneri southward.

As discussed under grynea grynea , smilacis does not range far inland from the coast. While it is

clear that for thousands of years smilacis and grynea were isolated from each other by the forest swamps

between the Sandhills and coastal islands, there was no such barrier between smilacis and sweadneri.

Thus, smilacis and grynea are meeting in a tension zone while smilacis and sweadneri meet in a blend

I am here designating a male from Chatham County, Georgia as neotype of this neglected and unique

subspecies (Figs. 27-28). The neotype of Thecla smilacis has the following labels and data attached to it. A

red label with the hand printed words: NEOTYPE. Thecla smilacis Boisduval & Le Conte, 1833

designated by R. Gatrelle in TTR 3:4 August 2001. A white label with the hand printed words: March 20,

1976, nr. Fort Pulaski, Chatham County, GA. A small white label machine printed with: collector, Ronald

R. Gatrelle; and hand printed: c? M. g. smilacis. This specimen is currently deposited in the International

Lepidoptera Survey’s Museum of the Hemispheres, Goose Creek, South Carolina.

** ******

**********

**-'4t

Figs. 1- 42. Eastern Mitoura. 1-2: d hesseli, 10 May 1987, Lebanon St. For., Burlington Co., NJ (leg. unknown). 3: d hesseli, 13 May 1984, Blue Hills

Res., Norfolk Co., MA (leg. unknown). 4: d hesseli, 20 April 1974, nr. Raeford, Hoke Co., NC. 5: ? hesseli. ex pupa 12 June 1976, nr. Raeford, Hoke

Co., NC. 6: d nr. angulata, 29 April 1988, St. Rd. 211, Brunswick Co., NC (leg. Zeligs). 7-8: $ hesseli, 20 July 1972, Chatsworth, NJ (leg. Douglas). 9-

10: d angulata, 1 April 1978, 10 mi. E. Sumatra, Liberty Co., EL (leg. Roman). 11-12: ? angulata, 30 March 1979, 8 mi. E. Sumatra, Liberty Co., EL

(leg. Baggett). 13: paratype ? angulata, 21 April 1984, nr Aiken St. Pk., Aiken Co., SC. 14: paratype ? angulata, ex ova 3 May - pupa 15 June 91, same

data as 13. 15-16: HOLOTYPE d M. h. angulata, ex ova 4 May - pupa 19 June 1990, same data as 13. 17-18: allotype ? M. h. angulata, 20 April 1990,

same data as 13. 19-20: Stoll’s damon in Cramer 1782. 21: B & LCt’s smilacis, 1833. 22-23: ? grynea, 6 May 1976, Fairfax Co., VA (leg. Hartgroves).

24: d grynea, same data as 22. 25-26: d sweadneri, 6 March 1976, New Smyrna Beach, Volusia Co., EL. 27-28: NEOTYPE d Mg smilacis, 20

March 1976, nr. Ft. Pulaski, Chatham Co., GA. 29-30: NEOTYPE d M. grynea, 29 March 1988, same data as 13. 31-32: ? sweadneri, 8 March 1975,

St. Augustine, St. Johns Co., EL. 33-34: ? smilacis, 19 March 1977, Hwy 204 nr. Ogeechee R., Bryan Co., GA. 35-36: ? grynea, 26 March 1977, nr.

Barnwell St. Rk., Barnwell Co., SC. 37-38: d grynea undescribed, 5 May 1974, Istachatta, Hernando Co., FL. 39: d smilacis, 13 March 1976, Givhans

Ferry St. Pk., Dorchester Co., SC. 40: ? smilacis nr. grynea, same data as 39. 41: ? smilacis, ex ova 30 March - pupa 19 May 1991, on Cooper R. nr.

Moncks Comer, Berkeley Co., SC. 42: ? smilacis, ex ova 27 March - pupa 25 May 1991, same data as 41. Specimens are 1.15 actual size. All specimens

leg. R. Gatrelle unless otherwise noted. Photos by Joe Mueller. _

MITOURA GRYNEA SWEADNER1

In the early and mid 1970’s, while Mitoura grynea sweadneri was still rather plentiful along the

east coast of Florida from Jacksonville south to Brevard County, I encountered this species several times.

The most abundant colony was encountered at New Smyrna Beach, Volusia County. It was also widespread

in the St. Augustine area including the type locality. I have not been to any of these sites for many years and

thus can not personally speak to its abundance or scarcity now. It is reportedly still fairly common in some

areas, but I know of no detailed published accounts in recent years.

This subspecies is fairly well known. Some workers had postulated that this might actually be a full

species. This is not the case as it blends to smilacis in the north and to the west to a slightly different

phenotype (which I shall discuss below), and then to the northwest to nominate grynea. Further, it is now

known that the genitalia of the Mitoura blend from subspecies to subspecies in this group along with their

morphology and phenotypes (e.g. Robbins, 1990). The sweadneri populations in the vicinity of Jacksonville

begin to show blend zone characters toward smilacis (increased dorsal fulvous and basal bars on the

ventral hindwings). Thus, I do not consider true sweadneri to range much further than the Florida - Georgia

state line on the Atlantic coast. As stated by Calhoun (1997), it is a Florida endemic.

While the smilacis figures presented herein are the first ever photos of that subspecies, sweadneri is

illustrated in several publications. Sweadneri is defined by the following characters (Figs. 31-32).

Ventrally, the hindwing’s two basal marks are either two dots or absent; the median line is fairly straight as

in most smilacis , however, the inward part of the white median line often has a wide brown boarder; the

black marginal spot in cell CU1 is not very large. Dorsally, the wings are usually a dark brown and rarely

have reddish fulvous scaling, which when present, is faint and restricted.

The species grynea is recorded from 20 counties across northern and central Florida. Nineteen of

these have been attributed to subspecies sweadneri (Calhoun, 1997). My taxonomic analysis is that this

attribution is only partially correct, as the populations in western Florida differ significantly from typical

sweadneri. However, the correct taxonomic placement of this west coastal Florida non-grynea/mm-

sweadneri entity is uncertain at this time and needs further study.

I have had a fair amount of experience with species grynea in Florida over the years. I have

encountered sweadneri at 5 locations on the east coast, and the non (or near) sweadneri populations at 5

other locations in Hernando, Citrus, and Levy counties. In total, this amounts to a few hundred specimens of

both entities. I have also viewed numerous Florida specimens in various personal collections and the

Florida State Collection of Arthropods, Gainesville.

On the ventral hindwings, the population in west Florida seems allied to both smilacis and

sweadneri. The basal markings are almost always dots (or absent), but I have seen a few specimens where

these begin to become bars. The black marginal spot is also usually smaller than in east coast specimens.

To my eye, the green ground color tends to a yellowish hue in some individuals, while in sweadneri the

green is very dark and even brownish in some specimens. The big difference however, is on the dorsal

surface where the west Florida population often has very noticeable fulvous areas (Fig. 37). Further, this

fulvous tends to be yellowish, and while never real strong, it is reminiscent in shade to that of the western

subspecies M. grynea castalis (W. H. Edwards, 1871). I had, at one point, decided to describe this entity

as a new subspecies herein. However, I have decided this needs more study. This does not mean though,

that these should be referred to as sweadneri. For now, they should be referred to as either near sweadneri

or, perhaps more properly, as near smilacis.

The main question is, by what evolutional path did this west Florida entity come into being? Is it a

descendant from a grynea that might have inhabited western Florida at a glacial maxima when the west

coast of Florida and areas of the Gulf coast extended many miles into the gulf of Mexico from where it is

today? Or, did it move down into its present location from an ancestor to the north? How is it related

evolutionally to sweadneri ? These issues call for further research.

MITOURA HESSELI

Mitoura hesseli Rawson and Ziegler, 1950 was described from Lakehurst, Ocean County, New

Jersey. There are two subspecies of hesseli in the eastern United States. This has been known for some

time. Northern (nominate) hesseli ranges from southern Maine south to north coastal North Carolina. The

populations in south central North Carolina are intermediate between nominate hesseli and the southern

subspecies described below. The few specimens I have seen from the coastal population in Brunswick

County, North Carolina also appear intermediate but lean toward the southern subspecies (Fig. 6).

I first became familiar with hesseli and its habitat in Hoke and Cumberland counties, North Carolina

beginning in July 1973.1 have collected/observed scores of specimens from that area on several occasions.

I have also reared the Hoke County population twice (Fig. 5). On 23 April 1977 I discovered an

undocumented stand of its larval host, Chamaecyparis thyoides L, near Aiken State Park in Aiken County,

South Carolina. On 21 May 1977 I subsequently collected a female at this new site for a South Carolina

state record. This was also one of the first known specimens of the southern subspecies. Previous searches

between 23 April and 21 May found nothing (this species is not expected to be flying in that area in late

May and my capture of this specimen that day was the result of an actual miracle - which I would be glad to

tell anyone about privately). I have collected and observed this population several times between 1977 and

1991.1 have also reared specimens of the Aiken colony twice (Figs. 13-16) verifying the unique characters

of this population. Today, the site remains as it was when I first located it. .

The first person to consider describing this subspecies was Steve Roman who lived in the Orlando,

Florida area at the time and who, along with Rick Gillmore, had the most experience with, and was thus the

most knowledgeable of, this taxon in Florida. Roman subsequently gave up studying Lepidoptera (he later

became interested in certain Coleoptera). About that same time I began working on this present paper

dealing with all the southern Mitoura and had a rough manuscript completed by the fall of 1979. This was

to be part of a series of papers on several southeastern hairstreaks. Business and personal matters put all

this on hold. Next, Dave Baggett began to investigate this taxon and moved close to producing a paper. At

one point we talked of doing this together. Several factors eventually came into play in his life that kept him

from moving forward. Thus it is that I have been sitting on this description, in various stages of completion,

for about 20 years.

The only real decision has been in determining the ranges of the two subspecies. Baggett felt the

populations in Florida and south Georgia (discovered by Irving Finkelstein) were the definitive subspecific

entity. I strongly disagreed. The new subspecies is only slightly more phenotypically developed and

averages a little larger in Florida but as an evolutional entity the subspecies clearly includes the population

in extreme southwestern South Carolina. Subspecies angulata exhibits far less variation from southern

South Carolina to north Florida than nominate hesseli exhibits from Maine to Virginia. Angulata may be

present in Sumter County, South Carolina as there is a large stand of C. thyoides there. Unfortunately, it lies

in the bombing range of the Shaw Air Base and can not be accessed - even though in a State Forest.

Mitoura hesseli angulata Gatrelle, new subspecies

Description and diagnosis. (Figs. 9-18). The primary distinguishing features between the northern (nominate) and

southern subspecies {angulata) are the markings on, and the ground color of, the ventral hindwings. Secondarily, angulata is

distinguished by its longer tails, larger size and tendency to have more fulvous scaling on the dorsal forewings. Other than the

sex patch of the males, the sexes of each respective subspecies are marked and colored alike with the respective females

being somewhat larger and with longer tails than their males. In nominate hesseli (Figs. 1-8) the ventral ground color is

typically a vivid olive green, in subspecies angulata it is dark green to dark brown. In nominate hesseli the ventral white

marginal line is often wide from Ml to the anal angle and blends into the submarginal area peppering it with many white

scales; in subspecies angulata this line is thin and the submarginal area much less invaded with white scaling. The ventral

hindwing median line in angulata is much more undulate than in nominate hesseli; the spots in this line on angulata are very

angulate also while in northern hesseli they are more curved and give a softer appearance. The last two spots in this line in

cell CU2 and A2 are diagnostic of angulata and form, what Baggett aptly called, a sickle shape; in northern hesseli these

lines usually tend to form a soft m shape. In angulata the lower of the two ventral hindwing basal spots is usually in the form

of a sharp arrow-head pointed outward, this is mirrored by an inward pointing arrowhead in the median line in cells Ml, M2;

nominate hesseli lacks this feature. In cells M3 and CU1 the spots in the median band on angulata are often very reduced in

size - almost absent; in nominate hesseli they may be only slightly reduced. On the dorsal surface, angulata has red fulvous

scaling in some specimens, becoming more frequent the farther south the subspecies is encountered, there is red scaling on 6

of the paratypes (20%) but strongly in only two.

Types. All: SOUTH CAROLINA, Aiken County, nr Aiken State Park (leg. R. Gatrelle). Holotype c? (Figs. 15-16):

ex ova 4 May 1990, ex pupa 19 June 1990. Allotype 9 (Figs. 17-18): 20 April 1990. Paratypes : 14c? c?, 16 9 9: 1 9,21 May

1977; 4c? c?, 19, 21 April 1983; 4c? c?, 19, 21 April 1984; 19, 25 July 1988; 1 9, ex ova 27 April - ex pupa 9 June, 1 9, ex

ova 2 May - ex pupa 24 June 1989; 3c? c?, 20 April 1990; 1 9, 29 April, 3c? c?, 9 9 9, ex ova 2 May - ex pupa 12 to 18 June

1991. All type specimens are currently housed in the TILS Museum of the Hemispheres, Goose Creek, South Carolina. It is

planned that some of the paratypes will be deposited in another Museum to be determined later.

Type locality. Aiken County, South Carolina.

Etymology. This subspecies derives its name from the angular nature of the median bands on the ventral hindwings.

Remarks. It is significant that in the southern subspecies of grynea the ventral median line becomes straighter and

the basal markings bars, dots or obsolete, while in the southern subspecies of hesseli these same characters become more

angular and undulate. Opposite patterns like this, especially in closely related species, indicate that they are strictly genetic

in origin. In contrast, it is usual for southern hairstreak subspecies in the eastern U.S. to exhibit more dorsal fulvous and

longer tails than their northern counterparts - typical of environmentally induced morphological characters. The second

brood of M. hesseli angulata is darker below than the spring brood with most specimens being a deep brownish green in

ground color. I have seen many specimens from Florida in the private collections of Steve Roman, Rick Gillmore and Jeff

Slotten.

It is very significant that I have reared both the Aiken (South Carolina) colony of angulata (Fig. 14) and the Hoke

(North Carolina) colony of hesseli (Fig. 5) twice each. These where reared under the same conditions (indoors) at the same

location (Goose Creek, SC) with each producing 100% distinctly different subspecific phenotypes demonstrating that the

populations are two genetically distinct morphological subspecies.

Baggett (personal communication) was interested in the fact that he had found evidence in the plant literature that the

larval host of angulata in Florida was considered by some as a distinct variety of Chamaecyparis thyoides and that this

might indicate that angulata evolved in concert with this variety of C. thyoides. This is worthy of future study. I have noted

several other stands of White Cedar in Aiken County (via binoculars) but have not been able to access these sites as they are

well into private property. Mitoura hesseli angulata is quite unco mm on in nature and very under-represented in collections.

It should be considered a taxon of special concern. The population in Aiken County is the only known colony in South

Carolina. This colony is located on a utility easement on private property. While angulata may well occur at other locations

within South Carolina, this should not be assumed from a wildlife management standpoint. I have found that hesseli colonies

are most numerous where the old trees have been logged and young trees are in thick stands of 5 to 30 feet tall saplings.

There were five other specimens I had photographed and originally intended to include in this paper but there was not

enough room for them on the plate and they have been omitted. These were two unique wild caught aberrant individuals of

smilacis and specimens of grynea from Mississippi and Iowa. The latter are examples of grynea to the west of this study

area. All the Mississippi material I have seen from mid to up state is typical grynea. I have not seen any from the coastal

region of that state. Being from Iowa, I have collected grynea at several locations there. These are transitional to more

western phenotypes. They tend to have bars at the base of the VHW and lean toward subspecies M. g. castalis (W.H. Edwards,

1871).

In recent years various long established Eumaeini genera have come to be lumped as subgenera under Callophrys

Billberg, 1820. This includes the genus Mitoura. This does not seem warranted to me. In fact, we are now in a phase where

much lepidopteran lumping seems to be going on at all levels - and at times with very little or no published research. For

those who have followed this trend, the name angulata would be spelled “angulatus” if placed under Callophrys.

ACKNOWLEDGMENTS

I wish to thank Niklas Wahlberg and his wife for translating the Dutch OD of damon to English. I

thank Steve Roman and Dave Baggett for thoughts shared years ago relative to the subspecific status of this

southern taxon. I thank Don Lafontaine for supplying me with various original descriptions and color copies

of damon in particular. I also thank the late J. F. Gates Clark who, while at the USNM, supplied me with the

original description of smilacis and a color photograph of that plate. As stated in the text, my work on this

paper goes back many years.

9

LITERATURE CITED

BOISDUVAL, J.A., & J.E. LECONTE. 1833. Historic generate et iconographie des Lepidopteres et des

chenilles de l’Amerique Septentrionalis. Vol. 1. Paris. 228 pp.

CALHOUN, J.V. 1997. Updated List of the Butterflies and Skippers of Florida. Holo. Lepid. 4(2): pgs. 39-

50. Gainesville, FI.

FORBES, W.T.M. 1960. Lepidoptera of New York and Neighboring States, part 4. Cornell Univ. Agr. Exp.

Sta. Memoir 371, 188 pp.

FREEMAN, H.A. 1952. Field and Lab., 20: 30.

GATRELLE, R.R. 1998. An Addendum to Anthocharis midea dosPassos and Klots 1969 (Description of a

New Subspecies from Texas). The Taxonomic Report Vol. 1, No 1, TILS, Goose Creek, SC. 5 pp.

-. 1999. Three New Hesperioidae (Hesperiinae) from South Carolina: New Subspecies of

Euphyes bimacula, Poanes aaroni, and Hesperia attains. The Taxonomic Report Vol. 1, No 10,

TILS, Goose Creek, SC. 13 pp.

- . 2001. An Examination of Southeastern U.S. Satyrium (Lycaenidae: Theclinae). Part

One: An Obscure New Subspecies of Satyrium edwardsii. The Taxonomic Report Vol. 3, No 2,

TILS, Goose Creek, SC. 7 pp.

HUBNER, J. 1819. Verz. bekannter Schmetterlinge. Augsburg. Pg. 74.

JOHNSON, K. 1991. Types of Neotropical Theclinae (Lycaenidae) in the Museum National d’Histoire

Naturelle, Paris. Journal of the Lepid. Soc., Vol. 45(2): pgs. 142-157.

RADFORD, A.E., H.E. AHLES & C.R. BELL. 1968. Manual of the Vascular Flora of the Carolinas. Univ.

of North Carolina Press, Chapel Hill. 1183 pp.

ROBBINS, R.K. 1990. The Mitoura spinetorum Complex in New Mexico and the Validity of M.

millerourm (Lycaenidae: Theclinae). Journal of the Lepid. Soc. Vol. 44(2): pgs. 63-76.

STOLL (in CRAMER). 1782. Uitl. Kapellen, Vol. 4: pg. 208.

The Taxonomic Report

is a publication of The International Lepidoptera Survey (TILS).

(A Tax Exempt Non-Profit Scientific Organization)

The Taxonomic Report is projected for publication at the rate of 8-10 issues a year. Subscription/

dues for Volume Three are $45 US for domestic and $55 US for overseas subscribers. The subscription

year follows the calendar year. All issues are mailed 1 st class. At the end of each year, subscribers receive

that year’s volume on a record-only compact disc (CDR) for permanent archiving and reproduction for

personal use (i.e. a museum or university may make as many copies as needed in whatever format desired).

Non-members may receive individual issues in print any time for $10 per issue. Individual issues on CDR

to non-members are $25 per issue post paid. Subscriptions and individual issue orders should be made

payable to TILS; and mailed to: Treasurer, 126 Wells Road, Goose Creek, SC USA 29445-3413.

Catch us on the web at: www.tils-ttr.org

10

Volume 3

28 December 2001

Number 5

Initial Survey of the Butterflies and Skippers in the Vicinity of the Buck Creek

Serpentine Barrens, Clay County, North Carolina.

Conducted by the International Lepidoptera Survey for the US Forest Service. May - October 2001

SUMMARY

General Serpentine barrens are generally low in biotic diversity. However, these barrens are known to

frequently harbor unusual species of plants and animals not usually found elsewhere. A survey was conducted

from 4 May through 2 October 2001 in and around the Buck Creek Barrens located in Clay County, North Carolina

to document the butterfly and skipper taxa present at this location and their status. The site was visited 15 times

during this period with at least two visits each month except September and October. A total of 76 different taxa

were located with another 14 being likely (90 total). Two new state records were recorded, one new mountain

record and several unusual species. One of the two new state records is an undescribed species and the other a

possible undescribed subspecies.

Species status. Throughout the Southern and Eastern United States the 2001 season was characterized by

unusually low numbers of most species. In many areas even usually common species were found in low numbers.

Because 2001 was an unusual year for population density, it is not possible to give an accurate assessment of the

“normal” levels for many taxa found in the 2001 survey. But because the primary researcher is an expert field

lepidopterists with several years of experience with western North Carolina taxa, an educated projection is given for

most taxa recorded.

Barrens area. It is our opinion that the barrens area once supported a much more robust and diverse

butterfly and skipper fauna then it does today. We find the area in poor health and in much need of increased

management and in a manner that caters more to invertebrates. Burns are needed but should be limited in size as

the rarer species seem to not be evenly distributed throughout the barrens area. More and smaller burns are

recommended in a grid manner rather than on entire slopes at a time. We also recommend the thinning and

removal of trees on the periphery of the serpentine areas to help provide a buffer and transitional perimeter.

AREAS SURVEYED

The survey site was segmented into four areas. 1) East Barrens. This area is on the east side of FS

Road 350 up the west facing slope to just above FS Road 6269. 2) West Barrens. This area is on the west

side of FS Road 350 and extends in an irregular pattern up the east facing slope parallel to road 350 to the

junction of FS Road 350A. A power line cut runs the length of this area. In the southern portion of this

section the barrens habitat goes to the top of the ridge. The power line cut connects the West Barrens to

the next area. 3) Meadow at the old church property end of FS Road 350A. Though man made, this

meadow functions as an extension of the West Barrens due to the fly way created by the power line cut.

This area should be maintained as an integral part of the Barrens system. 4) Surrounding area. The area

of Hwy 64 at the eastern junction with old 64 where there are large open areas; Hwy 64 between east and

west junctions of old 64; up FS Road 6237. These surrounding areas act as man made habitat reservoirs

where several of the grass/sedge feeding species of the Barrens have found suitable habitat that is now

less available in the Barrens areas. Areas to the north are too forested to support Barrens specific taxa.

SURVEY DATES AND METHOD

The survey area was visited the following dates. May 4, 10, 14, 18, 29; June 18, 29; July 6, 16,

31; August 10, 21, 28; September 18; October 2. The time of each daily survey was basically the same.

The day usually began between 08:30 and 09:30 and ended between 16:30 and 19:00 depending on day

length and weather. Weather was good to excellent on all dates - morning fog was the biggest factor. A

set pattern was established and followed each of these days. Area 3 was always visited first as it received

the most morning sun enabling species to fly there much earlier than the other areas. Area 3 was left

between 11:00 and 12:00 each visit. Area 2 was surveyed next ranging from about 11:00 to 14:00. Area

1 was surveyed last as it only had full sun from noon onward. The beginning time in area 1 varied from

12:00 to 13:30. Depending on what taxa were located in the initial round of daily searches, the three areas

were surveyed again with the most time spent in the most fruitful area on a given day. The area 4

peripheral sites were checked sporadically with the large open area at the eastern junction of old and new

highways 64 being visited most frequently as it was the exit route from the Buck Creek site. This part of

area 4 had the latest sun which provided the opportunity for even early evening surveying in mid summer.

VERIFIED SPECIES LIST

NAME

AREA DATE

STATUS

HESPERIIDAE

1 2 3 4 Month - day/day/day

occurrence

1 Epargyreus clarus

X X X X all 15 dates

abundant

2 Thorybes bathyllus

X 8-21

undetermined

3 Erynnis icelus

X X X X 5-04/10/14/18/29; 6-18/29; 7-06

abundant

4 “ brizo

X X X X 5-10/14/18/29

abundant

5 “ Juvenalis

X X X X 5-04/10/14/18/29

abundant

6 “ horatius

X X X X 8-10/21

common

7 “ baptisiae

X X 7-31; 8-10/21

common

8 “ lucilius ?

X 7-16; 8-10

rare

9 Pyrgus communis

X X 10-02

undetermined

10 Nastra Iherminier

X X X X 7-31; 9-18; 10-02

not uncommon

11 Lerema accius

X XX 7-16/31; 8-10/28; 9-18; 10-02

uncommon

12 Ancyloxypha numitor

XXX 5-29; 8-28; 10-02

uncommon

13 Hylephila phyleus

X X X X 7-31; 9-18; 10-02

not uncommon

14 Polites peckius ssp.

16 Pompeius verna

X X X X 8-10/21/28; 9-18

common

undetermined

A A A O-lo/ZV, y -1 o, 1U-UZ

XX X 8-10; 9-18

uncommon

17 Atalopedes

X X X X 8-10/21/28; 9-18; 10-02

common

campestris Huron

18 Atrytone logan

X X X X 7-06/16/31

not uncommon

19 Euphyes vestris

X XX 7-16; 9-18

uncommon

20 Atrytonopsis hianna

X 5-14

rare?

21 Amblyscirtes hegon

XXX 5-10/14

common

22 “ vialis

XX X 5-10/14/29

not uncommon

23 Panoquina ocola

X 9-18; 10-02

undetermined

2

PAPILIONIDAE

Month-day/day/day

occurrence

1 Pterourus glaucus

X

2 Pterourus new species X X X X 5-10/14/18/29; 6-18

3 Pterourus troilus X X X X 5-04 through 9-18

4 Papiliopolyxenes X X 5-10; 7-31; 8-21

asterius

not uncommon

undetermined

5 Battusphilenor X X X X 5-29; 6-18/29; 7-31; 8-10/21/28; 9-18

PIERIDAE

1 Pier is rapae X

common

3 Anthocharis midea

annickae

XX ,

5-04/10/14/18/29

undetermined

X X X X

X X 5-29; 6-18; 7-06; 9-18; 10-02

; 9- not uncommon

6 Phoebus sennae

eubule

XXX 5-14; 9-18; 10-02

occasional

7 Eurema lisa

X 9-18

undetermined

8 “ nicippe

X XX 6-29; 8-10/21; 9-18

occasional

9 Nathalis iole

X 7-31

occasional

LYCAENIDAE

1 Fenisecatarquinius X X 5-04/10/14

not uncommon

2 Satyrium calanus

falacer

3 “ liparops

4 Parrhasius m-album

XXX 6-29; 7-06/16/31

X 7 06

abundant

A /-UO

X 5-14

uncommon

uncommon

occasional

5 Deciduphagus henrici

X 5-14

undetermined

6 Strymon melinus

humuli

X XX 7-06; 9-18

uncommon

7 Calycopis cecrops

X X 9-18

uncommon

8 Celastrina ladon

X X 5-04/10

undetermined

9 “ neglectamajor

X X 5-29

undetermined

10 “ neglecta

X X X X 6-29; 7-06/16/31; 8-10/21

common

11 Everes cornyntas

X X X X all 15 visits

abundant

12 Glaucopsyche

lygdamus ssp

NYMPHALIDAE

X 5-04/10/14

not uncommon

1 Euptoieta claudia

X XX 6-29 through 10-02

not uncommon

2 Speyeria cybele

X X X X 6-18 through 10-02

common

3 “ aphrodite cullasaja

X X X X 6-18 through 9-18

common

X X 7-16; 8-10/21; 9-18

uncommon

5 Chlosyne gorgone

X X 5-10/14/18

uncommon

6 “ ismeria nycteis

X X X X 5-29; 6-18/29; 7-06

common

7 Phyciodes maconensis XX X 5-10/14/18/29 not uncommon

8 “ tharos

X X X X 5-10 through 10-02

common

9 “ cocyta ?

X X 7-06 through 9-18

undetermined

10 Polygonia comma

XXX 5-10/29; 7-06/16; 9-18

uncommon

11 “ interrogationis

X X X X 5-10/14/18; 7-06/1631; 8-10; 9-18

not uncommon

12 “ progne

X 5-18

rare

13 Nymphalis antiopa

X X X X 5-29; 7-16; 10-2

not uncommon

14 Vanessa atalanta

X X X X 5-29; 7-06/16/31; 8-10/21/28

not common

15 “ virginiensis

X X X X 5-10 through 10-02

common

16 “ cardui

X X X X 7-06 through 10-02

erratic/common

17 Junonia coenia

X X X X 5-10/29; 6-29; 7-06 through 10-02

not uncommon

18 Limenitis archippus

X X X X 5-29; 6-18/29; 7-16

uncommon

19 “ arthemis astyanax

X X X X 5-29; 6-29; 7-16; 8-21/28

common

20 Agraulis vanillae

nigrior

X X X 9-18; 10-02

occasional

21 Enodia anthedon

X X 6-18; 8-10

uncommon

22 Satyrodes appalachia XXX 6-29; 7-16/31

not uncommon

23 Cercyonis pegala

Carolina

XXX 7-31; 8-10/21/28; 9-18

very common

24 Megisto cymela

X X X X 7-06/16/31

not uncommon

25 Hermeuptychia

sosybia

XXX 6-18/29; 7-06/31; 8-10/28; 9-18

not common

26 Cyllopsis gemma

X X 6-29

uncommon

DANAIDAE

1 Danaus plexippus

X XX 7-31 through 10-02

common

PROBABLE AND ADDITIONAL SPECIES LIST

Jason Love of the Coweta FS Station tentatively identified a few other species for this site in 2000.

Gatrelle also expects a few other species to be likely for the Barrens area. These species are as follows.

LOVE RECORDS

1234 DATE

STATUS

1 Hesperia sassacus

? 5-29

possible

2 Erynnis zarucco

? ? 7-16

probable

3 Wallengrenia egeremei

1 ? ? 9-10

probable

4 Deciduphagus

augustinus

? ? 4-16

very probable

EXPECTED

WHEN FOUND

5 Polites Themistocles

X X X X May-June and August-September

very probable

6 “ vibex

X X X X June to August

very probable

1 Poanes zabulon

X X X X May-June and August-September

very probable

8 “ hobomok

X X X X May to July

very probable

9 Wallengrenia otho

X X X X June to August

possible

4

10 Celastrina nigra

X X

X late March into May

very probable

11 Deciduphagus irus

X X

X May into June

_i t b ciilMli

12 Incisalia niphon

13 Satyrium edwardsii

X X

X

X mid April through May

very probable

probable

14 Polygonia faunus X X June to August probable

srnythi

SPECIAL COMMENTS

Six taxa are of special interest.

1) A new species of Swallowtail in the genus Pterourus is in the process of being described. This species

seems endemic to the Appalachian region. The Buck Creek site will be its type locality. This species is

univoltine and flies from mid spring to early summer. In the below picture, the top two individuals are

the common Eastern Tiger - Pterourus glaucus glaucus, the two lower individuals are the new species.

Black females are not known in the new species while they are dominant in glaucus (at Buck Creek). As

can be seen, these sympatric Buck Creek species are most easily told apart by size in the males.

2) Chlosyne gorgone gorgone is known from only two locations - one in Georgia and one in South

Carolina. It is a univoltine species of the Sandhills region. Other populations are known from the

foothills regions of northern Georgia and South Carolina. It has been determined that these multivoltine

upstate populations are not the nominate subspecies and have tentatively been referred to subspecies

car lota (which is a Midwestern taxon). A unique population of C. gorgone was found at the Buck Creek

barrens. (This colony is 2500 feet higher than the Georgia/South Carolina foothills colonies.) This is a

new North Carolina state record and the only known record of gorgone in the Appalachian mountains (an

old 1800s West Virginia record is uncertain). Gatrelle will collect a small series of this population as it is

possibly an undescribed relict subspecies - and hopefully work out its local life history in 2002. The

population seems to be well established at this site in both the east and west barrens areas. This is by far

the most unique taxon at this site.

3) Phyciodes batesii maconensis (Appalachian Crescent) is at times a common butterfly throughout the

survey area. This North Carolina/Georgia southern Appalachian endemic (described by Gatrelle in 1998

from Macon County, North Carolina) has now undergone mtDNA analysis (by Dr. Wahlberg) against

nominate batesii of the northeastern US and eastern Canada. It has been determined that the mtDNA of

these two taxa are very different. This means that maconensis is possibly a species distinct from batesii.

It is so treated by Gatrelle in this paper - Phyciodes maconensis (new combination).

4) One specimen of Polygonia progne (Grey Comma) was found along old Hwy 64. This may be the

southernmost record for this typically northern species. This specimen may have been a stray but this is

doubtful as it was found early in the year and was in poor condition. This indicates that it was bred in the

area and overwintered there. This taxon is very unusual in North Carolina. It may well have a colony in

the survey area including the stream bottom that divides the east and west barrens.

5) One freshly emerged male specimen of Atrytonopsis hianna was found in the West Barrens. This is a

new North Carolina mountain region record for this species. Jason Love recorded Lerema accius from

this same area on April 16, 2000. It is Gatrelle’s opinion that this is in fact a misidentification of hianna.

Love did not voucher his record, and these two can look very similar to an inexperienced lepidopterist.

This is the second most unique taxon in the barrens.

6) Five Erynnis Skipper specimens were collected in the area 3 meadow and tentatively determine to be

species lucilius. This determination was made by dissecting the male genitalia and comparing the adults

with reared specimens of lucilius from West Virginia. (Reared by Tom Allen.). The problem is that the

larval host, Columbine ( Aquilegia canadensis ), was not located by Gatrelle in the immediate area. This

host needs to be documented in this vicinity. If plants of this host are found, a search should be made for

lucilius larvae on these plants to confirm this record. E. baptisiae is an almost cryptic sibling species to

lucilius. Erynnis lucilius is a unique species for North Carolina and its status there needs a lot of detailed

survey work.

In conclusion, this survey is but a beginning. The Lepidoptera found to date in this initial survey

reveals that much more work and analysis needs to be conducted in this unique Serpentine Barrens and

the adjoining areas.

Survey conducted by Ronald R. Gatrelle, president, The International Lepidoptera Survey.

Report submitted December 27, 2001. Financial support provide by the US Forest Service.

6

Volume 3 15 May 2002 Number 6

NAME-BEARING TYPES AND TAXONOMIC SYNOPSIS OF THREE

LYCAENID BUTTERFLY TAXA FROM WESTERN CANADA

(LEPIDOPTERA: LYCAENIDAE)

Norbert G. Kondla 1

P.O. Box 244, Genelle, BC VOG 1G0 Canada

AND

Crispin S. Guppy

4627 Quesnel-Hydraulic Road, Quesnel, BC V2J 6P8 Canada

ABSTRACT: We clarify which of two designated lectotypes of Chrysophanus florus Edwards, 1884 is valid We also show

that the putative holotype of Plebeius saepiolus insulanus Blackmore, 1920 is actually a lectotype. A valid neotype designation

for Lycaena saepiolus arnica Edwards, 1863 is provided. Publication dates are corrected and we also briefly review the various

taxonomic interpretations and distributions that appear in the literature with respect to these taxa.

Additional keywords: Plebejus,Aricia, Epidemia, dorcas, helloides, kodiak, rufescens, Alberta, British Columbia

INTRODUCTION

The first purpose of this article is to clarify the name bearing type of the butterfly Chrysophanus

florus Edwards, 1884. This is necessary because two lectotype designations have been published and two

butterflies with lectotype labels exist in the Canadian National Collection of Insects and Arthropods

(CNC, Ottawa, Canada). Our second purpose is to clarify the name bearing type of Plebejus saepiolus

race insulanus Blackmore, 1920. This is necessary because the existing name bearing type is erroneously

labeled as a holotype in the CNC. We also report the correct publication years for these two taxa. Thirdly,

a valid neotype designation for Lycaena saepiolus arnica is presented. This is necessary because the

neotype designation by Brown (1970) is invalid. We also give an overview of the numerous and

unresolved taxonomic interpretations related to these butterflies. Our overall purpose is to set the stage for

subsequent taxonomic review.

Chrysophanus florus Edwards, 1884 (Figures 1 and 2)

Edwards (1884) described Chrysophanus florus as a distinct species. The original description

appeared in Canadian Entomologist 12(11), which was published 17 January 1884 (Bird and Ferris 1979,

Bridges 1988), rather than in 1883 as has generally been assumed (e.g. Miller and Brown 1981, Guppy

and Shepard 2001). Two lectotypes have been designated and reside in the Canadian National Collection

of Insects and Arthropods. Figures 1 and 2 show the dorsal and ventral views of the two putative

lectotypes in the CNC.

1 Research Associate, The International Lepidoptera Survey, Goose Creek, South Carolina.

Brown (1969) published the first lectotype designation. He selected the lower specimen shown in

Figures 1 and 2 for his lectotype but clearly showed that it was not from the type series (syntypes). A

lectotype may only be selected from the type series, pursuant to the International Code of Zoological

Nomenclature (henceforth, “the Code”) Article 74 (International Commission on Zoological

Nomenclature 1999). It is clear from Brown (1969) that Edwards did not have available to him the

specimen Brown selected as the lectotype and hence the lectotype designation by Brown is not valid. As

noted by Brown (1969), Edwards only saw one or two of Geddes’ L. florus specimens and returned them

to Geddes (the collector of the types). Also as noted by Brown (1969), none of the four Geddes L. florus

specimens from Calgary in the CNC carry an Edwards label but two specimens from Crowsnest Pass do

carry Edwards labels. Those two specimens are therefore the type series. We recommend that a label be

added to the ’’lectotype” labelled by Brown (1969) stating that it is not a lectotype, along with a citation of

this article for the benefit of future researchers who access these specimens.

Bird and Ferris (1979) designated the second lectotype. Their lectotype designation is the valid

lectotype designation but not for the reasons they present in their paper. They express the view that the

Brown lectotype designation is invalid because of an error in the type locality as provided by Brown. In

fact, the ‘correctness’ of a type locality has no bearing on the validity of a lectotype. There is no Code

requirement for a lectotype to have a ‘correct’ type locality. The type locality does not determine the

lectotype; it is the lectotype that determines the type locality (Article 76.2 of the Code). However for the

reasons explained above, we also conclude that the Brown lectotype is invalid and hence Bird and Ferris

(1979) were justified in designating a new lectotype. The Bird and Ferris lectotype is valid because it was

selected from the type series.

The type locality of L. florus was referenced as Red Deer River, and restricted to Didsbury,

Alberta by Brown (1969) and by Miller and Brown (1981). Both this type locality and the alleged type

locality restriction is incorrect. Brown (1969) did not restrict the type locality but rather alleged that

“Garrett’s Ranche, Br. Amer.” is now called Didsbury. Brown (1969) quoted the type locality as “Taken

on Red Deer River, Br. Am.”. We note that the Red Deer River is more than 80 kilometres from the town

of Didsbury. Type locality confusion was further increased because the lectotype selected by Brown

(1969) was collected near Calgary, which should have been cited as the type locality until the lectotype

designation by Bird and Ferris (1979). All three of these alleged type localities are incorrect. The valid

lectotype designation by Bird and Ferris (1979), along with the historical and geographical research

reported therein, means that the type locality of L. florus is “Garnett’s Ranch, near Lundbreck, mouth of

Crowsnest Pass, Alberta”.

The taxon florus has variously been placed in the literature as a subspecies of Lycaena ( Epidemia)

dorcas or as a subspecies of Lycaena ( Epidemia ) helloides (eg. Ferris 1977, Scott 1978), although Klots

(1931) argued that L. dorcas and L. helloides are the same species because they have similar male

genitalia. Various books have not contributed anything to resolution of this matter and have even

contributed to confusion about the distribution of L. florus (eg. Layberry et al. 1998, Opler 1999). Bird et

al. (1995) correctly described the Alberta distribution as being confined to the extreme southwest of the

province. The status of L. florus in southern British Columbia is under review. It was not included in

Guppy and Shepard (2001), although it is reported from British Columbia by Ferris (1977) and numerous

specimens of phenotypic florus are known from southern British Columbia. Opler (1975: 314) expressed

the view that high altitude florus populations in Colorado appear intermediate between dorcas and

helloides but did not explain the perceived characters that resulted in such a view. Kohler (1980, pers.

comm.) recognises L. helloides and L. florus as different taxonomic entities in Montana on the basis of

phenotypic, phenological and ecological differences. A review of the specimens in the CNC by Kondla in

1998 and by Guppy in 2002 support the interpretation that L. helloides , L. dorcas , and L. florus all occur

in Alberta as distinct species. Recent literature has seemingly been based on the unstated assumption that

the taxon florus must be associated at the species level with either dorcas or with helloides , as pointed out

by Kondla (1999). Nothing has been published to support treating florus as anything other than the full

species that Edwards described it as. Clarity on the name bearing type is needed regardless of the differing

taxonomic interpretations.

Plebeius saepiolus race insulanus Blackmore, 1920 (Figures 3 and 4)

Blackmore (1920) described Plebeius saepiolus race insulanus , although the publication date has

apparently always been stated in error to be 1919 (eg. Miller and Brown 1981; Guppy and Shepard 2001).

The Proceedings of the Entomological Society of British Columbia were at that time normally published

the following year, as was the case for the 1919 Proceedings (Bridges 1988). Further evidence for

publication in 1920 is contained within the original description itself. The last three paragraphs are

preceded by the words “AUTHORS NOTE (October, 1920)”. Since then the species saepiolus , with its

subspecies insulanus , has been traditionally placed in the genus Plebejus or its variant spelling Plebeius.

Detailed explanation of the Plebeius/Plebejus spelling variants is provided by Balint et al. (2001), who

also invoke Article 24.2 of the Code to make Plebejus the code-compliant spelling.

3

Balint and Johnson (1997) provide reasons based on genitalic structure for preferring use of the

generic name Aricia for the species saepiolus. The genus Aricia was named after the town of Aricia in

Latium on the Via Appia (Traupman, 1970) and is feminine. Brown (1951) incorrectly used the spelling

insulana for the taxon insulanus , in combination with the masculine Plebeius/Plebejus. Use of the

feminine spelling insulana in combination with the genus Aricia would also be an error. The Latin word

insulanus (= an islander) is a noun, and as such Article 31.2.1 of the Code requires the original spelling to

be retained, with gender ending unchanged. Gender agreement for species group names applies only if the

name is a Latin or latinized adjective or participle in the nominative singular. Readers should also resist

the temptation to change saepiolus to saepiola when placed in the genus Aricia , because the Latin word

saepiolus is also a noun.

Blackmore did not designate a holotype in his 1920 paper, but three years later re-described the

taxon insulanus and this time did designate a holotype (Blackmore 1923). Unfortunately this belated

holotype designation is invalid, because Article 73 of the Code requires that a holotype designation be

part of the original description of a taxon. A holotype can only be designated at the time of original

description, thus the “holotype” designated by Blackmore (1923) is not a valid holotype. Code Articles

74.5 and 74.6 render the putative holotype a legitimate lectotype. We recommend to the CNC, as

custodians of the type specimen, that a lectotype label be added to the specimen, along with a citation of

this article for the benefit of future researchers. The dorsal and ventral views of the lectotype of Plebeius

saepiolus race insulanus Blackmore, 1920 (type locality: Victoria, BC) are shown in Figures 3 and 4.

Lycaena arnica Edwards, 1863 (Figures 5 and 6)

The taxon arnica was described as a full species by Edwards (1863). The type locality of arnica

Edwards is Fort Smith, NT by virtue of our neotype designation (below) and not Fort Simpson as

erroneously listed in recent literature including Brown (1970). The original description gave “From

Mackenzie’s River” as the type locality. Brown gave no reasons for arbitrarily saying that Fort Simpson

is the type locality. Brown asserted that Fort Smith is upstream of Fort Simpson but this is incorrect. Fort

Smith is located on the Slave River, which is separated from the Mackenzie River by Great Slave Lake.

Unfortunately Brown’s neotype designation is not compliant with the fourth edition of the

International Code of Zoological Nomenclature. The fourth edition of the Code requires a valid neotype

designation to be published with “a statement that it is designated with the express purpose of clarifying

the taxonomic status or the type locality of a nominal taxon” (Article 75.3.1). Brown’s designation does

not meet this test. The fourth edition of the Code supersedes all previous editions so this deficiency

adequately demonstrates that the Brown neotype designation is invalid. To some this may seem to be a

minor reason to invalidate Brown’s neotype designation. However it is critical to avoid the selective

rejection of portions of the Code, based on personal opinion of “importance”, in the interest of taxonomic

stability and consistency.

However, for the benefit of readers who mistakenly think that compliance with the version of the

Code in effect in 1970 renders the Brown designation valid; we test the designation against the provisions

of the second edition of the Code, which was in effect in 1970. The second edition of the Code required

neotypes to only be designated in connection with revisory work and then only in exceptional

circumstances (e.g. a complex zoological problem) when a neotype is necessary in the interests of

stability of nomenclature. Brown did not designate the neotype as part of revisory work. He presented no

exceptional circumstances that warranted a neotype. His stated motivation for designating a neotype was

that the original description was very brief and left much to be desired and thus he felt obliged “to settle

the question of arnica' s identity”. Thus, Brown’s neotype designation was also invalid under the Code

version in effect at the time.

We remedy this situation by validly designating Brown’s putative neotype of arnica as the neotype in

accordance with the International Code of Zoological Nomenclature. The designation is organized in

accordance with the Code neotype articles to clearly demonstrate compliance with the Code provisions:

♦ Article 75.1 - We believe that a name bearing type is necessary to define the nominal taxon objectively.

We present below the numerous and conflicting and unsubstantiated interpretations surrounding the name

arnica and related names.

♦ Article 75.3 - We believe that there is an exceptional need to establish a name bearing type to allow for

resolution of the various published and conflicting taxonomic interpretations surrounding arnica and

related names.

♦ Article 75.3.1 - We designate the neotype with two express purposes. One purpose is to establish Fort

Smith, Northwest Territories, Canada as the type locality of the taxon arnica. The second purpose is to

clarify that we view arnica as a distinct taxonomic entity from the taxa insulanus Blackmore, 1920 and

kodiak Edwards, 1870.

♦ Article 75.3.2 - The taxon arnica differs from insulanus by having females that often have blue scaling

basad on the dorsal forewing and by being more strongly spotted on the ventral surface. The taxon arnica

is differentiated from kodiak by its larger size and lighter, greyish white ventral surface, with smaller

spots, in the males.

♦ Article 75.3.3 - In the interests of stability and to avoid confusion; we designate as the neotype of arnica

the same specimen invalidly designated by Brown (1970). The neotype is a male in the Canadian National

Collection of Insects and Arthropods in Ottawa, Canada. It is type number 10908 in said collection. It was

collected at Fort Smith, NT by W.G. Helps on 28 June 1950. It is illustrated in black and white by Brown

(1970) and is herein illustrated in colour as Figures 5 and 6.

♦ Article 75.3.4 - We believe that the type specimens of arnica are lost because Brown (1970) quotes from a

letter by Edwards to Holland that they were lost. Types were not located in sundry collections visited by

Brown in his research on Edwards types.

♦ Article 75.3.5 - Brown (1970) presented evidence that the neotype is consistent with what is known of the

former name-bearing type from the original description and we cite his paper as evidence herein. We have

also compared the original description (Edwards 1863) to the neotype and find that it is consistent.

♦ Article 75.3.6 - We reference the information in Brown (1970) as evidence that the neotype came as

nearly as practicable from the original type locality.

♦ Article 75.3.7 - The neotype is the property of the Government of Canada and is housed in the Canadian

National Collection of Insects and Arthropods, Ottawa, Canada.

. . ‘ 1 ' 11 1 M 1111 . j i 111 11 ^ i 1 1111 m~n m i u l i. n 11 n 11; n 11 n 11 h 11) I) I j f j .11 j

Figure 5. Dorsal view of the neotype of arnica Figure 6. Ventral view of the neotype of arnica

in the CNC. Photo: N. Kondla in the CNC. Photo: N. Kondla

Synopsis of the names attributed to the nominal species Aricia saepiolus in western Canada

With clarity of the types and type localities now in hand; we provide a brief synopsis of the

various taxonomic interpretations and distributions presented in the literature since these animals were

first described.

Blackmore (1920) limited insulanus to Vancouver Island and expressed the view that populations

from Atlin in extreme northwestern British Columbia approach typical saepiolus. Llewellyn-Jones (1951)

also followed this approach. Holland (1931:258, 259) treated arnica and insulanus as full species rather

than subspecies of saepiolus. Leussler (1935) reported collection of a few specimens from the area of the

Mackenzie River delta, NT. He observed that “These are small and come nearest to race insulanus

Blackmore, but are paler and duller looking above. They fit the description of arnica Dew. [sic] somewhat

indifferently”. Brown (1951) recognised nominate saepiolus as being present in extreme southern British

Columbia; treated Vancouver specimens as insulanus and extended application of the name insulanus'' on

the mainland west of the Fraser River in British Columbia (Lillooet)”. Brown (1951) further stated that

"Arnica (?) extends eastward from the mountains in western Alberta” and made no comment on the

placement of populations in northwestern British Columbia.

Downey (1975:343) assigned insulanus to populations from Vancouver Island and western British

Columbia, and used arnica for the remainder of British Columbia with the exception of a comment that

nominate saepiolus ranges “northward to British Columbia where it gives way to insulanus ”. Scott

(1986) reported insulanus from southwestern British Columbia, south to northwestern California and east

to Montana and used arnica for the remainder of western Canada. Layberry et al. (1998) restrict insulanus

to Vancouver Island and attribute arnica to the remainder of the Canadian range. Shepard (2000) disputes

the assignment of coastal Oregon populations to insulanus and asserts that Vancouver Island populations

are a distinct subspecies found nowhere else in Canada. Guppy and Shepard (2001) restrict insulanus to

Vancouver Island and apply arnica to the remainder of BC and even south well into Oregon and east into

Alberta and western Montana. This differs from the interpretation of Hinchliff (1994) who assigned

Oregon coastal populations to insulanus and interior populations to saepiolus ; and also differs from

Hinchliff (1996) who assigned all Washington populations to saepiolus. Kohler (1980) assigned all

Montana populations to saepiolus. Bird et al. (1995) noted that “Most Alberta material can be assigned to

Plebejus saepiolus arnica”. Note however that Bird et al. (1995) illustrated a phenotype that is different

from that of any named saepiolus subspecies. Ferris et al. (1983) assign Yukon populations to arnica.

Additional uncertainty in subspecies status and geographic boundaries in the northwest is

introduced by the taxon Lycaena kodiak, described by Edwards (1870). This valid taxon has been

essentially ignored in the literature although Holland (1931:263) did note that it was originally described

from Kodiak Island and that it “is widely diffused through Alaska and the northwestern parts of British

America” [= Canada]. The name may have been ignored because, as Brown (1970) points out, none of the

three butterflies he illustrates under the name of kodiak are even of the same species as kodiak. Brown

also notes that other authors have historically misplaced the name kodiak. Brown (1970) clarified the

status of kodiak and designated a lectotype that correctly associates kodiak with the species Aricia

saepiolus. Guppy and Shepard (2001) provide a colour photograph of the male ventral surface of a

butterfly that resembles this taxon under the name of arnica , from Atlin, British Columbia. The taxon

kodiak is distinguished from arnica by its smaller size and darker grey ventral surface with more

pronounced dark spots.

The taxon rufescens has been reported from southern British Columbia (Blackmore 1920,

Llewellyn-Jones 1951). This butterfly was described as a full species, Lycaena rufescens Boisduval, 1869,

but has usually been treated as a female form name (e.g. Comstock 1927, Miller and Brown 1981). A

lectotype was designated by Emmel et al. (1998), who also restricted the type locality to Bear Valley, near

Olema, Marin County, CA. Emmel et al. (1998) treated rufescens as a junior synonym of the subspecies

aehaja Behr,1867 (type locality: alpine headwaters Tuolumne River, CA); although they gave no

rationale for this taxonomic interpretation. In contrast, Austin (1998) presents ample evidence for treating

6

rufescens as a subspecies of Aricia saepiolus distinct from aehaja ; at least in the geographic area he was

dealing with. At this time we do not know if rufescens is present in British Columbia as a form without

standing under the Code or if there are populations that warrant recognition as a species level name under

the Code.

Further elaboration and clarification of the insulanus component of this confused situation is

hindered by the fact that insulanus has not been found on Vancouver Island since 1979 (Shepard 2000;

specimens in Kondla collection). It may well be extirpated there and future workers therefore are limited

to examination of historical material in sundry collections for the purpose of comparing insulanus with

other taxa. Shepard (2000) itemises the location of approximately 146 specimens of insulanus in sundry

collections. A search of the Canadian Biodiversity Information Facility website by Kondla revealed the

existence of a few additional specimens in the collections of the Nova Scotia Museum of Natural History,

the Royal Ontario Museum and the Royal Saskatchewan Museum. There are likely still additional

specimens in various museums and private collections, including specimens collected by Richard Guppy

who supplied Vancouver Island butterflies to numerous collectors over many years. We would welcome

notification of the details of such additional specimens.

We provide photographs of two series of insulanus held by the CNC as an aid to future researchers

of saepiolus taxonomy. Figures 9 and 10 show dorsal and ventral views of insulanus from the type series

and the vicinity of the type locality. Figures 11 and 12 show an interesting series from Saratoga Beach

(east-central Vancouver Island) that is plainly different from the appearance of butterflies from the type

locality (southern Vancouver Island). Figures 7 and 8 show the types of insulanus and arnica side by side

to control for the vagaries of photography and to allow easy comparison of the differences and

similarities.

It is clear from this brief review that there are numerous and conflicting interpretations regarding

Aricia saepiolus in northwestern North America. It is equally clear that there is insufficient information

presented in the literature to allow an unambiguous assessment of which interpretation is most defensible

and congruent with reality in the field. There is no clarity as to where saepiolus grades into insulanus and

arnica or even if they do. There is no clarity as to where kodiak grades into arnica. The literature also

presents differing descriptions of the appearance of the taxa under discussion. We do not elaborate on

that here since it is more appropriate to include in a future taxonomic review.

Figure 9. Aricia saepiolus insulanus specimens from the type locality. Photo: C. Guppy

Figure 10. Aricia saepiolus insulanus specimens from the type locality. Photo: C. Guppy

8

Figure 11. Additional insulanus specimens. More than one collection date on individual specimen labels,

otherwise all labels are identical to the example shown. Photo: C. Guppy

ACKNOWLEDGMENTS

We thank Dr. J. Don Lafontaine for providing access to the CNC. We also thank Dr. Zsolt Balint and

Dr. Kurt Johnson for reviewing a draft of this paper.

LITERATURE CITED

AUSTIN, G.T. 1998. Notes on Plebejus saepiolus (Boisduval) (Lepidoptera: Lycaeninae: Polyomatinae) in

Nevada, with description of a new subspecies. Pp. 819-824 in Emmel, T.C. (ed.). 1998. Systematics of

Western North American Butterflies. Gainesville, FL: Mariposa Press. 878 pp.

BALINT, Z. AND K. JOHNSON. 1997. Reformation of the Polyommatus section with a taxonomic and

biogeographic overview. Neue Entomologische Nachrichten 40:1-68.

BALINT, Z., C.S. GUPPY, N.G. KONDLA, K. JOHNSON, AND C.J. DURDEN. 2001. Plebeius Kluk 1780,

or Plebejus Kluk, 1802? Folia entomologica hungarica 62: 117-184.

BIRD, C.D., G.J. HILCHIE, N.G. KONDLA, E.M. PIKE, AND F.A.H. SPERLING. 1995. Alberta Butterflies.

The Provincial Museum of Alberta. 349 pp.

BIRD, C.D. AND C.D. FERRIS. 1979. Type locality of Epidemia dorcas florus (Lepidoptera: Lycaenidae).

Canadian Entomologist 111:637-639.

BLACKMORE, E.H. 1920. The Lycaenidae of British Columbia. Proceedings of the Entomological Society of

British Columbia (1919) 14:5-11.

_. 1923. Two new races of the genus Plebeius Linn, from British Columbia. Canadian

Entomologist 55:98-100.

BRIDGES, C.A. 1988. Catalogue of Lycaenidae & Riodinidae (Lepidoptera: Rhopalocera). Urbana, IL: C.A.

Bridges, vii + ii + 377 + ii + 115 + ii + 140 + ii + 101 + ii + 37 + ii + 12 + ii + 1 + ii + 10 pp.

BROWN, F.M. 1951. Colorado Plebeius saepiolus. Annals of the Entomological Society of America 44:286-

292.

_. 1969. The types of the lycaenid butterflies described by William Henry Edwards. Part II.

Lycaenidae. Transactions of the American Entomological Society 95:161-179.

_. 1970. The types of lycaenid butterflies named by William Henry Edwards Part DDL Plebejinae.

Transactions of the American Entomological Society 96:353-433.

DOWNEY, J.C. 1975. Genus Plebejus Kluk. Pp. 337-350 in Howe, W.H. (editor) The Butterflies of North

America, xiii + 833 pp. + 97 pis.

EDWARDS, W.H. 1863. Descriptions of certain species of diurnal lepidoptera found with the limits of the

United States and British America. No. 2. Proceedings of the Entomological Society of Philadelphia 2:78-

82.

_. 1870. Descriptions of new species of diurnal Lepidoptera found within the United States.

Transactions of the American Entomological Society 3:10-22.

_. 1884. Descriptions of new species of North American butterflies. Canadian Entomologist

15:209-211.

EMMEL, J.F., T.C. EMMEL AND S.O. MATTOON. 1998. The types of California butterflies named by Jean

Alphonse Boisduval: designation of lectotypes and a neotype, and fixation of type localities. Pp. 3-76 in

Emmel, T.C. (ed.). 1998. Systematics of Western North American Butterflies. Gainesville, FL: Mariposa

Press. 878 pp.

FERRIS, C.D. 1977. Taxonomic revision of the species dorcas Kirby and helloides Boisduval in the genus

Epidemia Scudder. Bulletin of the Allyn Museum 45:1-42.

FERRIS, C.D., C.F. DOS PASSOS, J.A. EBNER, AND J.D. LAFONTAINE. 1983. An annotated list of the

butterflies (Lepidoptera) of the Yukon Territory, Canada. Canadian Entomologist 115:823-840.

GUPPY, C.S. AND J.H. SHEPARD. 2001. Butterflies of British Columbia. Vancouver: UBC Press. 414 pp

HINCHLIFF, J. 1994. An Atlas of Oregon Butterflies. The Evergreen Aurelians. 176 pp.

_. 1996. The Distribution of the Butterflies of Washington. The Evergreen Aurelians. 162 pp.

HOLLAND, W.J. 1931. The Butterfly Book Rev. ed. Garden City, NY: Doubleday. xii + 424 pp. + 77 pis.

10

INTERNATIONAL COMMISSION ON ZOOLOGICAL NOMENCLATURE. 1999. International code of

zoological nomenclature, fourth edition. London: The International Trust for Zoological Nomenclature,

xxix + 306 pp.

KLOTS, A.B. 1936. The interrelationships of the species of the genus Lycaena Labricius (Lepidoptera,

Lycaenidae). Bulletin of the Brooklyn entomological Society 31:154-170.

KOHLER, S. 1980. Checklist of Montana butterflies (Rhopalocera). Journal of the Lepidopterists’ Society

34:1-19.

KONDLA, N.G. 1999. Pend-d’Oreille Butterfly Survey. Living Landscapes Program report for Royal BC

Museum and Columbia Basin Trust. 38 pp. (http://www.livingbasin.com/butterflv/)

LAYBERRY, R. A., P. W. HALL AND J. D. LALONTAINE. 1998. The Butterflies of Canada. University of

Toronto Press. 280.

LEUSSLER, R.A. 1935. Notes on the diurnal lepidoptera of the Canadian arctic collected by Owen Bryant in

the summers of 1929 to 1932. II. Bulletin of the Brooklyn Entomological Society 30:42-62.

LLEWELLYN-JONES, J.R.J. 1951. An Annotated Check List of the Macrolepidoptera of British Columbia.

Entomological Society of British Columbia, Occasional Paper No. 1. 148 pp.

MILLER, L.D., AND L.M. BROWN. 1981. A catalogue/checklist of the butterflies of America north of

Mexico. Lepid. Soc. Mem. 2:i-vii, 1-280.

OPLER, P.A. 1975. Subfamily Lycaeninae. Pp. 309-316 in Howe, W.H. (editor) The Butterflies of North

America, xiii + 833 pp. + 97 pis.

_. 1999. A Lield Guide to Western Butterflies. Boston: Houghton Mifflin, xiv + 540 pp.

SHEPARD, J.H. 2000. Status of five butterflies and skippers in British Columbia. Government of British

Columbia, Wildlife Working Report No. WR-101. 27 pp.

SCOTT, J.A. 1978. The identity of the Rocky Mountain Lycaena dorcas-helloides complex. Journal of

Research on the Lepidoptera 17:40-50.

_. 1986. The Butterflies of North America: A Natural History and Lield Guide. Stanford, CA:

Stanford University Press. 583 pp.

TRAUPMAN, J.C. 1970. The New College Latin and English Dictionary. Bantam Books, Inc. 502 pp.

The Taxonomic Report

is a publication of The International Lepidoptera Survey (TILS).

(A Tax Exempt Non-Profit Scientific Organization )

The Taxonomic Report is projected for publication at the rate of 8-10 issues a year. Subscription/

dues for Volume Four are $45 US for North America (Can., US., Mex.) and $55 US for overseas

subscribers. The subscription year follows the calendar year. All issues are mailed 1 st class. At the end of

each year, subscribers receive that year’s volume on a record-only compact disc (CDR) for permanent

archiving and reproduction for personal use (i.e. museums & universities may make as copies as needed

in whatever format desired). Non-members may receive individual issues in print for $5 per issue.

Individual issues on CDR to non-members are $15 per issue post paid. Subscriptions and individual

issue orders should be made payable to TILS; and mailed to: Treasurer, 126 Wells Road, Goose Creek,

SC USA 29445-3413.

Articles for publication are sought. They may deal with any area of taxonomic research on

Lepidoptera. Before sending a manuscript, simply write TILS at the above address to set up discussion on

how to best handle your research for publication.

Catch us on the web at: www.tils-ttr.org

ii

Volume 3

15 June 2002

Number 7

The Taxonomic Report

OF THE INTERNA TIONAL LEPIDOPTERA SURVEY

PTEROURUS APPALACHIENSIS (PAPILIONIDAE: PAPILIONINAE),

A NEW SWALLOWTAIL BUTTERFLY FROM

THE APPALACHIAN REGION OF THE UNITED STATES

HARRY PAVULAAN 1

494 Fillmore Street, Herndon, VA 20170

AND

DAVID M. WRIGHT

124 Heartwood Drive, Lansdale, PA. 19446

ABSTRACT: A new univoltine species of Tiger Swallowtail, Pterourus appalachiensis, is described from the southern

Appalachian Mountain region of the eastern United States. This distinct swallowtail has remained unrecognized by

lepidopterists since the description of its sympatric congener Pterourus glaucus (Linnaeus) in 1758. Historical accounts of

Tiger Swallowtails from this region pertain specifically to glaucus and cannot be attributed to this new species. Morphology,

voltinism, phenology, distribution, and behavioral traits indicate species level status of appalachiensis. Although

appalachiensis shares several phenotypic characters with the recently elevated species canadensis (Rothschild & Jordan),

preliminary mitochondrial DNA analysis indicates that appalachiensis is more closely related to glaucus. Additional work

is needed to identify the natural hosts and evolutionary origins of this fascinating species.

Additional key words: Cryptic species, sympatry, species complex.

REVIEW OF PTEROURUS GLAUCUS (LINNAEUS)

The insect commonly known for over 150 years as the Tiger Swallowtail (Miller, 1992) and more

recently as the Eastern Tiger Swallowtail (NABA, 1995) has been the subject of intensive investigation in

recent years regarding its ecology, genetics, and systematics (Scriber et al., 1995; Scriber, 1996). It was

the first butterfly depicted by an artist from the New World. John White, while serving as the expedition

leader of Sir Walter Raleigh’s third sortie to America (“Virginia” = Roanoke Is., North Carolina), rendered

the famous first painting in 1587 which was reproduced in Holland (1931, PI. 77) (Fig. 1). Despite some

exaggerations through artistic license, White otherwise provided accurate detail. The specimen appears to

be a male. Among marginalia appended to the original painting is the name “Mamankanois”, that is

believed to be an equivalent to the Native American Indian name for “butterfly”. The painting fell into the

hands of Thomas Moffett of London, who directed the making of a woodcut facsimile and its eventual

publication in 1634 (p. 98) (Fig. 2). Moffett’s figure was copied by Jonstonus in 1657 (PI. 5) (Fig. 3). The

butterfly was described again by Merret (1666) and Petiver (1699), but not figured. Petiver formerly called

it “Papilio Caudatus, luteus, maximus, Virginianus ” and informally referred to it as “Moffet’s great yellow

1 Research Staff member, The International Lepidoptera Survey, 126 Wells Road, Goose Creek, South Carolina 29445

Figures 1-6: Earliest artistic renditions of Pterourus glaucus glaucus. Fig. 1. Mamankanois from White, 1587.

Fig. 2. Moffett’s 1634 rendition of Mamankanois. Fig. 3. Jonstonus’ 1657 copy of Moffett’s cut. Fig. 4. Papilio

caudatus maximus, Carolinianus in Catesby, 1736. Fig. 5. Dorsal, Papilio alcidamas, Cramer, 1775. Fig. 6.

Ventral, Papilio alcidamas, Cramer, 1775.

and black Virginia Butterfly”. He also cited the works of Moffett, Jonstonus and Merret. The next depiction

(PL 83) was by Catesby in his The Natural History of Carolina, Florida and the Bahama Islands . Vol. 2

(1736) (Fig. 4). Catesby called it “ Papilio caudatus maximus, Carolinianus ” and cited Petiver’s work.

These pre-Linnean names have no standing in The Code, however illustrations and descriptions published

in this period may be used by authors erecting Latin names in 1758 and afterward (Article 3.2) (ICZN

1999).

The next descriptions came from Linnaeus (1758), whose Svstema Naturae (10 th ed.) marked the

official beginning of zoological nomenclature. Linnaeus first described Papilio glaucus (p. 460) from a

dark female form. The location was described as “ Habitat in America.” No type specimen was designated

and it is believed that none existed. In the same publication, Linnaeus described Papilio antilochus (p.

463). He cited the previous works of Petiver and Catesby, and in so doing referred to a male specimen.

The location was given as “ Habitat in America Septentrionalis .” Similarly, no type specimen was

designated, and it is believed that none existed. Linnaeus (1771) later described Papilio turnus from the

yellow form of the female and the location was described as “ Habitat in America”. No figure or type was

provided. Cramer (1775) described Papilio alcidamas (PI. 38) from a male specimen, and gave the

location as “Jamaica, but also can be found from New York to Carolina.”. The plate depicts a typical

summer form glaucus male (Figs. 5 & 6). No type specimen is known. Rothschild and Jordan (1906)

restricted the type locality to “New York, Carolina”.

DISCOVERY OF AN UNUSUAL SWALLOWTAIL

During the interval 1985 to 2001, while conducting research in various sites of the southern

Appalachian Mountains, yearly emergences of an unusual Tiger Swallowtail were consistently noted. The

annual appearance of this butterfly was interpolated in the staggered emergence of what was considered to

be one species Pterourus glaucus. Traditionally, offset spring flights of an individual species in the

mountain region are attributed to stratified climatic conditions. At higher elevations average colder

temperatures directly affect the emergence dates of butterflies, where the first individuals appear later than

those at lower elevations. In time, however, it became evident to us that climatic conditions could not

account for significant differences between low and high altitude populations. The contrasting phenotypes

and differences in voltinism between Piedmont and Appalachian populations were reminiscent of sibling

species. We theorized that two taxa were likely involved, i.e. standard glaucus and a new species.

Privately, we choose a temporary moniker for the latter (“giant canadensis ”) because it was quite large and

immediately recognizable by its canadensis-like yellow submarginal band on the ventral forewing.

Furthermore, it had a single brood and lacked a black female form. Careful subsequent sampling allowed

us to establish a primary southern Appalachian distribution for this new taxon.

The principal question was did this unusual swallowtail represent an unrecognized population of

Pterourus canadensis (Rothschild & Jordan) in the southern Appalachians. Allen (1997) included P.

canadensis in the West Virginia fauna based on phenotypic similarity of mountainous West Virginia

populations to canadensis populations from areas much further north (Figs. 7 & 8). The primary

distinguishing feature of canadensis is the strongly developed yellow submarginal band on the ventral

forewing. In glaucus this band becomes a row of yellow lunules interrupted by black. On June 10, 2001,

we sampled and measured several Pterourus swallowtails on the summit of Spruce Knob in Randolph Co.,

WV (4861 ft., Canadian Zone). One segregate of individuals (n=8) was immediately recognizable as

canadensis by diminutive size (FW costal length 43-48 mm) and a strongly developed submarginal band.

This is the only location where we have found canadensis in West Virginia, though Allen lists it from five

counties. Several attempts to find it at Dolly Sods Natural Area in Tucker Co., WV (Canadian Zone) were

unsuccessful. Also flying with standard canadensis at Spruce Knob were (n=18) much larger individuals

3

(51-65 mm) of the “giant canadensis ” phenotype observed elsewhere in the southern Appalachians. With

two size segregates clearly present in West Virginia and only the larger phenotype occurring further south in

the mountains, we felt it was unlikely that “giant canadensis ” actually was canadensis.

For a time we also entertained the possibility that “giant canadensis ” represented a hybrid

phenotype between low altitude P. glaucus and undiscovered populations of P. canadensis at higher

elevations. Allen (1997) reported that hybridization between glaucus and canadensis probably occurred in

West Virginia and that canadensis ranged further south in a hybrid zone through Virginia to western North

Carolina. However, an exhaustive search of the mountains of western North Carolina and eastern

Tennessee, the Blue Ridge of Virginia, and Dolly Sods Wilderness of West Virginia proved unsuccessful in

finding the small canadensis phenotype. We also observed that the spring brood of glaucus was noticeably

absent at higher elevations. Thus in the absence of one parent species or both, hybrids would not be

possible. Since the new taxon occurred in such dominant numbers over such broad mountainous regions,

we were convinced it was not the product of ongoing hybridization.

It is important to call attention to a confounding situation at low and mid elevations in the

Appalachians. Small canadensis- like variants of glaucus (Fig. 9) occur there regularly in the early spring.

These variants often possess strongly developed yellow submarginal bands on the ventral forewing, making

them difficult to distinguish from canadensis on the basis of that character alone. In some, the black margin

of the inner hindwing is also broad, however, this is usually narrower in these variants and aligns with

descriptions of this trait in glaucus. Virtually all females associated with these early spring, yellow -

banded males are readily identified as glaucus (Fig. 10), because they have considerable blue on the dorsal

hindwing. Also approximately 50% of the early spring females are the black form glaucus (Linnaeus) (Fig.

12) in our study area in northern Virginia. Offspring of these early spring canadensis- like variants,

obtained from ovipositions in captivity on both Prunus serotina and Liriodendron tulipifera , yield typical

summer form glaucus adults. Routinely, the early spring populations of glaucus (Fig. 11) on the coastal

plain and outer Piedmont fail to generate strong canadensis- like traits.

The yellow submarginal band on the ventral forewing is a consistent feature of several North

American Pterourus swallowtails including P. canadensis in the north; P. rutulus (Lucas), P. eurymedon

(Lucas) and P. multicaudatus (W. F. Kirby) in the west; and P. alexiares (Hopffer) in Mexico. Glaucus is

the exception among the Tiger Swallowtails in having the submarginal band replaced by a row of yellow

crescents. We scanned several eastern collections for yellow banded specimens from the Appalachian

Mountains in western North Carolina to south-central Pennsylvania and found additional males & females

with this character which had been previously labeled “ Papilio glaucus ”. All of these specimens were

collected within the hypothetical flight period (May-June). The females bore a striking resemblance to P.

canadensis on the ventral forewings, but departed significantly from canadensis on the dorsum. Taken all

together, our observations lead us to conclude that we were seeing an unrecognized species. A unique

feature of the new taxon is its considerable size, which is in stark contrast to what one would expect in a

spring swallowtail in the mountain region.

The most extensive historical coverage of Tiger Swallowtails from this region is found in Clark &

Clark (1951). These authors devoted 20 pages to phenotypic variation within glaucus , not only in Virginia

but also throughout the entire species range, which included at-the-time subspecies canadensis. Having

carefully read and reread this work, we cannot find clear reference to a unique Appalachian Mountain

phenotype. The authors described an early spring phenotype (“late March or early April”) from northern

Virginia as being comparable to canadensis and even to Alaskan P. canadensis arcticus (Skinner). Their

description is attributable to the early spring canadensis- like variant of glaucus (Fig. 9) which we found

primarily in the Blue Ridge region. Clark & Qark (1951) also described a late-spring phenotype which

emerged “ten days or two weeks after the first appearance” of the early spring form. They considered this to

be normal glaucus , though somewhat intermediate between spring and summer forms. It contained both

black and yellow female forms. Their spring form intergraded through an “unbroken series” to “the typical

Figures 7-12: P. canadensis and early spring P. glaucus (all split dorsal/ventral aspects). Fig. 7. d P. canadensis : no date,

Miners Bay, Ontario, Canada (leg. unknown). Fig. 8. 9 P. canadensis : same data as 7. Fig. 9. d P. glaucus : 4 May 2001,

Buck Creek, Clay Co., North Carolina (leg. Gatrelle). Fig. 10. 9 P. glaucus : 27 April 1999, Blue Mountain, nr. Linden,

Warren Co., Virginia. Fig. 11. d P. glaucus : 23 April 1993, Germantown, Montgomery Co., Maryland. Fig. 12. 9 P.

glaucus : 7 April 2002, same data as 10. All leg. Pavulaan except Figs. 7-9. All are actual size. Photos: Joe Mueller.

[summer] form” which appeared shortly after the end of the spring flight; occasionally the two broods

overlapped. Our observations of glaucus on the Piedmont and in the lower mountain elevations parallel

those of the Clarks, which is consistent with a bimodal spring emergence pattern (early spring & mid

spring). Clark & Clark (1951) also discussed glaucus in other text sections of their Virginia monograph,

including a curious reference to “northern 1-brooded forms still persisting] in the mountains” (p. 7) and to

“[some] pupae...remaining dormant until the following spring” (p. 123). Our interpretation is that they did

not recognize these points as referable to a different but fairly cryptic species.

DESIGNATION OF NEOTYPES

We contend that name-bearing types serve to stabilize taxonomic nomenclature and are compelled to

designate neotypes for the four names previously published for the species Pterourus glaucus (Linnaeus) in

the eastern United States. These names are Papilio glaucus Linnaeus 1758, Papilio antilochus Linnaeus

1758, Papilio turnus Linnaeus 1771, and Papilio alcidamas Cramer 1775. By erecting name-bearing

types, the nomenclature relating to Pterourus glaucus is fixed and clarified. This action will help to

distinguish glaucus from the new species being described below for which there is no available name.

Papilio glaucus Linnaeus 1758. Svstema Naturae . 10 th ed. Vol.l Stockholm, 824 pp.

Original description: (p. 460) Glaucus. 9. P. E. alis subcaudatis nebulosis concoloribus:

primoribus macula flava; posticus macula ani fulva. M. L. U. Habitat in America. Alae Posticus

Linea transversa fusca bifida; ceteratum Troilo similis. [Wings dark, cloudy & tailed. Yellow

spots on forewings. Hindwings with reddish spot in anal region. Found in America. Wing surfaces

with dark indistinct forked transverse veins, otherwise similar to troilus.]

Neotype: A typical black female specimen of the summer brood (Fig. 19) is hereby designated as

the neotype of Papilio glaucus Linnaeus 1758. It is currently deposited in the Museum of the

Hemispheres, Goose Creek, South Carolina, and bears the following labels: A large label which

reads: Pterourus glaucus female / Summer black form / September 10, 2000 / Sandbridge /

Virginia Beach, VA. A small red hand-written label which reads: NEOTYPE / Papilio glaucus

Linnaeus 1758 / designated by H. Pavulaan & D. Wright. This specimen was collected from an area

near to the John White lead settlement on Roanoke Island, NC, and fixes the name-bearing type to a

coastal plain population. This population presently contacts neither P. canadensis nor P.

appalachiensis. The type locality is also outside the range of subspecies P. glaucus maynardi

(Gauthier, 1984).

Papilio antilochus Linnaeus 1758. Svstema Naturae . 10 th ed. Vol.l Stockholm, 824 pp.

Original description: (p. 463) Antilochus. 28. P. E. alis caudatis concoloribus flavis: fasciis

margineque nigris, caudis albis longitudine alae. Pet. Mus. 50. N. 505. Papilio caudatis maximus,

striis umbrique nigris. Catesb. Carol. 2. T. 83 Habitat in America Septentrionalis . [Wings yellow

& tailed. Black bands and margin. Tail edged longitudinally with white. Petiver’s Musei

PetiveranL etc. (page) 50. No. 505. Large tailed butterfly with black stripes. Catesby’s Natural

History of Carolina. Florida and the Bahama Islands . Vol. 2, pi. 83. Found in North America.]

Neotype: A typical yellow male specimen of the summer brood (Fig. 17) is hereby designated the

neotype of Papilio antilochus Linnaeus 1758. It is currently deposited in the Museum of the

Hemispheres, Goose Creek, South Carolina, and bears the following labels: A large label which

reads: Pterourus glaucus male/ Summer form / July 17, 1988 / Corapeake / Gates Co., NC. A small

6

red hand-written label which reads: NEOTYPE / Papilio antilochus Linnaeus 1758 / designated by

H. Pavulaan & D. Wright. This specimen was collected from a coastal area near to the John White

lead settlement on Roanoke Island, NC, and represents a corresponding male to the Papilio glaucus

neotype.

Papilio turnus Linnaeus 1771. Mantissa Plantarum . 2nd ed. Stockholm, 587 pp.

Original description: (p. 536) Turnus PAPILIO E. A. alis caudatis concoloribus flavis:

primoribus fasciis quinque dimidiatis posticeque nigris. Habitat in America. D. Fabricius. Corpus

2: dae magnitudinus, facie P. Machoanis. Thorax limeis flavis. Alae primores concolores, flavae,

fascii, 5 nigris ad margineum. Extetiorem: harum prima in ipsa basi; fecunda excurrens peralam.

Posticam; margo posticus late niger lunulis 8 geminatus flavis._ posticae repundae, caudatae,

subconcolores, flavae, versus postica nigrae. Fascia 2: da primorum excurrens versus angulum ani.

Lunulae marginis postici, 6 lutae (subtus nagis fulvae) praeter totidem. Lineares marginales. Canda

lanceolata nigra. [ Papilio turnus. Wings yellow and tailed. Forewings with five black bands and

hindwings with (about) half as many. Found in America. D.(?) Fabricius. Body (abdomen) twice

the size, same appearance as P. machaon. Thorax with yellow lines. Forewings uniformly yellow

with five black bands and exterior margin; First band at the base of wing, others fanning out to outer

margin. Wide black border with eight small lunule-like yellow eyespots. Hindwings curved

backward, tailed, nearly all yellow, turning black near edge. Bands on forewing twice the size as

those on hindwing, tapering toward anal or posterior portion of wing. Six golden yellow lunules

near margins of hindwings (underneath more reddish) in addition to just as many tiny marginal lines,

separated by small black distinct projections.]

Neotype: A typical yellow female specimen of the summer brood (Fig. 20) is hereby designated as

the neotype of Papilio turnus Linnaeus 1771. It is currently deposited in the Museum of the

Hemispheres, Goose Creek, South Carolina, and bears the following labels: A large label which

reads: Pterourus glaucus female / Summer yellow form / September 10, 2000 / Sandbridge /

Virginia Beach, VA. A small red hand-written label which reads: NEOTYPE / Papilio turnus

Linnaeus 1771 / designated by H. Pavulaan & D. Wright. This specimen was collected at the same

location as the Papilio glaucus neotype.

Papilio alcidamas Cramer 1775. De Uitlandsche Kappelen , etc. Vol. 1. Amsterdam, 156 pp.

Original Description: (p. 62) PLAAT XXXVffl. Fig. A. B. Alcidamas. Deze Pagie of Grieksche

Ridder Kapel (Pap. Eq. Achivi) gelykt eenigermaate naar de zoogenaamde Konings-Pagie

( Podalirius Sp. 36. Linn.) die Niet alien in Europa, maar ook in de West-Indien zig onthoud. Deze

komt von Jamaika, en valt ook in Nieuw-Jork en Carolina. [Plate 38. Fig. A. B. Alcidamas. This

species of tailed butterfly with Greek name, which resembles a closely related species {podalirius

Linn.) that is found in Europe, can be found in West Indies. This one comes from Jamaica, but also

can be found from New York to Carolina.]

Neotype: A yellow male specimen of the summer brood, which closely resembles Cramer’s plate

(Fig. 18), is hereby designated the neotype of Papilio alcidamas Cramer 1775. It is currently

deposited in the Museum of the Hemispheres, Goose Creek, South Carolina, and bears the following

labels: A large label which reads: Pterourus glaucus male / Summer form / September 10, 2000 /

Sandbridge / Virginia Beach, VA. A small red hand-written label which reads: NEOTYPE /

Papilio alcidamas Cramer 1775 / designated by H. Pavulaan & D. Wright. This specimen was

collected at the same location as the Papilio glaucus neotype.

Figures 13 - 16: Pterourus appalachiensis types. Figs. 13 & 14. Holotype d* Pterourus appalachiensis : 10 May 2001, Buck

Creek (3200’), Clay Co., North Carolina (leg. Gatrelle). Figs. 15 & 16. Paratype (allotype) 9 Pterourus appalachiensis : 29 May

2001, trail to Scaly Mountain (4300’), Macon County, North Carolina (leg. R. Gatrelle). Specimens are actual size. Photos: Joe

Mueller.

9

Cu2, while in male it;

• cell Cul. Wing

vein Cu2), and blue.

11

Larval hosts. One of the

zs (Walnut), Carya (Hickory), to

(Magnolia), Ostry

(Tuliptree), and F

it of Spruce Knob in P

J cies of Benda (Birch)

13

smafl portable size (l’x l’x 2’) to large sturdy size (3’x3’ x 5’) were also employed. Many small tree species wereplaced

in these cages as planted, potted, or fresh cut specimens. These included wild or in some cases nursery stock of Prunus

'a and Prunus serotina in the first day of captivity. In summer of2000, another confined blaclfform

is univoltine. The flights of appalachiensis and canadensis are essentially synchronic where they are sympatric in higher

elevations of West Virginia. RECORDED FLIGHT: North Carolina: May 4 (2001) - June 1 (1988); Virginia: April 22

(2001) - June 23 (2000) with mid-late May peak; West Virginia: May 25 (2002) - June 5 (2002); Maryland: June 3 (1990);

14

SET*

10 ft. high (and higher) in

iy patches in the woodland habitat. Theyhave

Range, (maps A & B pg. 20). The range at this writing is believed to be pi

ain region of the eastern United States. The type locality is situated near the south

f CO.: Blue Ridge Park

RAPPAHANNOCK C

(Blue Ridge), Front Royal, Blue Ridge (Shenandoah National Park).

Mountains National Park. WEST VIRGINIA: GRANT CO.: Dolly Sods

15

GENETIC AND EVOLUTIONARY RELATIONSHIPS.

The eastern Pterourus species (glaucus, canadensis , and appalachiensis) share an extensive suite of

morphological and biological features which is a strong indication of common ancestry. Hagen et al. (1991)

recently summarized the evidence demonstrating significant differentiation between glaucus and canadensis.

These two species are distinguished by genetically-controlled differences in adult, larval, and pupal stages.

Canadensis has a gene for obligate pupal diapause which offers a selective advantage in colder climates where the

growing season is shortened and the butterflies are limited to one generation (Hagen & Scriber 1989). On the

other hand, diapause in glaucus appears to be environmentally determined. A zone of thermal unit accumulations

necessary to complete two successful generations (Hagen et al. 1991) delineates the northernmost limit of glaucus.

Under these control systems, the glaucus range cannot expand northward but the canadensis range may expand

southward. The isotherm that corresponds to the thermal watershed between bi- and univoltine populations

coincides with a complex plant ecotone and a narrow zone of butterfly hybridization. This isotherm is sharply

defined across the Great Lakes region, but is much less regular and uncertain further east. The isotherm follows a

southward course through Pennsylvania and rides the high elevations of the Appalachian Mountains to North

Carolina (Scriber & Cage 1995). It has been predicted that the Appalachians provide altitudinal refugia for

canadensis types and that an inability to complete two generations would select against glaucus (Scriber et al.

1996). Many individuals from the mountainous regions of West Virginia are phenotypically canadensis ; also the

highest elevations of the state support veiy small phenotypes that may be true relict canadensis. The

southernmost limit of these small canadensis types is in West Virginia. They are not found further south in the

Appalachians, a situation that is analogous to distributions of other northern butterflies (Colias interior , Lycaena

epixanthe , Celastrina lucia, Speyeria atlantis ).

Pterourus appalachiensis appears to replace canadensis in the Appalachians south of West Virginia. This

large univoltine swallowtail combines the phenotypic markings of canadensis and the large size of summer

glaucus. Its origin is unknown. However, because a considerable portion of its mitochondrial DNA is similar to

glaucus , we conclude that it is neither P. canadensis nor a predominately canadensis hybrid. The latter have the

external appearance of typical canadensis, but their larvae can also detoxify tuliptree (Scriber, 1998). Instead we

suspect appalachiensis evolved principally from a glaucus genome initially as a physiologic race or through

introgression of unique genes. It is possible that appalachiensis independently evolved genes advantageous for

life at high elevation or acquired them during past periods of interbreeding. Climatic variation during the

Pleistocene could have expanded the range of canadensis to contact ancestral appalachiensis in the southern

Appalachians. The acquisition of an obligate diapause gene (among others) may have accelerated the

acclimatization of appalachiensis to the southern Appalachian highlands in the post Pleistocene period.

Veiy little is known about isolating mechanisms between appalachiensis and glaucus in nature. Their

nearly allochronic flights, differing altitude preference, and contrasting behaviors (especially of females) would

seem to keep their zone of contact confined to a narrow ecological gudient. To the extent that hybridization

occurs, it has not diluted the essence of either taxa. Lastly, we raise the intriguing possibility that appalachiensis

is older than glaucus and is more closely related to a shared common ancestor with canadensis. Perhaps

appalachiensis provided the advantageous genes that spurred canadensis radiation in the north.

Hybridization study. In a limited breeding study, a reared black form female P. glaucus (ex larva,

9/10/00, on Prunus serotina from Virginia Beach, VA) was crossed with a male P. appalachiensis (captured at

Blue Mountain, Warren Co., VA, on April 22, 2001) and placed inside a breeding cage with P. serotina. This

female oviposited readily and produced 24 ova in two days before dying. All ova yielded first instars with a single

white saddle mark and a very faint tan rear saddle mark, thus appearing like the two documented appalachiensis

larvae. Eight died in the first instar stage. An additional six larvae died during development and the remaining ten

reached pupal stage. These pupae diapaused and were placed outdoors in a protected location before being taken

indoors in late February, 2002. Seven pupae produced large males of intermediate phenotype between

appalachiensis and glaucus. The three largest pupae (females) failed to eclose. The apparent failure to produce

eclosed hybridized females parallels our inability to find naturally-occurring intermediate females (esp. black

forms) in our study sites and may be indicative of an isolating mechanism at work.

16

A NOTE ABOUT THE NORTHERN LIMIT OF APPALACHIENSIS.

More work is needed to ascertain the northern limit of appalachiensis. Field observations in Rhode Island

from 1983 to 2001 recorded a regular sequence of emergences of Tiger Swallowtails throughout the state. The

season began with flights of both standard glaucus and canadensis- like phenotypes in April, which often lasted until

early June. No black females were recorded in RI during the spring. A second emergence, consisting of very large

appalachiensis- like phenotypes emerged during the month of June and flew into early July. Likewise, no black

females were recorded in this emergence. During the latter half of July, a second brood of glaucus appeared and flew

into early September. The latter consisted of a variety of forms, including large ochreous yellow females and

occasional black females in years of abundance (M. Schenck, pers. obs.) In 1983, captive females of both spring

glaucus and canadensis- like phenotypes oviposited freely on Prunus serotina. The glaucus progeny produced typical

summer specimens in the same year (second brood). The progeny of canadensis- like females went into diapause

(pupae desiccated during the following winter). Females of the appalachiensis- like phenotype captured in June also

oviposited on P. serotina and produced diapausing pupae (pupae desiccated during the following winter). The

experiment with RI appalachiensis-\ike females was repeated in 1994. Diapausing pupae successfully survived the

winter and produced appalachiensis-Wke, adults in early July of the following year. We intentionally did not include

Rhode Island in the formal range of appalachiensis in our paper, and leave open the question of its occurrence in

southern New England to future hvestigation. The issue of a potential hybrid zone of glaucus x canadensis (and/or

glaucus x appalachiensis ) in this region needs clarification.

We gratefully acknowledge the following people and thank them for their invaluable service: Ronald Gatrelle

for providing specimens (including the type specimens) from North Carolina and reviewing the manuscript; Niklas

Wahlberg, Department of Zoology, Stockholm University, Sweden, for performing mitochondrial DNA analyses; Felix

Sperling, Department of Biological Sciences, University of Alberta, for providing directions to access the databases at

NCBI; Eileen Mathias, Information Services Librarian, Ewell Sale Stewart Library, The Academy of Natural Sciences

of Philadelphia, Philadelphia, PA for assistance in researching historical literature; Don Azuma, Entomology

Department, The Academy of Natural Sciences of Philadelphia, for access to collections; Jackie & Lee Miller, Allyn

Museum of Entomology, Sarasota, FL, for access to collections: Eric Quinter, Entomology Department, American

Museum of Natural History, New York, NY, for access to collections; John Rawlins, Section of Invertebrate Zoology,

Carnegie Museum, Pittsburgh, PA, for access to collections; Alex Grkovich for sharing collection data; Bob Gardner

for sharing western Maryland field notes and corroborating some observations; Tom Allen, West Virginia DNR,

Elkins, WV, for stimulating discussions of Pterourus swallowtails in his state; Joseph Mueller for photography of

specimens.

17

LITERATURE CITED

ALLEN, T.J. 1997. The Butterflies of West Virginia and Their Caterpillars. Pittsburgh, PA: University of Pittsburgh

Press, xii + 388 pp.

CATERINO, M.S., and F.A.H. SPERLING. 1999. Papilio phylogeny based on mitochondrial cytochrome oxidase I

and II genes. Molecular Phylogenetics and Evolution 11(1): 122-137.

CATESBY, M. 1736. The Natural History of Carolina, Florida and the Bahama Islands. Vol.2. Printed by author.

London, 100 pp + appendix 20 pp + index.

CLARK, A.H., and L.F. CLARK. 1951. The Butterflies of Virginia. Smithsonian Misc. Collections 116(7): vii +

239 pp.

CRAMER, P. 1775. De Uitlandsche Kappelen Voorkomende in de drie Waereld-Deelen Asia, Africa en America, by

een verzameld en beschreeven. Vol. 1. Amsterdam: Baalde, Utrecht, Wild, 156 pp.

GATRELLE, R.R. 2001. Initial Survey of the Butterflies and Skippers in the Vicinity of the Buck Creek Serpentine

Barrens, Clay County, North Carolina. The Taxonomic Report 3(5): 1-6.

HAGEN, R.H., R.C. LEDERHOUSE, J.L. BOSSART and J.M. SCRIBER. 1991. Papilio canadensis and Papilio

glaucus (Papilionidae) are distinct species. Journal of the Lepidopterists’ Society 45(4):245-58.

HAGEN, R.H. and J.M. SCRIBER. 1989. Sex-Linked Diapause, Color, and Allozyme Loci in Papilio glaucus :

Linkage Analysis and Significance in a Hybrid Zone. Journal of Heredity 80(3): 179-185.

HOLLAND, W.J. 1931. The Butterfly Book. Revised Edition. New York: Doubleday, Doran, 424 pp.

ICZN (International Commission on Zoological Nomenclature). 1999. International Code of Zoological

Nomenclature. 4 th ed. London: The International Trust for Zoology Nomenclature, 306 pp.

JONSTONUS, JOHANNES. 1657. Historiae naturalis de insectis, libri III. De serpentibus et draconibus, libri II ...

Amstelodami, Apud 1.1, fil. Amsterdam: Schipper.

KUKAL, O., M.P. AYRES, and J.M. SCRIBER. 1991. Cold tolerance of pupae in relation to distribution of

swallowtail butterflies. Canadian Journal of Zoology 69: 3028-3037.

LINNAEUS, C. 1758. Systema Naturae. 10 th ed. Vol.l Stockholm, 824 pp.

_. 1771. Mantissa Plantarum. 2nd ed. Stockholm, 587 pp. (Animalia p. 521-552)

MILLER, J.Y. 1992. The Common Names of North American Butterflies. Washington, D.C.: Smithsonian Press, 177

pp.

MERRET, CHRISTOPHER. 1666. Pinax rerum naturalium britanni carum, continens vegetabilia, animalia, et.

fossilia. London: F. and T.Warren.

MOFFETT, THOMAS. 1634. Insectorum sive mimimorum anumalium theatrum: olim ab ab Edoardo Wottono,

Conrado Gesnero, Thomaque Pennio inchoatum: tandem Tho. Morfeti Londinatis operasumptibusq: maximis

concinnatum, auctum, perfectum: et ad vivum expressis iconibus supra quingentis illustratum. [Edited by Sir

Theodore Turquet de Mayerne.] London: Thomas Cotes.

NAB A. 1995. The North American Butterfly Association (NAB A) Checklist & English Names of North American

Butterflies. Morristown, NJ: NAB A Special Publication. 43 pp.

PETIVER, JAMES. 1699. Musei Petiverinai centuria [secundadecima] Rariora Naturae continens: viz. Animalia,

fossilia, plantas. London: S. Smith and B. Walford.

ROTHSCHILD, W. and K. JORDAN. 1906. A revision of the American papilios. Novitates Zool. 13: 411-744.

SCRIBER, J. MARK. 1990. Interaction of introgression from Papilio glaucus canadensis and diapause in

producing “spring form” Eastern Tiger Swallowtail butterflies, P. glaucus (Lepidoptera: Papilionidae). The Great

Lakes Entomologist 23(3): 127-135.

SCRIBER, J.M. 1996. Tiger tales: Natural history of native North American swallowtails. American Entomologist

42(1): 19-32.

_. 1998. The inheritance of diagnostic larval traits for interspecific hybrids of Papilio canadensis and

P. glaucus (Lepidoptera: Papilionidae). The Great Lakes Entomologist 31(2): 113-123.

SCRIBER, J.M. and S.H. CAGE. 1995. Pollution and global climate change: Plant ecotones, butterfly hybrid zones

and changes in biodiversity, (p. 319-344) In J.M. Scriber, Y. Tsubaki & R.C. Lederhouse (eds.). Swallowtail

butterflies: Their ecology and evolutionary biology. Gainesville, FL: Scientific Publishers.

SCRIBER, J.M., R.H. HAGEN and R.C. LEDERHOUSE. 1996. Genetics of mimicry in the tiger swallowtail

butterflies, Papilio glaucus and P. canadensis (Lepidoptera: Papilionidae). Evolution 50(1): 222-236.

SCRIBER, J.M., Y. TSUBAKI, and R.C. LEDERHOUSE. (eds.). 1995. Swallowtail butterflies: Their ecology and

evolutionary biology. Gainesville, FL: Scientific Publishers, 459 pp.

APPENDIX

Provided below is the DNA nucleotide base sequence of the mitochondrial gene COI (cytochrome oxidase

subunit I) from the Pterourus appalachiensis male holotype and female paratype, plus the comparable sequence from

a typical male & female P. glaucus collected at the appalachiensis type locality. A total of 1460 residues of this 1.5

kb gene were aligned for comparison. In the display we have highlighted the two nucleotide positions that were found

to vary between these closely-related taxa.

Pterourus appalachiensis

TGAGCAAGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAACTCCGGTTCTTTAATTGGAGATGCCAAATT

TATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGACT

AGTACCTTTAATATTAGGGGCACCTGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAACT

CTTTTAATTTCAAGAATAATTGTTGAAAGTGGAGCTGGAACTGGATGAACTGTTTATCCCCCTCTTCTTCCAATATCGCTCATGG

AAGAAGATCAGTAGATTTAGTTATTTTTTCCCTTCATTTAGCAGGGATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACAA

TTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCTTTATTATTACTT

CTTTCATTACCTGTTTTAGCTGGAGCTATTACAATACTATTAACAGATCGAAACTTAAATACATCATTTTTTGATCCTGCAGGAG

GGGGAGATCCAATTTTATATCAACATTTATTTTGATNNNNNNNNNNNNNNNNNNTTTATATTTTAATTTTACCTGGATTTGGAA

TAATTTCTCATATTATTTCTCAAGAAAGAGGAAAAAAGGAAACATTTGGATGTTTAGGTATAATTTATGCTATAATAGCAATTG

GATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTAGGAATAGATACAGATACTCGAGCTTATTTTACCTCAGCAAC

aataattattgcagttcctactgg|attaaaatttttagatgattagcaactcttcatggaactcaaattaattatagtccatca

ATTTTATGAAGTTTAGGATTTGTATTTCTATTTACAGTAGGAGGATTAACTGGAGTAATTTTAGCTAACTCTTCTATTGATGTTAC

CTTACATGATACATATTATGTAGTAGCTCATTTTCATTATGTTTTATCTATAGGAGCTGTATTTGCTATTATAGGAAGATTTATTC

attgatacccattatttaccggtctttctttaaatccttatcttttaaaaattcaattttttacaatattttttgg|gtaaattta

ACCTTTTTTCCCCAACATTTCTTAGGATTAGCTGGAATACCTCGCCGATATTCAGATTATCCTGATAATTTTACCTCATGAAATAT

TATTTCTTCTTTTGGATCTTATATTTCTTTATTGTCATTAATAATAATAATAATAATTATTTGAGAATCAATAATTAATCAACGAA

TTATTTTATTTTCTCTTAATATACCATCATCTATTGAATGACTTCAAAACTTACCTCCTGCAGAACATTCATATAATGAACTTCCT

ATTTT

Pterourus glaucus

TGAGCAAGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAACTCCAGGTTCTTTAATTGGAGATACCAAAT

TTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGAC

TAGTACCTTTAATATTAGGGGCACCTGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAACT

CTTTTAATTTCAAGAATAATTGTTGAAAGTGGAGCTGGAACTGGATGAACTGTTTATCCCCCCTTTCTTCCAATATCGCTCATGG

AAGAAGATCAGTAGATTTAGTTATTTTTTCCCTTCATTTAGCAGGGATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACAA

TTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCTTTATTATTACTT

CTTTCATTACCTGTTTTAGCTGGAGCTATTACAATACTATTAACAGATCGAAACTTAAATACATCATTTTTTGATCCTGCAGGAG

GGGGAGATCCAATTTTATATCAACATTTATTTTGATNNNNNNNNNNNNNNNNNNTTTATATTTTAATTTTACCTGGATTTGGAA

TAATTTCTCATATTATTTCTCAAGAAAGAGGAAAAAAGGAAACATTTGGATGTTTAGGTATAATTTATGCTATAATAGCAATTG

GATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACAGTAGGAATAGATACAGATACTCGAGCTTATTTTACCTCAGCAAC

aataattattgcagttcctactgg|attaaaatttttagatgattagcaactcttcatggaactcaaattaattatagtccatca

ATTTTATGAAGTTTAGGATTTGTATTTCTATTTACAGTAGGAGGATTAACTGGAGTAATTTTAGCTAACTCTTCTATTGATGTTAC

CTTACATGATACATATTATGTAGTAGCTCATTTTCATTATGTTTTATCTATAGGAGCTGTATTTGCTATTATAGGAAGATTTATTC

attgatacccattatttaccggtctttctttaaatccttatcttttaaaaattcaattttttacaatattttttgg|gtaaattta

ACCTTTTTTCCCCAACATTTCTTAGGATTAGCTGGAATACCTCGCCGATATTCAGATTATCCTGATAATTTTACCTCATGAAATAT

TATTTCTTCTTTTGGATCTTATATTTCTTTATTGTCATTAATAATAATAATAATAATTATTTGAGAATCAATAATTAATCAACGAA

TTATTTTATTTTCTCTTAATATACCATCATCTATTGAATGACTTCAAAACTTACCTCCTGCAGAACATTCATATAATGAACTTCCT

ATTTT

In order to compare P. appalachiensis mtDNA with other Pterourus swallowtails of the glaucus group, COI

gene sequences were downloaded from the internet site of the National Center for Biotechnology Information (NCBI)

available at http:www.ncbi.nlm.nih.gov/ . Gene data were available for Papilio (Pterourus) glaucus from Potomac,

MD [Accession no. AF044013]; P. canadensis from Richford, NY [AF044014]; P. rutulus from Orcas Island, WA

[AF044015], and P. multicaudatus from Black Hills, SD [AF044016]. Collection localities were given in Caterino &

Sperling (1999). The P. glaucus samples from the Appalachian Mountains and the Piedmont share the same gene

sequence, while other taxa diverge from glaucus to varying degrees. From this preliminary comparison (Table 1), it

can be concluded that appalachiensis is much more closely related to glaucus than to canadensis or any other North

American Pterourus swallowtail.

19

Table 1

COI Gene

P. glaucus i

P. glaucus 2

P. appalachiensis

P. canadensis

P. rutulus

P. multicaudatus

X

X

X

X

X

X

No. of nucleotide base differences

A

0

X

X

X

0

2

X

X

X

c_

2

X

~25

~36

X

D

24

X

X

27

X

E

35

X

X

X

47

F

45

X

X

X

X

1 = North Carolina (Mts.)

Mitochondrial DNA data can only be evaluated in view of maternal lineages. Our limited sampling may have

failed to detect considerable intraspecific variation in appalachiensis. Small polymorphisms, such as those between

P. appalachiensis and glaucus above, could be interpreted either as a retained ancestral polymorphism or as evidence

of recent gene flow through hybridization. Molecular studies of multiple genes, particularly nuclear genes inherited

from both parents, may provide a balanced picture of the genetic history of appalachiensis. The combination of

genetic, morphological, and biological data will help define the limits of this species.

Visit The International Lepidoptera Survey on the World Wide Web at: TILS-ttr.org

- and -

Join the discussion at our list serve on YahooIGroups at: TILS-Leps-Talk

20

Volume 3

30 November 2002

Number 8

I:■: s-v The Taxonomic Report

OF THE INTERNA TIONAL LEPIDOPTERA SURVEY

A REVIEW OF POANES HOBOMOK (HESPERIIDAE: HESPERIINAE)

WITH THE DESCRIPTION OF A NEW SUBSPECIES

FROM THE SOUTHERN APPALACHIANS

RONALD R. GATRELLE 1 2

126 Wells Road, Goose Creek, South Carolina 29445-3413

ABSTRACT. Poanes hobomok monofacies is described from the southern limits of the Appalachian Mountains in

western North Carolina, northern Georgia and eastern Tennessee. The type locality is Chestnut Mountain, 3,400’, Macon

County, North Carolina. This new subspecies is characterized by the similarity of males and females and overall much darker

and subdued marking when compared to both P. h. hobomok (eastern to mid, northern US & eastern to mid, southern Canada)

and P. h. wetona (Colorado & New Mexico). The northern and western range of this new taxon and the area of its

intergradation with nominate hobomok remains to be established, however, specimens from as far south in the Appalachians

as West Virginia are nominate hobomok. All subspecific descriptions are presented. Syntypes are recognized for P.

hobomok in the MCZ, Harvard The type of wetona is illustrated for the first time. It is concluded that nominate hobomok

and wetona differ significantly only in females, that ridingsii is a doubtful subspecies, and monofacies has the most distinct

Additional key words: form alfaratta, melanism.

Discovery and Overview of a New Subspecies

Since the late 1980s I have made numerous trips to the southern Appalachian Mountains of western

North Carolina and northeast Georgia to research the butterflies and skippers of that region. Poanes

hobomok (Harris) 1862, is local, but not uncommon, in that area. In 1994, I noticed I had incorrectly

determined two males as females in the small sample I had collected in this region. This manifested that the

sexes were very similar and that both sexes were decidedly darker than individuals I had from the Midwest.

I thus began a concerted effort to collect hobomok at various locations in that region. By 2002 I had

acquired a sufficient sample from a variety of sites which confirmed that this was a unique and hitherto

undescribed subspecies of Poanes hobomok.

This new subspecies, described herein, has much less fulvous on the dorsal surface of males than

the males of the nominate subspecies (typical in New England region). Females of the new subspecies are

much less variable than nominotypical females. For example, while the dark female form pocahontas

(Scudder), 1864 is frequent to common in the New England region, it is apparently infrequent in western

North Carolina and northern Georgia. Further, New England and southeastern Canadian hobomok females

frequently have extensive dorsal fulvous (Fig. 10); this never occurs in females of the new subspecies.

Both males and females of the new subspecies have the ventral hind wing yellow patch reduced and within

1 Staff Researcher, The International Lepidoptera Survey, Goose Creek, South Carolina.

2 Research Associate, Florida State Collection of Arthropods, Gainesville, Florida.

25 26 27 28

Figs. 1-28: Poanes hobomok subspecies. Figs. 1/2 (DAO, <? P- h. wetona holotype (data pg. 5). Figs. 3/4 (DAO, ? P- h. wetona, Colfax Co.,

NM., leg. Spomer. Figs. 5/7 (D/V), d P. hobomok, Melrose, MA, 2 June 2002, leg. Grkovich. Figs. 6/8 (DAO, P. hobomok, Lake Co., MN, 29

July 1967. Figs. 9/11 (D/V), d P. hobomok, Gardner, MA, 8 June 2002, leg. Grkovich. Figs. 10/12 (D/V),? P. hobomok, Edmund-ston, NB,

CAN, 25 June 1961. Figs. 13/15 (D/V), d P. hobomok, Hardin Co., IA, 2 July 1967. Figs. 14/16 (D/V), ? P. hobomok (same data as 13). Figs.

17/19 (DAO, c? P. h. monofacies holotype (datapg. 6). Figs. 18/20 (D/V), ? P. h. monofacies allotype (datapg. 6). Figs. 21/23 (D/V), <J P. h.

monofacies paratype, Clay Co., NC, 24 May 2002. Figs. 22/24 (D/V), ? P. h. monofacies paratype, Macon Co., NC, Jones Knob, 16 May 2002.

Figs. 25/27 (D/V), lightest d P. h. monofacies paratype (data as 22). Figs. 26/28 (D/V), lightest ? P. h. monofacies paratype, (data as 22

except, 4 June 1993). 13-28 leg. Gatrelle. All X 1.20 natural size. Dorsal/Ventral. 17,18,21,22 form alfaratta.

a darker brown ground color than in nominate hobomok. The phenotype of the new subspecies is not

indicated to be an ecotype produced by altitude or short photoperiod. So far it has been found to occur as

low as 900 feet and as high as 4400 feet and likely has a much wider altitudinal range.

The western subspecies Poanes hobomok wetona Scott, 1981 was described from Colorado at

7200 ft. and displays the opposite phenotypic extreme as individuals are heavily fulvous in both males and

females (Figs. 1-4). Further, the lightest males and females in the east are found more commonly the further

north the species occurs into Canada. The many specimens I have examined in this study indicate that the

increase in dorsal fulvous correlates with increased elevation or shorter photoperiods. If this assessment is

correct, then the melanistic phenotype of the new subspecies is significant as it occurs in the opposite

phenotypic direction, but within the same short day niche, which indicates that this phenotype is a product of

genetics and not ecology - not an ecotype. It should be noted that melanistic facies are a common

occurrence among many species of Lepidoptera in the southern Appalachian region.

My primary purpose in this paper is to bring the existence of this subspecies to the attention of the

scientific and conservation communities. Thus, there are a few questions that remain to be addressed by

subsequent research. Foremost of which is the determination of the limits, or extent, of this taxon’s range. I

have examined a large number of specimens in the course of this study from throughout the range of species

hobomok. At present, the new subspecies is confirmed only from western North Carolina, Georgia, and

eastern Tennessee. It likely extends into northwestern South Carolina, northern Alabama and possibly much

further west (Arkansas?).

The few specimens of P. hobomok I have seen from West Virginia indicate that it does not occur

there but may inhabit the southernmost areas of that state. The blend zone may occupy much of Virginia and

north central North Carolina. Although this should not be assumed. For example, no mention of darker

males is made in either the Butterflies of West Virginia (Allen, 1997) or Butterflies of Virginia (Clark and

Clark, 1951) and both books figure typical Poanes hobomok hobomok males. Males with very reduced

dorsal fulvous (f. alfaratta Holland, 1930) are only know in the new subspecies described herein.

Examination of Described Taxa

Poanes hobomok hobomok

Poanes hobomok was described by Thaddeus W. Harris in 1862 as Hesperia hobomok. This was a

posthumous publication 6 years after his death (Harris: 1795-1856). This was in A TREATISE ON SOME

OF THE INSECTS INJURIOUS TO VEGETATION, third edition. (The cover reads: HARRIS'S INSECTS

INJURIOUS TO VEGETATION - FLINT.) This was actually the fourth in a series that began with the

REPORT ON SOME OF THE INSECTS INJURIOUS TO VEGETATION published by the Commissioners

on the Zoological and Botanical Survey of Massachusetts in 1841. The next three versions were in 1842,

1852 and 1862. Hobomok was not described until this 4 th edition - which is as follows.

Hesperia hobomok. Hobomok Skipper. (Fig. 137)

Dark brown above; on each of the wings a large tawny-yellow spot occupying the greater part of the middle, four or five

minute spots of the same color near the tips of the fore wings, on which is also a short brownish line at the outer extremity of

the central mesh; under side of the fore wings similar to the upper, but paler; hind wings brown beneath, with a yellow spot

near the shoulder, and a very broad deep yellow band, which does not attain the inner margin and has a tooth-like projection

extending towards the hinder edge. The male has not the usual distinguishing oblique dash on the fore wings, which differ

from those of the female only in the greater size of the tawny portion, which extends to the front margin.

Expands from 1 7/20 to 1 4/10 inch.

This skipper comes very near to the Otho of S mi th and Abbot (Which is not the same as the Otho of Boisduval), and

also approaches closely to a species that is figured in Dr. Boisduval’s work under the name Zabulon; but does not sufficiently

agree with either of them, and, in the belief that it has not been described before, I have given it the name of one of our

celebrated Indian chiefs. It is found in June and July.

3

No type locality is established in the text. Because earlier editions state that either New England or

Massachusetts is the area being surveyed, Massachusetts has historically been considered the type locality.

I am not comfortable with this technically as in the 4th volume in which the name hobomok is introduced no

state or region is mentioned anywhere. I thus here restrict the type locality to Massachusetts.

No type specimens are designated nor are any references given to any. There is a black and white

woodcut on the margin, but this was commissioned and added by the editor (Flint) and can not thus be

considered the type.

The Harris collection is located at the Museum of Comparative Zoology (MCZ), Harvard

University. There are four old specimens in the Harris collection which I believe are actual syntypes used

by Harris. Collectively they constitute the type (ICZN Article 73.2). These specimens have very few labels

but what labels they do have are quite significant. Three have only a hand written label that says 171. This

is a reference to Harris’s notebook where he listed his species by number. The only other data is a date on

the fourth specimen of - June 15 1839. I have sought to designate one of these as a lectotype but have been

unable to secure photographs from the MCZ. There is nothing in the OD text or in Harris’s notebook to

indicate that these are syntypes. But the one bearing a label of June 15 1839 is compelling evidence of an

actual type. If this specimen is in good condition, and especially if typical of Massachusetts’ specimens, I

recommend it be designated as the lectotype.

The MCZ web site provides information and photos of its types. The site refers to these 4

specimens as Type. The data is given but no photos. I have contacted the Museum to obtain more

information and photos of these specimens. I was told that photos were not available. Because another

hobomok subspecies is being described in the eastern United States, I think it important to have the

nominate taxon clearly defined by proper typification and type locality. This should be done as soon as

possible. There is always the possibility that one or more of these alleged types may yet prove to just be

old specimens that someone else wrote 171 on.

Brown (1975) conducted an in-depth study into the literary history and Code relativity of the

posthumous publication of this Harris name. While the information he uncovered is impressive, I disagree

with part of his conclusions. I have been assisted greatly in this by David Wright who concurs. The

problem is two fold. One issue is that of authorship of the name hobomok, the other date of publication.

There were three works that appeared about the same time and each had Harris’s descriptions in them. I

will just mention them here under Brown’s paper rather than cite them individually. They are the works of

Scudder, Morris and Flint. Brown seemed to think that the name hobomok might be attributable to one of

these men which is why he saw the date of publication of such importance.

Brown’s concern was unwarranted as in all cases the text of the description was clearly attributed

to Harris and put forth as his work alone. Since the Morris paper was dated as published in February of

1862 and all that is stated in the Flint volume re date of publication is simply 1862, Brown determined that

it was necessary to find the actual month of the Flint edition to assure proper authorship. One can read this

all in the Brown paper, so I will just address what I consider Brown’s error.

Brown concluded that there were several issuances of the 3rd edition. I do not accept this for two

reasons. First, if this were so I think they would have been referred to as different editions. Second, the

item Brown assessed the publication date by was the date of the Editor’s Preface in these books. These

are simply the dates each preface was written not the volume published. To me, this is proven by this

statement. “The copy in the British Museum (N.H.) library has the Editor’s Preface dated ‘Boston, December,

186T. The publication date for this printing is T862’ ”. Brown missed the obvious by seeing the publication

date as 1861 even though 1862 is explicitly stated. The Code requires that when a date of publication is

present that that is the date of publication. I don’t think we can tell the exact month the 3rd edition was

published. But this is a moot point, in my view, as the author is Harris regardless of the month or in which

of the three publications his description appeared in 1862 because the text is always attributed to Harris.

Poanes hobomok ridingsii

The number of subspecies recognized depends on how taxonomists assess (or synonymise) these

entities. Of the four possible subspecies, Poanes hobomok ridingsii F.H. & R.L. Chermock, 1940 is the

most controversial. The original description of ridingsii is quite odd. By the title and first portions of the

text, ridingsii is clearly presented as an infrasubspecific form which does not have availability by the rules

of the International Code of Zoological Nomenclature. However, the authors lastly apply this epithet as a

subspecies in the Riding Mountains and types are designated.

Thus, ridingsii is introduced as a form but made an available name within the same article! Its range

is limited to the Riding Mountains of Manitoba, Canada. The few specimens (6) from Manitoba I have seen

do not convince me that this should be considered a subspecies. Someone should examine this in detail. In

the mean time, the name ridingsii can be utilized as at least a form name in Canada if anyone wishes to do

so. Here is the original description

Poanes hobomok ridingsii new form

This form has the same relationship to hobomok that suffusa has to massasoit. The upper surface is slightly darker in

color than that of hobomok. The discal patch on the secondaries below is very heavily overcast by brownish scales. We have

a very extensive series of this form from the Riding Mountains where it appears to be constant. From Montreal, we have a

fair series collected by our generous friend Mr. Sheppard. At Montreal this form occurs with the typical form. The

classification “form” is based on this latter material; however, in the Riding Mountains, ridingsii occurs as a race. With

sufficient material from the regions between the two locations, interesting theories could be formulated.

Holotype - tf,June 23, 1938, Riding Mountains, Manitoba

Allotype - 9, June 7, 1934, Riding Mountains, Manitoba

Paratypes - Riding Mountains, Sand Ridge, Man., and Montreal, P.Q.

Poanes hobomok wetona

Poanes hobomok wetona was minimally described verbally and no illustration was provided. To

my knowledge, the photos provided herein are the first published depictions of the holotype (Figs. 1-2). I

have examined topotypical Massachusetts males of hobomok (Figs. 5/7) that are identical to typical males

of wetona. It is the females of wetona that distinguish it as being distinct from nominate hobomok. Although

some hobomok females also have considerable dorsal fulvous, the dark form pocahontas occurs frequently

within northeastern US hobomok while this form is unknown from subspecies wetona. The southern

Appalachian taxon described herein differs more from nominate hobomok and western wetona than those

two differ from each other. Here is the OD of wetona.

Poanes hobomok wetona Scott, new subspecies. Wetona is somewhat paler than P. hobomok hobomok (Harris). The

brown DFW and DHW borders are slightly narrower, the dorsal wing bases have less brown, and the brown dorsal spot beyond

the FW cell is smaller (less brown). Few females are as dark as ssp. hobomok, and many females are as light as males; the

black female form pocahontas common in eastern U.S. in ssp. hobomok is absent in wetona. I first discovered wetona in

1967. It has since been found common throughout the foothills of the Wet Mts. in southern Colorado, and also on Raton

Mesa in New Mexico. It possibly occurs between these areas, west of La Veta for instance. These are its only Rocky Mtn.

localities (although ssp. hobomok occurs in the Black Hills). It occurs in Quercus gambellii - Pinus ponderosa habitat.

Types: Sand Gulch S. Greenwood, 7200’, Custer Co. Colo. 30 May 1971 [leg.] Glenn Scott, holotype male, 4 m paratypes;

North Creek 4 mi. NW Beulah, Custer Co. Colo. 29 June 1970 G. Scott 2m If, 30 June 1971 J. Scott, 11; Beulah, Pueblo

Co. Colo. 12 June 1970 2m J. Scott; 2 mi. up Greenhorn trail, Pueblo Co. Colo. 22 June 1967 If J. Scott; Soda Gulch S.

Wetmore, Custer Co. Colo, 7400’ 29 June 1971 40 J. Scott; Smith Creek Campground, Custer Co. Colo. 25 May to 6 July,

1970-1793, 48, J. Scott & G. Scott; N. Hardscrabble Creek 2 mi. S. Greenwood, Custer Co. Colo. 24 June 1968, If G. Scott;

Slope between N. & middle Hardscrabble Creek, Custer Co. Colo. 30 June 1968 If G. Scott; N. Hardscrabble Crk. E. of

Harms Gulch, Custer Co. Colo. 30 June 1968 2m 3f G. Scott; middle Hardscrabble Crk. Custer Co. Colo. 1 July 1968 If G.

Scott; 2 mi. SW Oak Creek Cgd., Fremont Co. Colo. 7 July 1970 If J. Scott; 5 mil SE Beulah, Pueblo Co. Colo. 18 June

1970 5m G. Scott; South Hardscrabble Crk. 7400’, Custer Co. Colo. 30 June 1971 8 J. Scott; N. of Goodpasture, Pueblo Co.

Colo. 5 May 1972 lm J. A. Scott; Raton Mesa, Colfax Co. New Mex. 4 July 1973 Allotype female, 13 m 3f paratypes J.

Scott. 3m paratypes to New Mex. State Univ., others to many colls. [RG. The holotype was deposited in the LACM.]

Poanes hobomok monofacies: New Subspecies

Diagnosis. Males. Both P. h. hobomok and P. h. wetona are broadly fulvous on the dorsal forewings. Some males

of nominate hobomok have dark dusting at the base of the forewings, but never as extensive as in typical males of P. h.

monofacies. Males of P. h. monofacies differ from all other hobomok populations in that many individuals have extensive

dark brownish black scaling at the base of the forewings - this is especially noticeable in cell CU2 where the dark basal color

extends well into the cell in some individuals reducing the fulvous area to a small spot. This is form alfaratta (Figs. 17 &

21) which was previously considered to only occur in females. Monofacies is thus the only subspecies where some males

are darker than typical females. In monofacies the dark forewing margin is 3 to 5 mm wide, to 1/3 width of wing; in hobomok

1.5 to 3.5 mm wide, less than 1/4 width of wing. The fulvous area on the dorsal hindwing of monofacies is also reduced. This

is most noticeable in cell CUi. On the ventral surface of both wings the outer ground color tends to be a uniform dark brown

in monofacies\ the hind wing central yellow patch is noticeably narrower (smaller) than in either wetona or hobomok, often

occupying only about the middle one third of the wing surface. In typical hobomok from New England west through

subspecies wetona the ventral outer ground color varies from medium brown to light yellowish brown with bluish-gray

dusting; the central hind wing yellow patch often occupies over half the surface of the wing. The fringe on monofacies is

usually brown while in the other subspecies it is usually orange. Females. In subspecies monofacies, the dorsal forewings

are never extensively fulvous, while in subspecies wetona they almost always are, and frequently are in hobomok females.

The pocahontas form is rare in subspecies monofacies but common in New England nominate hobomok. The ventral

surface of monofacies females is similar to that of its males except that they are at times dusted with bluish-gray scales on

the dark brown outer margins of the wings and the central yellow patch is even more restricted and at t im es absent. The

dorsally yellow females of hobomok and wetona are usually well marked and more colorful ventrally (Figs. 4, 12 & 16).

Description. Male (Figs. 17/19, 21/23, 25/27): Head, thorax, abdomen and legs: In all anatomical features

darker but of the same colors as in nominate hobomok except for the palpi which are as in nominate hobomok - grayish

white at base blending to rusty tawny at terminal segment; palpi thus in more contrast with head and thorax in monofacies.

Forewings : dorsally, outer margin dark brown 3 to 5 mm wide; base of wing usually with extensive brown, up to 8 mm into

wing in cell CU2; fulvous area accordingly compressed so that many male monofacies are form alfaratta', ventrally, as above

but fulvous and dark areas more sharply defined, base of wing black. Hindwings : dorsally, dark brown with restricted orange

fulvous central patch, spot in cell CUi small and never extending to base of vein (this spot usually extends to base of vein in

hobomok), never a fulvous spot in cell CU2; ventrally, central area yellow patch occupying half or less of wing surface and

strongly contrasting with dark outer brown ground, ground seldom with any yellowish dusting, fringe usually dark and

concolorous with marginal area of wing with an inner thin black line. Female (Figs. 18/20, 22/24, 26/28): Head, thorax,

abdomen and legs: as in male but slightly lighter. Forewings : dorsally, as in male but tending to less fulvous with most

females being form alfaratta, individuals with only small spots (pocahontas) are uncommon; ventrally, as in male but outer

marginal lighter and often with blue-gray dusting in apical area. Hindwings : dorsally, as in male, individuals with no fulvous

uncommon; ventrally, as in male but central yellow patch more restricted and usually with blue-gray dusting on margins.

Types. Holotype c? (Figs. 17/19): NORTH CAROLINA: Macon County, near summit of Chestnut Mountain,

3,500’, FS Rd. 4563, 22 May 2000, R. Gatrelle collector. Allotype 9 (Figs. 18/20): NORTH CAROLINA: Macon County,

near summit of Chestnut Mountain, 3,500’, FS Rd. 4563, 22 May 2000, R. Gatrelle collector. Paratypes : 31c?c?,1299:

NORTH CAROLINA: Clay County: Buck Creek, lc?, 18 May 2001, lc?, 7 May 2002, 3c? c?, 24 May 2002, lc?, 25 May

2002, Chunky Gal Mtn. at Hwy. 64, 1 d\ 24 May 2002; Jackson County: Brushy Mtn., 1 c?, 29 May 2000, Whiteside Cove

Rd., 3100’, 1 9, 30 May 2000 (form pocahontas)', Macon County: vise. Jones Knob, 1 d, 27 June 1992,4 c? c?, 5 9 9,4 June

1993, 19, 10 June 1994, 4c? c?, 19,30 June 1994, 1 c?, 22 May 2000,4500’, 4 c? c?, 29 9,16 May 2002, Chestnut Mtn., 1 c?,

22 May 2000, Scaly Mtn. trail, off Turtle Pond Rd., 4100’, 1 c?, 1 9 ,10 June 1993. GEORGIA: Walker County: Pigeon Mtn.

Rec. Area, 1000’, 19 km WSW of LaFayette, 4c?, 19,2 May 1992, 3c? c?, 16 May 1998. The holotype and allotype are

deposited in the LACM, Los Angeles, California; NC paratypes in the TILS collection Goose Creek, South Carolina; Georgia

paratypes in collection of James Adams, Dalton, GA. All NC paratypes leg. R. Gatrelle; all GA paratypes leg. James Adams.

Etymology. The name means one face because the sexes look very much alike.

Additional material examined. In this study I examined specimens from the following locations. All specimens

are nominate hobomok unless otherwise noted. Number of specimens by sex in [c?/ 9 ]. CANADA: MANITOBA: Duck Mtns

[1/2] (ridingsii). Riding Mtns. [ /l], Turtle Mtns. [1/1]; ONTARIO: Kitchner [ /2], Shequiadah [2/ ]; NEW BRUNSWICK:

Edmundston [ /l]; NOVA SCOTIA: Armdale [8/2]. UNITED STATES: MASSACHUSETTS: Mt Holly [4/3], Melrose [3/2],

Gardner [ /l]; CONNECTICUT: Middletown [1/ ], Kent [ /l]; NEW HAMPSHIRE: Coos Co. [4/ ]; VERMONT: Orange Co.

[7/3]; MAINE: Lewiston [ /1], Brunswick [ /1]; NEW YORK: Staten Island [1/ ], Lk. Tiorrti [ /2], Catskills [4/1], Hartsdale [21

]; NEW JERSEY: Nutley [ /l]; PENNSYLVANIA: Bucks Co. [1/2], Green Lane Co. [1/1], Bedford [4/7], Flowertown [10/16],

Montgomery Co. [8/8], Centre Co. [ /l], Lehigh Co. [3/3]; MARYLAND: Allegany Co. [3/2]; WEST VIRGINIA: Pocahontas

Co. [ /l]; ILLINOIS: Lake Co. [8/1], Me Hennery [3/ ]; OHIO: Geauga [1/1]; MICHIGAN: Lansing [ /l], Cass Co. [1/ ];

6

WISCONSIN: Marathon Co. [1/ ], Polk Co. [1/ ]; MINNESOTA: Lake Co. [1/ ]; IOWA: Lyon Co. [1/ ], Hardin Co. [12/8];

NEBRASKA: Cass Co. [2/1], Sioux Co. [1/1], Saunders Co. [ /l], Richardson Co. [4/4]; MISSOURI: Wayne Co. [3/2], Boone

Co. [ /l], Holt Co. [ /4], Grundy Co. [6/4], Columbia [ /l]; OKLAHOMA: Craig Co. [3/ ]; ARKANSAS: Carroll Co. [4/3] (nr.

>n Co. [ /l], Saline Co., Quachita Mtns. [1/ ] (nr. monofacies ); GEORGIA: (all monofacies) Bibb Co. [

/l], Cobb Co. toona Dam [1/ ], Pickens Co. [1 atypically light/1], Rabun Co. [2/ ]; TENNESSEE: {monofacies) Great

off museum labels was sometimes difficult to read or very ir

;e left FW: 17.5 (in MA hobomok : 14.5). I

al hind wing in cell CUi. 20% - 40% of males are fo

ACKNOWLEDGMENTS

I thank the Los Angles County Museum (Julian Donahue and Brian Brown) for providing photos of

the wetona holotype; Canadian National Collection (Don Lafontaine) for the original description of

ridingsii; Steve Spomer, James Adams and Alex Grkovich for loan of important specimens; David Wright

and George Austin for the original description of hobomok; Wright for detailed information on the Harris

collection and notebook. Wright and Jonathan Pelham for literary historical information; Philip Per kin s

(MCZ) for information on MCZ types; Spomer and Austin for review of this document.

LITERATURE CITED

ALLEN, T.J. 1997. The Butterflies of West Virginia and Their Caterpillars. Pittsburgh, PA: University of

Pittsburgh Press xii + 388 pp.

BROWN, F.M. 1975. The third Edition of Thaddeus William Harris’s “Treatise on Some of The Insects

Injurious to Vegetation.” 1862. Entomological News. Vol. 86, Nos. 3&4 1975. Pp 65-68.

CHERMOCK, F.H. & R.L. CHERMOCK 1940. Some New Diurnal Lepidoptera From the Riding

Mountains and the San Ridge, Manitoba. Canadian Entomologist, 72: 83.

CLARK, A.H., and L.F. CLARK. 1951. The Butterflies of Virginia. Smithsonian Misc. Coll. 116 (7): vii +

239 pp.

GATRELLE, R.R. 1999. An Evolutionary Subspecific Assessment of Deciduphagus henrici (Lycaenidae)

Based On Its Utilization of Ilex and Non -Ilex Hosts: Description of a Third Ilex Associated Subspecies.

Designation of a Neotype and Type Locality for Deciduphagus irus. TTR, Vol. 1:6, 14 pp. The Int.

Lepid. Survey, Goose Creek, SC.

_. 1999. Hubner’s Helicta : The Forgotten Neonympha. The Recognition and Elevation of

Neonympha helicta (Nymphalidae: Satyrinae) to Specific Status. The Designation of Neotypes for N.

helicta and N. areolatus. The Subspecific Transfer of septentrionalis to helicta and the Description

of a Third helicta Subspecies From South Florida. The Taxonomic Report. Vol. 1:8, 8 pp. The Int.

Lepid. Survey, Goose Creek, SC.

_. 2000. Description of a New Subspecies of Poanes aaroni (Hesperioidea: Hesperiinae)

the West Central Gulf Coast of the Southern United States. The Taxonomic Report. Vol. 2:2, 10 pp. The

Int. Lepid. Survey, Goose Creek, SC.

HARRIS, T.W. 1862. A Treatise on Some of the Insects Injurious to Vegetation, third edition.

Commissioners on the Zoological and Botanical Survey of Massachusetts: 313

ICZN (International Commission on Zoological Nomenclature). 1999. International Code of Zoological

Nomenclature. 4 th ed. London, 1999: The International Trust for Zoology Nomenclature, 306 pp.

REMINGTON, C.L. 1968. Suture-zones of Hybrid Interaction Between Recently Joined Biotas. Evol.

Biology, Vol. 2 (8), 325- 413.

SCOTT, J.A. 1981. New Papilionoidea and Hesperioidea From North America. Papilio (New Series) No.

1: Nov. 25, 1981. 12 pp.

_. 1986. The Butterflies of North America, A Natural History and Field Guide. Stanford Univ.

Press, Stanford, CA. 583 pp.

Volume 3

15 December 2002

Number 9

The Taxonomic Report <t

OF THE INTERNA TIONAL LEPIDOPTERA SURVEY ^WWr

TAXONOMY AND DISTRIBUTION OF BUTTERFLIES (PAPILIONOIDEA)

OF THE SKARDU REGION, PAKISTAN

Muhammad Abbas \ Dr. Muhammad Ather Rafi 1 2 , Dr. Mian Inayatullah 3

Dr. Muhammad Rafique Khan 4 , Harry Pavulaan 5

ABSTRACT. A study was conducted in six different localities around Skardu to document the butterfly fauna of that

region. The study revealed that 16 species in 5 families and 14 genera occur in the area. The fa mili es include: Papilionidae

(represented only by the genus Parnassius)\ Pieridae (genera Pieris, Pontia and Colias are represented); Lycaenidae (genera

Lycaena, Everes, Aricia, Plebejus, Zizeeria and Zizina are represented); Nymphalidae (only two genera, Aglais and Cynthia

are represented); and Satyridae (represented by the genera Pararge and Maniola).

INTRODUCTION

Butterflies have been studied systematically since the early 18th century and 19,238 species had

been documented worldwide by 1998 (Heppner, 1998). This figure is not constant because of the

continuous discovery of new butterflies (Goodden, 1977; Stokoe, 1974; Green and Huang, 1998), and also

due to ongoing disagreements between taxonomists over the status of many species.

The distribution of butterflies involves both expanding and contracting ranges. Natural changes in

the distribution of species can be difficult to deduce because they tend to be slower and subtler than the

dramatic changes caused by man. Unfortunately, most expanding ranges involve introduced species and

most contracting ranges are due to the destruction of natural habitats (Lafontaine, 1997). Expansion in a

species’ range may often be in response to human activities favoring these species, making these butterflies

opportunists. In order to document such temporal changes over time, a baseline faunal inventory must first

be established.

It is essential that we document the butterfly fauna of certain regions so that steps may be taken to

ensure the survival of these fascinating creatures for future generations. There is little that can be done to

save our butterflies once their habitats are destroyed. Thus, it is important to manage our environment and

avoid further damaging the already fragile balance of nature (Whalley, 1992).

In spite of their aesthetic appeal, we have comparatively little information on the butterfly fauna of

many regions of Pakistan, especially Skardu. No documented collections had been made or faunal surveys

conducted in this rather remote region prior to this study. The region known as the Northern Areas of

Pakistan is spread over a vast area of 74,200 sq. km. It lies beside the lofty peaks and great mountainous

ranges of the Karakorams, Hindu Kush, Himalayas and Pamir, which are largely uninhabited. Within this

1 Kara Koram Agriculture Research Station, Pakistan Agriculture Research Council, Skardu, Pakistan

2 Pest Management Research Programme (PMRP), Institute of Plant and Environment Protection (PMRP), Islamabad-45500, Pakistan.

3 Department of Entomology, North West Frontier Province (N.W.F.P.) Agricultural University, Peshawar, Pakistan.

4 Department of Entomology, University College of Agricultural, Rawalakot, Azad Kashmir, Pakistan.

5 Research staff member, The International ]

i Lepidoptera Survey, Herndon, Virginia, U.S.A.

area, the Skardu Region covers an area of 28,850 sq. km. with a population of 272,000 (census, 1986).

Elevations in the study area range from approximately 2,270 m. along the river Indus to over 4,000 m. on

the Deosai Plains, with Skardu city itself at 2,438 m. Skardu is well known for its peculiar geographical

and climatic conditions. The climate is temperate and very arid. In summer the temperature reaches to a

maximum of 35.2°C while the minimum temperature in winter is around -25°C.

Most settlements in the region occur along rivers and are built on alluvial deposits. With irrigation,

crop agriculture is possible. The people of Skardu are largely subsistence agriculturists, but crops are

produced for market as well. Skardu is famous not only for its beautiful scenery, but due to the temperate

climate it also holds its place as a commercial fruit production region for Pakistan and abroad, producing

cherries, almonds, apricots, apples, pears, peaches, grapes, plums, mulberries, among others. Important

regional crops are wheat, maize, barley, alfalfa, barseem, potatoes, tomatoes, turnips, cabbages and carrots

(agricultural statistics, 1993-94). Thus, the settled areas contain largely disturbed habitat. The surrounding

region, most of it arid, is thinly populated by shepherd farmers.

The present study was conducted to document for the first time the butterfly species in Skardu. The

objectives of this study were foremost to study the distribution and diversity of butterflies in various

habitats found in the region.

REVIEW OF LITERATURE

Distribution Studies

Despite their great importance to researchers, aesthetic value to lepidopterists and despite numerous

studies of butterflies on he Indian subcontinent, there is very little information on the butterfly fauna of

Pakistan and especially about the Skardu region. Thus, literature references are relatively scarce.

Doherty (1886) explored the butterfly fauna of Kashmir for the first time. Swinhoe (1887) reported

4 families of butterflies from Karachi and neighboring areas, including Papilionidae (4 species),

Lycaenidae (18 species), Nymphalidae (17 species), and Hesperioidea (7 species).

Marshal and de Niceville (1883-1890) worked on the butterfly fauna of the Indian sub-continent.

Leslie and Evans (1903) reported the butterflies of Chitral. Bingham (1905) and Lefroy (1909) reported on

butterflies from the Indian region. Rhe-philipe (1917) reported 5 families from Lahore, including

Papilionidae (3 species), Pieridae (17 species), Lycaenidae (11 species), Nymphalidae (16 species) and

Hesperioidea (7 species). In another study, Evans (1923) explored the butterfly fauna of the Indian region.

Puri (1931) explored the butterfly distribution of Lahore. He reported 57 species belonging to 34

genera and 5 families. Similarly Evans (1933) studied the butterfly fauna of Baluchistan. Talbot (1939)

and Wynter-Blyth (1940-1957) described the butterfly fauna of the Indian subcontinent. Menesse (1950)

worked on the butterflies of Sind.

Malik (1970) reported 8 species of butterflies from Rawalpindi and Murree. In another study Malik

(1973) reported 9 families of butterflies from West Pakistan, including Papilionidae (9 species), Pieridae

(21 species), Lycaenidae (21 species), Nymphalidae (19 species), Satyridae (1 species), Danaidae (9

species), Acaeridae (1 species), Erycinidae (2 species) and Hesperioidea ( 9 species). Ahsan and Iqbal

(1975) reported 66 species of butterflies from Lahore, belonging to 44 genera and 7 families, among which

12 species were reported for the first time from Lahore. Iqbal (1978) recorded 51 species in 35 genera and

8 families from Rawalpindi and Islamabad, including: Papilionidae (3 species), Pieridae (12 species),

Lycaenidae (7 species), Nymphalidae (11 species), Satyridae (6 species), Danaidae (3 species),

Erycinidae (3 species) and Hesperioidea (5 species).

Hasan (1994) explored the fauna of Islamabad and Murree, reporting Papilionidae (4 species),

Pieridae (13 species), Lycaenidae (11 species), Libytheidae (1 species), Nymphalidae (17 species) and

Danaidae (3 species). More recently, Hasan (1997) reported 80 butterfly species in 9 families from

Northwest Himalaya (Galgit and Azad Kashmir), including Papilionidae (6 species), Pieridae (15 species),

Lycaenidae (17 species), Libytheidae (1 species), Nymphalidae (24 species), Satyridae (8 species),

Danaidae (3 species), Erycinidae (1 species) and Hesperioidea (5 species). In another attempt, Smith and

Hasan (1997) reported 50 species from Northern Pakistan (Gilgit to Khunjerab). Khan, et al. (2000)

studied the distribution and diversity of genus Papilio in Rawalpandi and Islambad. Most recently, Rafi, et.

al. (2000) published a guide to the Papilionidae of Pakistan.

Taxonomy

The field of lepidopteran taxonomy is dynamic and the status of a great many named taxa or their

higher level placement have been changed, many of them several times since their original descriptions.

Little actual taxonomic work pertaining to he Lepidoptera of Pakistan has been done. Puri (1931) did

systematic studies of the butterflies of Lahore. Ahsan and Iqbal (1975) prepared a revised list along with

keys and brief description of the species recorded in Lahore. Similarly, Iqbal (1978) conducted a

systematic account of the butterflies of Rawalpindi and Islamabad.

3

MATERIALS AND METHODS

During April 1999, six sites were selected for extensive sampling to determine the distribution,

diversity and taxonomy of butterflies in Skardu (map pg. 14). The five localities were Skardu city, Shigar

village, Kharmang village, Sadpara village, Kachura village and the Deosai Plains. These localities were

selected on the basis of their position in topographic elevation, vegetation and accessibility.

In the center of the study area is Skardu city (photo page 2). The city lies on the banks of the river

Indus amidst the towering mountains of the Karakoram range. Skardu city lies at the site of an oasis situated

on an arid geological tableland 8 km. wide by 32 km. long. The landscape is made uneven by ancient sand

dunes. Willows, poplars and the oriental plane tree grow here naturally among the cultivated apricots,

peaches, mulberries, apples, pears, plums and cherries (Stewart, 1982). Grapes, vegetables and a variety of

field crops are also widely cultivated.

Shigar village is about 32 km. to the north of Skardu along the banks of the river Shigar. It is situated

within the lush green Shigar valley, an oasis which is surrounded by towering snow clad peaks. The valley

is known for its crops of grapes, pears, apples, walnuts, peaches and apricots.

Kharmang village lies far to the southeast along the river Indus. It is situated near Kachura Lake,

known for multitudes of wildflowers which line its shores in spring. Peaches, apricots, pears and apples

are grown here.

The Deosai Plains (Fig. 1) south of Skardu are located on one of the world’s highest plateaus,

roughly 56 km. long by 40 km. wide, averaging 4,116 m. and are encircled by the Himalayan Mountains

which teach heights of over 5,500 m. The cold alpine climate causes the plains to be snowbound under

deep snows from November to May (Stewart, 1982). During the summer months, though arid due to a lack

of rain, it becomes a morass of swamps from the melted snow mich as the arctic tundra. Although above

tree line, it is characterized by rich alpine snowmelt flora as evidenced by the abundance of flowering

plants that make the plains glow with bright colors through the summer months. This region is uninhabited

and much of it is now within Deosai National Park. The primary area of study here was at Burzil Top.

Kachura village (Fig. 2) is about 32 km. to the northwest of Skardu near the river Indus. Like the

other areas, oasis conditions and irrigation support vegetation and cultivated crops. Without irrigation, such

areas would quickly revert to arid steppe-like conditions.

Sadpara village (Fig. 3) lies directly south of Skardu on the way to the Deosai Plains. Here too,

native vegetation is primarily found in oasis conditions and cultivation is totally dependent on irrigation.

Butterfly specimens were collected by means of netting within one square kilometer at each sample

site. Each site was sampled for 30-60 minutes per visit at intervals of 10-15 days throughout the study

period, from April 1999 until the end of September 2000. Four hundred specimens were vouchered, which

were mounted for positive identification. Each specimen was labeled with (a) place of capture, (b) date of

collection, (c) scientific name, (d) family name, and (e) collector’s name. The specimens were identified

with the help of available literature and already identified specimens from different collections of the

country, such as the Institute of Plant and Environment Protection (IPEP), Islamabad, and Pakistan Forest

Institute, Peshawar. All the identified specimens from this study have been deposited in the entomological

collection of the Entomology Department, NWFP Agricultural University, Peshawar and Institute of Plant

and Environment Protection (PMRP), Islamabad.

RESULTS

The present work is based on the collection of butterflies conducted in the study area during the

years 1999 - 2000. Specimens were collected from various localities around Skardu. More than four

hundred specimens were collected which were identified to species level. The survey revealed 16 species

in 14 genera and 5 families, which occurred in the study areas. No species of the superfamily Hesperioidea

(Latreille) were recorded.

Species Recorded

Superfamily Papilio noidea Latreille, 1809

Family Papilionidae Latreille, 1809

The Papilionidae consist of two major subfamilies: the Papilioninae Latrielle and the Parnassiinae

Duponchel. The Swallowtails ( Papilioninae ) are large, usually dark coloured butterflies that have the radius in the

front wing five-branched. Most genera contain tailed species. These groups are not represented in the Skardu region.

The Parnassians ( Parnassiinae ) are medium-sized, having very rounded wings usually white or gray with dark

markings, the radius in the front wing is four-branched, and there are no tail-like prolongations on the hindwing.

Females are unique among the butterflies in that they carry a distinct hardened pouch or “phragis” beneath their

abdomen, which is produced by the male immediately after mating, to prevent other males from mating with the

female. Only one species in genus Parnassius of this family has been recorded in the study area.

Subfamily Parnassiinae Duponchel, 1835

Tribe Parnassiini Duponchel, 1835

Genus Parnassius Latreille, 1804

The Apollo Butterflies are medium-sized, usually white or gray with dark markings, and with rounded, often

translucent wings. Many species are adorned with red eyespot markings on the wings. They are also typically found

in arctic/alpine habitats. Interestingly, only one species of this genus was recorded in the study area. It is frequently

found with other members of the genus.

Parnassius charltonius Gray, 1853 - Regal Apollo (Figs. 8 & 9)

Wingspan: 80-90 mm.

Female: Forewing with vein R 2 from R 5 ; veins Mi and R5 well-separated at the origin; discal band usually broadened below

the cells; the bases of areas Cuib and Cui a being usually entirely black; no red spot. Hindwing without a spot at base of area

R3; a small red or black spot at the middle of area R3; a very large red ocellus extending from vein M 3 to vein Mi, usually

white-centered; a red or black basal bar above the anal angle in area 1 and Cuib; a complete row of very distinct bluish-white

centered black submarginal spots on a dark ground; a narrow black marginal line, more or less interrupted at the veins. Female

phragis is heliciform (snail-shaped), being rolled upon itself, and furnished with a wide and longitudinal shallow groove.

Females are larger and wings are more diaphanous (transparent) than the male.

Male: Smaller, and wings generally less diaphanous (transparent) than the female.

Flight period: July-August.

Distribution & Habitat: This butterfly is broadly distributed over the mountain ranges of central Asia, but within the study

area was found only in restricted locations at Burzil Top in the Deosai Plains region, at elevations above 4,250 m. Previously

reported from nearby Chitral by Mani (1986). Leslie and Evans (1903) recorded it from Shandur and the Burzil pass. The

habitat includes mountain passes and steep rocky or clay slopes near glaciers. Males have been observed patrolling along

cliff faces. Females are known to descend to a lower elevation than the males.

Taxonomy: About 20 subspecies are described, however specimens from the study area have not been identified to

subspecies.

Comments: The larvae are known to feed on species of Corydalis in other portions of the species’ range.

Family Pieridae Duponchel, 1832

This family includes small to moderately sized butterflies of mainly white, yellow or orange ground color

bearing a variety of black margins, spots or other markings. They are characterized by pronounced sexual

dimorphism and seasonal variation. Antennae gradually stouter towards the tip; there are six normally developed legs,

fore tibia without cleaning spur, claws bifid; wings generally rounded, cell closed in both wings, one anal vein; hind

wing with pre-costal vein or with a very short one turned towards wing base apically, two anal veins. They are also

generally known to be species of open areas. Six species in three genera of this family were recorded in the study

Subfamily Pierinae Duponchel, 1832

Tribe Pierini Duponchel, 1832

L807

ait snow line on high alpine mountains, above 4,250 m.

id cold steppe habitats from other parts of its range.

Subfamily Coliadinae Swainson, 1827

Tribe Coliadini Swainson, 1827

Family Lycaenidae Leach, 1815

Subfamily Lycaeninae Leach, 1815

Tribe Zizeerini Chapman, 1910

Genus Zizeeria Chapman, 1910

1 in all

rtTn

. Later on it was al

351

Tribe Everini Tutt, 1907

Genus Everes Hubner, 1819

Tribe Polyommatini Swainson, 1827

Genus Ariciu Reichenbach, 1817

Wingspan: 25-30 mm.

Subfamily Nymphalinae Swainson, 1827

Tribe Nymphalini Swainson, 1827

Genus Aglais Dalman, 1816

10

rs only in some hilly areas and is not w

?ral white makings including apical spots and a subapical bar. § Hindwfng similarly orange

ia pale brown, covered with fine hairs; band of five black submarginal ocelli. Underside

>e (1917) and Puri (1931) again reported it from Chitral. Menesse (1950:

d Islamabad. Ahsan and Iqbal (1975) reported it from Lahore. Again repoi

ibad and other areas, and recently from Gilgit by Hasan (1997). It can be

ty of host plants, in 21 genera of plants (Field, 1971),

r« (C. & R. Felder, 1867) - Dusky M

Flight period: July-August.

Distribution and Habitat: In the study area, only recorded in the Deosai Plains. Found in hilly northern areas of Pakistan and also in the

northwest Himalaya (Mani, 1986). Generally not known from plains habitats but is known to occur at high altitudes, such as those at the Deosai

Plains, which average 4,116 m. in elevation.

Taxonomy: No subspecies have been identified for this study.

Comments: Prior to this study, Maniola pulchra was not known from Pakistan. It was first discovered by the authors from the study area.

Subfamily Pararginae Tutt, 1896

Genus Pararge Hiibner, 1819

This is a Palearctic group of several very similar species, all dark brown in appearance, with one subapical

occelus on the dorsal forewing and two or more occeli on the dorsal hindwing. There are varying amounts of orange

coloration overlaying the brown ground color in each species. One species of this genus was recorded in the study

Pararge menava Evans, 1932 - Dark Wall Butterfly

Wingspan: 50-60 mm.

Female: Wings above dark brown; subapical ocellus in forewing black, white-centered and ringed yellow, hindwing with two

ocelli above.

Male: Like the female.

Flight period: June-July in the study area.

Distribution and Habitat: In the study area, only recorded in the Deosai Plains. Found in hilly northern areas of Pakistan

and also in the northwest Himalaya (Mani, 1986). Generally not known from plains habitats but is known to occur at high

altitudes, such as those at the Deosai Plains, which average 4,116 m. in elevation.

Taxonomy: The nominotypical subspecies has been identified for this region. This species is very similar in appearance to

P. schakra (Kollar, 1844) and P. maerula (C. & R. Felder, 1867), neither of which were recorded during this study, but may

be confused with these species. These can be distinguished from P. menava in that they contain three ocelli on the dorsal

hindwing, whil e menava contains only two.

Comments: Prior to this study, Pararge menava was not known from Pakistan. It was first discovered by the authors from

the study area.

SUMMARY

No butterfly survey work had previously been conducted in Skardu and surrounding region of the

Northern Areas of Pakistan. Due to the lack of published information on butterflies in this region, the main

aim of this research was to investigate the taxonomy and distribution of butterflies in the study area. New

distribution records were established for all of the species listed in this study. Prior to this study, the

species Pontia callidice, Everes argiades, Plebejus argus, Maniola pulchra and Pararge menava had not

been previously reported from Pakistan and are established as new national records by the authors of this

study. Zizina otis was found frequent in the study areas, but is known from only one other location in

Pakistan.

Overall species diversity in the study area was found to be very low. This is due to the natural

climate, which is generally cold-temperate and arid, and the distinctively central Asian “steppe-like”

habitat of the region, which is rather unsupportive of great butterfly diversity. Thus, the lack of butterfly

diversity is not entirely due to the climate, but is more directly a result of lower diversity of flora upon

which to support greater butterfly diversity. However, some of the recorded species were very numerous in

certain areas, especially around areas of cultivation and irrigation. The following species were found in all

six of the study locations: P. rapae, P. brassicae , C. erate , C. fieldii , Z. knysna, P. argus and C. cardui.

These species apparently function as opportunists, benefiting from the activities of humans, though they may

have been present prior to human settlement. Certain other species were found in two or three of the study

locations, and therefore may have more specific habitat requirements: L. phlaeas, Z. otis, E. argiades, A.

agestis and A. cashmirensis . Four species: P. charltonius, P. callidice, M. pulchra and P. menava were

12

5: the Deosai Plains. These are all high-altitude species and

each found in only one of the study

very habitat specific.

The species recorded in this study have their origins in two primary zoogeographical zones: the

Palearctic region to the north and west and the Oriental (variously called Indo-Australian) region to the

south and east. Those of the Palearctic region are well-adapted to cold temperate climates in all

developmental stages and are primarily overwintering residents. These are: P. charltonius , P. rapae , P.

brassicae , P. callidice , C. erate , C. fieldii , L. phlaeas , E. argiades , A. agestis , P. argus , A. cashmirensis ,

M. pulchra and P. menava. These thirteen species comprise 81% of our sample of 16 species. Three of

the species in our sample have origins in the Oriental zoogeographic region and comprise 19% of our

sample. These include: Z. knysna , Z. otis and C. cardui. The first two species are resident, with only one,

Z. knysna being known as a permanent breeding resident. The status of Z. otis is not entirely clear, as it is

generally known from lower elevations in northern Pakistan and thus may be a seasonal (not overwintering)

breeding resident. C. cardui falls into a special class of its own, in that it manages to overwinter in the

adult stage in the warmer region to the south, and immigrates seasonally into the higher, colder reaches of

the north. Thus, butterflies in the study area have a predominantly central Asian character, well-adapted to

a dry steppe climate and extreme cold temperatures in winter.

LITERATURE CITED

AHSAN, M. and J. IQBAL. 1975. A contribution to butterflies of Lahore with the addition of new records. Biologia

21(2):143-158.

BINGHAM, C.T. 1905. The fauna of British India including Ceylon and Burma. Butterflies, Vols. 1-2. Taylor and

Francis Ltd., London. XV. 528 pp.

DOHERTY, W. 1886. List of Butterflies taken in Kashmir. J. Asiatic Soc. Bengal 55(2-3): 103-140.

EVANS, W.H. 1923. The identification of Indian butterflies (Papilionidae, Pieridae). J. Bombay Nat. Hist. Soc.

29:230-260.

_, 1933. The Butterflies of Balochistan. J. Bombay Nat. Hist. Soc. 36(1): 196-209.

FIELD, W.D. 1971. Butterflies of the Genus Vanessa and of the Resurrected Genera Bassaris and Cynthia

(Lepidoptera: Nymphalidae). Smithsonian Contributions to Zoology. 84:1-105.

GOODDEN, R. 1977. The Wonderful World of Butterflies and Moths. Hamlyn Pub. Group Ltd., London. 96 pp.

GORBUNOV, P.Y. 2001. The butterflies of Russia: classification, genitalia, keys for identification. Ekaterinburg. 320

pp.

GOVERNMENT of PAKISTAN. 1995. Agricultural Statistics of Pakistan. 1993-94. Ministry of Food, Agriculture

and Livestock. Islamabad, Pakistan. 308 pp.

_. 1988. Pakistan Demographic Survey 1986. Federal Bureau of Statistics. Karachi,

Pakistan, xlii + 137 pp.

GREEN, J. and A. HUANG. 1998. Butterflies of South Vancouver Island. Co-op Report. Royal British Columbia

Museum. Available online at: http://rbcml.rcbm.gov.bc.ca/nh_papers/anneh/text/coverpage.html

HASAN, S. A.. 1994. Butterflies of Islamabad and the Murree Hills. Asian Study Group, Islamabad. 68 pp.

_. 1997. Biogeography and diversity of butterflies of North West Himalaya. In Biodiversity of Pakistan, Editors:

S.A. Mufti, C.A. Woods and S.A. Hasan. Pakistan Museum of Natural History, Islamabad and Florida

Museum of Natural History, Gainesville. 181-204.

HEPPNER, J. 1998. Classification of Lepidoptera. Part 1 Introduction. Holarctic. Lep. Vol. 5, Supplement 1:148 pp.

IQBAL, J. 1978. A preliminary report on Butterflies of district Rawalpindi and Islamabad. Biologia 24(2):237-247.

KHAN, M.R., RAFI, M.A., ILYAS, M. and SAFDAR, M. 2000. Distribution and diversity of genus Papilio.

(Lepidoptera: Papilionidae) in Rawalpindi and Islamabad. Pak. J. Sci. Res. Vol. 52(1-2): 1-3.

LAFONTAINE, J.D. 1997. Butterflies and Moths. In Smith, I.M. (ed.). Assessment of species diversity in the

Mixedwood Plains ecozone. Printed summary [1997]. EMAN Publication. 31 pp. + CDROM.

LEFROY, H.M. 1909. The Indian Insect Life. Calcutta, 786 pp.

LESLIE, G.A. and W.H. EVANA. 1903. The Butterflies of Chitral. J. Bombay Nat. Hist. Soc. 14(4):666-678.

MALIK, J.M. 1970. Notes on the Butterflies of Pakistan in the collection of Zoological Survey Department Karachi,

Part I. Rec. Zool. Surv. Pakistan 2(2):25-54.

13

__ v 1973. Notes on the Butterflies of Pakistan in the collection of Zoological Survey Department Karachi.

Part II. Rec. Zool. Surv. Pakistan 5(l-2):ll-28.

MANI, M.S. 1986. Butterflies of the Himalaya. Oxford and IBH Publishing Co., New Delhi, India. 181 pp.

MARSHAL, G.F.L. and L. de NICEVILLE. 1883-1890. The Butterflies of India, Burma and Ceylon. Vols.1-3,

Central Press Co., Calcutta, pp.327, 332, 503.

MENESSE, N.H. 1950. Butterflies of Sind. J. Bombay Nat. Hist. Soc. 49(l):20-24.

PURI, D.R. 1931. Butterflies of Lahore. Govt. College Lahore. 61 pp. Rhe-philipe, G.V.de. 1917. The Butterflies of

Lahore. J. Bombay Nat. His. Soc. 25(1): 136-142.

RAFI, M.A., M.R. KHAN and M. IRSHAD. 2000. Papilionid (Swallowtails) Butterflies of Pakistan. Islamabad. 33

pp.

SMITH, D.S., and HASAN, S.A. 1997. A preliminary survey of diversity and distribution of butterflies of Northern

Pakistan. Gilgit to Khunjerab. In Biodiversity of Pakistan. Editors: S.A. Mufti., C.A. Woods and S.A. Hasan.

Pakistan Museum of Natural History, Islamabad and Florida Museum of Natural History, Gainesville. 205-211.

STEWART, R.R. 1982. History and Exploration of Plants in Pakistan and Adjoining Areas. In Nasir, E. and S.I. Ali

(ed.). Flora of Pakistan. Published by authors.

STOKOE, W.J. 1974. The Observer's book of Butterflies. W.J. Frederick Warne and Co., London. 191 pp.

SWINHOE, C. 1887. On the Lepidoptera of Karachi and its Neighborhood. J. Bombay Nat. Hist. Soc. 2(l):269-280.

TALBOT, G. 1939. Fauna of British India including Ceylon and Burma. Butterflies #1 and #2. Taylor and Francis

Ltd. London. 835 pp.

WHALLEY, P. (1992). Eyewitness Guide of butterflies and Moths. Dorling Kindersley. London. 63 pp.

WYNTER-BLYTH, M.A. (1940-1957). Butterflies of Indian region, 1st Edition. Bombay Nat. Hist. Soc. Bombay.

275 pp.

14

Figs. 1-9. Fig. 1. Deosai Plains in summer. Fig. 2. Kachura Lake, Skardu Valley. Fig. 3. Lake Sadpara, Skardu Valley. Fig. 4.

Lycaena phlaeas (Linnaeus, 1761) - Small Copper, Skardu. Fig. 5. Colias erate Esper, 1805 - Eastern Pale Clouded Yellow,

Skardu. Fig. 6. Colias fieldii Menetries, 1855 - Dark Clouded Yellow, Skardu. Fig. 7. Aglais cashmiriensis (Kollar, 1844) -

Kashmiri Tortoiseshell, Skardu. Fig. 8. Parnassius charltonius Gray, 1853 - d* Regal Apollo, Burzil Top, Deosai Plains. Fig. 9.

Parnassius charltonius 9 (same data as Fig. 8).

15