Volume 8 Number 3

The Taxonomic Report

OF THE INTERNATIONAL LEPIDOPTERA SURVEY

ISSN 2643-4776 (print) / ISSN 2643-4806 (online-)

Designation of a Neotype for Oeneis melissa (Fabricius, 1775)

and a Lectotype for Oeneis polixenes (Fabricius, 1775)

(Lepidoptera: Nymphalidae: Satyrinae)

CRISPIN s. GUPPY

5 Boss Road, Whitehorse, YT Y1A 5S9 Canada, csguppy@gmail.com

ABSTRACT. The Oeneis melissa (Fabricius, 1775) “neotype” designations of Lukhtanov and Eitschberger (2000;

2001) do not meet several critical requirements of the ICZN and are therefore invalid. In addition, the locality data is too vague

to be taxonomically useful, their “neotype” specimen is a specimen of the taxon generally known as O. melissa semplei, and

acceptance of their specimen as neotype would change the meaning of the taxon Oeneis melissa. Hence, I reject their neotype

designation. A neotype Oeneis melissa (Fabricius, 1775) is designated from Nain, Labrador with careful consideration of the

Articles of the International Code of Zoological Nomenclature. The ‘barcode’ mtDNA (COl gene) structure for the neotype is

provided.

The original number of type specimens of Oeneis polixenes (Fabricius, 1775) is unknown and a holotype was not

designated explicitly or through implication; therefore, the type specimens are syntypes. There is one specimen that has been

identified as a syntype of O. polixenes in the Natural History Museum in London (formerly the British Museum of Natural

History), and no other extant specimens are known. I have expressly and deliberately designated the specimen in the collection

of the Natural History Museum in London, as the lectotype of Oeneis polixenes (Fabricius, 1775) (ICZN Article 74.7.3) to fix a

specific phenotype for the name.

Additional key words: Taxonomy, nomenclature.

INTRODUCTION

The two butterflies Oeneis melissa and Oeneis polixenes (Nymphalidae: Satyridae) were described

by Johann Christian Labricius in 1775 (Labricius 1775, pp. 484 and 513). The original descriptions are

provided below in Ligure 1. The type(s) of Oeneis melissa were from the Joseph Banks collection.

18 November 2019

Fig. 1: Transcriptions and Translations of Original Descriptions of Oeneis polixenes and Oeneis melissa.

DISCUSSION

1. JOSEPH BANKS AS THE COLLECTOR OF THE TYPE SPECIMENS

For O. polixenes , the stated type locality of “America boreali” (= northern America) is minimally

helpful in identifying where the type specimen(s) were collected; anywhere in northeastern North

America could have been the source of the specimen(s). For O. melissa , the stated type locality of “insula

Terre neuve Americae” (= Newfoundland; for which “Terre-neuve” is the modern French language name)

must have been an error, because Oeneis melissa has not otherwise been found on the island of

Newfoundland (Layberry et al , 1998).

Joseph Banks may either have collected the type specimens himself, or they may have been given

to him. According to his diaries (in: Lysaght, 1971) and his biography by Lysaght (1971), he visited

Newfoundland and Labrador in 1766 aboard the ship Niger. The primary purpose of Niger’s voyage was

to construct a blockhouse at Chateau Bay on the Labrador coast. Banks stayed in St. John’s,

Newfoundland for a month commencing 11 May, with snow still on the ground, to 11 June. Neither O.

polixenes nor O. melissa would have been in flight by June 11; therefore, they could not have come from

St. John’s.

Banks then sailed to Croque, Newfoundland on June 11, 1766 and collected in the vicinity during

June. He was ill through most of July and kept no diary and did little collecting. O. melissa is unknown

from the island of Newfoundland, and O. polixenes is unknown from the eastern side of Newfoundland

where Croque is located. Hence Banks could not have collected the type specimens at Croque. On 6

August he sailed for Chateau Bay on the Labrador coast, where he remained until 3 October (Lysaght,

1971).

The flight season in Labrador for resident (non-migratory), single-brooded, non-hibernating

butterflies is early June to late August (GBIF database). There are 116 unique combinations of Oeneis

species / locality / date records in Labrador, which provides a reasonable sample size. The latest flight

date for the four species of Oeneis that occur in Labrador (O. jutta , O. polixenes , O. melissa and O. bore)

is August 23, with all records from July 13 onward being for northern Labrador (north of 55°N) for O.

polixenes and O. bore (there are no August records for O. jutta or O. melissa). Chateau Bay is in southern

Labrador at 51.98°N, and therefore Oeneis there can reasonably be expected to have completed their flight

period before the end of July.

2. TYPE LOCALITIES

Pelham (2008) defined the type locality of both O. polixenes and O. melissa as Chateau Bay,

Labrador on the basis of Banks’ visit there. There are several reasons for this being unlikely for O.

melissa :

1. The most southern known locality for Oeneis melissa on the Labrador coast is 200 km to the

north, at Cartwright. Chateau Bay is therefore not within the known range of Oeneis melissa.

2. Habitats near Chateau Bay appear to be a mix of low elevation barren rounded bedrock and

conifer forest, neither of which is suitable habitat for O. melissa (viewed on Google Earth).

3. The flight season for Oeneis melissa in southern Labrador (if it is present) can be expected to

end before August 6.

In contrast, O. polixenes may occur near Chateau Bay, with suitable habitat apparently being

present (dry tundra and bogs), and O. polixenes has been collected on Belle Isle (GBIF database), less

than 35 km off-shore from Chateau Bay, and about 82 km southwest along the coast at LAnse-au-loup

(N. Kondla specimens). The dominant habitat on Belle Isle appears to be similar to that near Chateau Bay

(viewed on Google Earth). However, the flight season for O. polixenes in southern Labrador can also be

expected to end before August 6. Specimens of O. polixenes from southern Labrador (Blanc Sablon,

L'Anse-au-loup, L’Asne-au-clair) in the collection of Norbert Kondla are dated June 30 to July 5.

Therefore, it is unlikely that Banks collected the type specimens of either O. melissa or O.

polixenes near Chateau Bay, Labrador, although collection of O. polixenes during a late flight season

cannot be completely ruled out.

After his stay at Chateau Bay, Banks returned to Croque (all butterflies would have ceased flight

by that time), then a week later to St. John’s, and then after another two weeks returned to Europe. Banks

returned to London on 30 January 1767. Commencing in 1768 he sailed for three years on James Cook’s

first voyage, he then visited Iceland in 1772, and in 1773 he made his last voyage abroad to Holland

(Lysaght, 1971). Therefore, it is impossible for Banks to have personally collected the type specimens of

Oeneis melissa or O. polixenes after 1766.

Other possible sources for the O. melissa and O. polixenes types are either Moravian missionaries

based in Greenland (and thence Labrador), or Captain George Cartwright. Both are known to have

provided Banks with natural history specimens from the Labrador coast (Lysaght, 1971).

George Cartwright made his first visit to Labrador in 1766, where he met Banks. When he

returned in 1768, he decided to become a trader on the Labrador coast. There is no indication that he

supplied Banks with natural history specimens in the period 1766 - 1768. from 1770 to 1775 Cartwright

was based at Lodge Bay, Labrador (Cartwright 1792). Lodge Bay is 180 km south of the nearest known

occurrence (Cartwright, NL) of O. melissa , and is therefore far outside the known range of O. melissa. It

is therefore very unlikely that any O. melissa were collected there. Lodge Bay is within the range of O.

polixenes , but there is no evidence one way or the other whether Cartwright collected any specimens

there. It is therefore unlikely that the type specimen(s) of O. melissa and/or O. polixenes were collected

near Lodge Bay 1770-1775, but it cannot be completely ruled out for O. polixenes.

In 1775 George Cartwright founded what is now the modern town of Cartwright. A letter from

Cartwright to Banks (Lysaght, 1971, p. 265-66) dated October 12, 1775 refers to a lack of collecting

equipment for “Elys”, suggesting an intent to collect insects for Banks. However, that letter also makes it

clear that Cartwright had collected very few natural history specimens for Banks to that date, and

apparently he did not collect “Elys” in 1775. It is therefore unlikely that the type specimen(s) of O.

melissa and/or O. polixenes were collected by George Cartwright near Cartwright in 1775, but it cannot

be completely ruled out because both species are known to occur near Cartwright.

The Moravian Missions in Greenland sent their first missionaries to Labrador in 1752 but were not

a major influence until after 1770 (Lysaght, 1971). They were at Davis Inlet in 1765 (where O. melissa is

likely to occur), and founded Nain in 1770 (where O. melissa and O. polixenes are known to occur),

Okkak in 1775 (where O. melissa and O. polixenes are likely to occur), and Hopedale in 1781 (where O.

melissa and O. polixenes are known to occur). Banks had plants in his collection from the latter three

settlements, sent to him by the Moravian missionaries (Lysaght, 1971); however, only Nain was

established prior to the publication of the name melissa. Therefore, Moravian missionaries could have

supplied Banks with the O. melissa and/or O. polixenes type(s), and Nain is the most likely location for

the specimens to have come from. However other locations along the central and northern Labrador coast

cannot be completely ruled out.

3. TYPE SPECIMENS

The type specimens of both O. melissa and O. polixenes can reasonably be assumed to have come

from Labrador. The British colonial government of Newfoundland governed the Labrador coast during

the 18th Century, resulting in the modern province of “Newfoundland and Labrador”, hence the error in

the specified type locality for O. melissa is not unreasonable. The type locality of “America boreali” for

O. polixenes could be anywhere in Newfoundland and Labrador.

The type specimen(s) of Oeneis melissa were in the Joseph Banks collection at the time the

species was described by Fabricius (1775). The type(s) of O. melissa are now apparently lost (Zimsen,

1964), and Butler (1869 [1870]) could not find any specimen(s) in the Banksian Collection in the British

Museum. Miller and Brown (1981), Lukhtanov and Eitschberger (2000; 2001), and Pelham (2008) also

considered the original type specimen(s) of Oeneis melissa (Fabricius, 1775) to be lost. At my request,

Kim Goodger, Curator of Butterflies at the Natural History Museum of London, searched the Joseph

Banks insect collection, but was not able to locate any specimen that might be a type of Oeneis melissa.

The only butterfly type specimen in the Banks Collection that is associated with the name “ melissa ” is a

specimen of Precis sinuata (Nymphalidae), the phenotype of which does not approximate the original

description of Oeneis melissa.

The type specimen(s) of Oeneis polixenes were in the Joseph Banks collection at the time the

species was described by Fabricius (1775). Butler (1869 [1870]) recorded one specimen of O. polixenes

(as O. bore) in the British Museum collection, which was noted as “Presented 1845, by Dr. Thienemann”

and therefore is not a type specimen of O. polixenes due to the date. There is apparently only one type

specimen of O. polixenes presently in the Natural History Museum in London (formerly, British Museum

of Natural History).

EXISTING “NEOTYPES” OF OENEIS MELISSA FABRICIUS, 1775

A “neotype” of Oeneis melissa (Fabricius, 1775) has twice been designated by Lukhtanov and

Eitschberger (2000 and 2001) (Figures 2-4). Neither of these neotype designations, separately or

together, fulfills the requirements of Article 75 of the International Code of Zoological Nomenclature

(ICZN 1999). The following requirements (paraphrased for brevity) were not met: Article 75.3.2 A

statement of distinguishing characters for the taxon; Article 75.3.5 Evidence that the neotype is consistent

with the original description; and Article 75.3.6 Evidence that the neotype came from as near as

practicable from the original type locality. The “neotype” is therefore not a neotype under the ICZN,

because it does not meet the requirements for a neotype.

The requirements of the ICZN (1999) should be consistently followed to ensure nomenclatural

stability. The Oeneis melissa “neotype” designations of Lukhtanov and Eitschberger (2000; 2001) do not

meet several critical requirements of the ICZN and are therefore invalid. In addition, the locality data is

too vague to be taxonomically useful.

For the sake of nomenclatural stability, my first thought was to simply re-designate, in a manner

that meets the provisions of the ICZN, the specimen of Lukhtanov and Eitschberger (2000; 2001) as the

neotype of O. melissa. Unfortunately, the original melissa description of “Wings dark brown above,

unspotted. Posterior below white and black variegated” does not correspond to the neotype specimen

selected by Lukhtanov and Eitschberger (2000; 2001). Failure to meet ICZN Article 75.3.5 - evidence

that the neotype is consistent with the original description, and Article 75.3.6 - evidence that the neotype

came from as near as practicable from the original type locality, apparently led Lukhtanov and

Eitschberger (2000; 2001) to designate a specimen of a different taxon as the “neotype” of O. melissa.

Fig. 2. Designation of “neotype” of Oeneis melissa Fig. 3. Illustration of “neotype” of Oeneis melissa

(Fabricius, 1775) by Lukhtanov and Eitschberger (Fabricius, 1775) by Lukhtanov and Eitschberger

(2001) - transcription of text: (2000) - transcription of text and copy of images:

Photographs by Ulf Eitschberger & Joerg Nappert 2003, with permission.

Fig. 4. Images of data labels of Oeneis melissa (Fabricius, 1775) “neotype” designated by Lukhtanov and

Eitschberger (2000 and 2001).

Specimens from the north coast of Labrador do match the original description of O. melissa.

Specimens from Nain, Hopedale, and Hebron have “Wings dark brown above, unspotted. Posterior below

white and black variegated”. This is an area that Moravian Missionaries could have obtained specimens

and sent them to Joseph Banks. The neotype designated by Lukhtanov and Eitschberger (2000; 2001) has

a different phenotype and appears to be the taxon generally known as O. melissa semplei , which occurs

from “Quebec, interior Labrador, and Hudson’s Bay” (Layberry et al. 1995). The semplei specimen of

Lukhtanov and Eitschberger (2000; 2001) may be from Smokey Mountain near Labrador City, which is at

this time the most accessible (by a highway) interior Labrador location with melissa habitat. Acceptance

(through re-designating) of the Lukhtanov and Eitschberger (2000; 2001) “neotype” would result in

semplei becoming a synonym of melissa and leave the taxon on the north coast of Labrador without a

name. This is not acceptable, and accordingly I designate below a neotype for Oeneis melissa (Fabricius,

1775).

4. DESIGNATION OF A VALID NEOTYPE FOR OENEIS MELISSA (FABRICIUS, 1775)

The original type specimen(s) of Oeneis melissa (Fabricius, 1775) did not originate from the

nominal type locality of Newfoundland and could have come from various locations. The type(s) came

from somewhere along the Labrador coast, but the exact location cannot be determined (see previous

sections). A name-bearing type of Oeneis melissa (Fabricius, 1775) is necessary to define the nominal

taxon objectively to allow a taxonomic review of the species, and I have determined that there are no

extant specimens identifiable as the type(s) of Oeneis melissa (ICZN Articles 75.1, 75.2, 75.3.4).

The vicinity of Nain, Labrador is a reasonable choice for the type locality, and is at least as

probable as any other location along the northern Labrador coast (ICZN Article 75.3.6). I therefore select

a specimen as neotype with the specific locality data of “Nain, Labr.”, which is as near as practical to the

original type locality (ICZN Article 75.3.6) as discussed above.

The selected location of Nain, Labrador for the neotype is consistent with the selection of

Hopedale, Labrador for the neotype of Oeneis taygete Geyer, [1830] by dos Passos (1949). Nain and

Hopedale are only 150 km apart on the coast of Labrador with similar ecological characteristics.

However, Hopedale was founded after the description of O. melissa , and therefore is very unlikely to be

the source of the type(s).

The neotype specimen (a female) and its data labels are illustrated in Figure 5. The neotype

specimen is in the Canadian National Collection of Insects and Arthropods (CNC), Ottawa, Canada

(ICZN Article 75.3.7). The neotype corresponds to the original description of melissa (ICZN Article

75.3.5) in having wing fringes of alternating patches of white and brown scales (“dentate”), the overall

colour of the upperside is “dark brown” and “unspotted”, and the underside of the hindwings is “gray-

marbled” / “white and black variegated”. The data label reads “Nain Labr July 8, 1970”; the collector is

unknown.

Dorsal view

Ventral View

Data labels

Neotvoe Specimen 'barcode' mtDNA structure (COD

■ NEOTYPE

ID *,/■< B P[apilioj. N[ymptialis). P[halerata],

Nucleotide Seauence: AACTTTATATTTTATTTTTGGAATTTGAGCAGGCATAGTAG

GAACATCTCTTAGCCTTATTATTCGAACAGAATTAGGTAACCCAGGATCTTTAATTG

G AG ATG ATC A AATTT AT AAT ACT ATTGTT AC AGCTC ATGCTTTT ATCAT AATTTTTTT

TATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTATTCCCCTTATACTT

GGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGACTTTTACCT

CCTTCCTTAATACTATTAATTTCAAGTAGTATTGTTGAAAATGGAGCAGGAACAGG

ATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCTCATAGAGGATCTTCTGTTGA

TTTAGCAATTTTTTCCTTACATTTAGCTGGAATTTCCTCTATTTTAGGAGCTATTAAT

TTT ATT AC AACAATT ATT AAT ATACG AATT AAT AAT AT AAATT ATG ATCAAAT ACCTT

TATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTATTACTTTCTCTTCCTGTACT

AGCTGGAGCAATTACCATACTTCTTACAGATCGAAATTTAAATACTTCATTTTTTGA

Specimen ID Melissa Fabricius, 1775

nnrinM 7 = Oeneis melissa (Fabricius, 1775)

UU * 1 UO !/ Designated 2019 by C.S. Guppy

Photographs by C.S. Guppy, 2019. Photographs may be reproduced wit

TCCCGCAGGAGGAGGAGATCCTATTTTATACCAACATTTATTT

Fig. 5. Neotype of Oeneis melissa Fabricius, 1775

The distinguishing characters for the taxon (ICZN Article 75.3.2) are the dark brown, unspotted

colour of the dorsum and the “gray-marbled” / “white and black variegated” ventral hindwings. The

‘barcode’ mtDNA nucleotide sequence is also provided in Figure 5. I submitted one leg of the neotype

specimen to the Barcode of Life laboratory at the University of Guelph to obtain the ‘barcode’ - a 658

base pair portion of the cytochrome oxidase I (COI) mtDNA gene, and the data is available through the

public BOLD database. The ‘barcode’ structure is apparently unique to the species “Oeneis melissa ”,

although the structure may be present in more than one subspecies (C.S. Guppy, in prep.).

5. DESIGNATION OF A LECTOTYPE FOR OENEIS POLIXENES (FABRICIUS, 1775)

The original number of type specimens of Oeneis polixenes (Fabricius, 1775) is unknown and a

holotype was not designated explicitly or through implication; therefore, the type specimens are syntypes

(ICZN Article 73). There is one specimen that has been identified as a syntype of O. polixenes in the

Natural History Museum in London (formerly the British Museum of Natural History), and no other

extant specimens are known. The BMNH accession number is ‘63 48’, with the original accession number

label still attached to the specimen (Figure 6). The BMNH register indicates that specimen number ‘63

48’ was from ‘America’ and was a Fabrician type. The material was part of the Joseph Banks collection

that came to the museum via the Linnaean Society (John Chainey, pers. comm. Feb. 2015). The current

catalogue number label is BMNH(E) 668188. This specimen of O. polixenes is not that listed by Butler

(1869 [1870]) (John Chainey, pers. comm. Feb. 2015).

There are at least two different phenotypes (potentially different species or subspecies) of O.

polixenes in Labrador, one inhabiting northern tundra habitats and one inhabiting southern Labrador with

at least some populations in bog habitats (C.S. Guppy, in prep.). I expressly and deliberately designate the

specimen shown in Figure 6, in the collection of the Natural History Museum in London, as the lectotype

of Oeneis polixenes (Fabricius, 1775) (ICZN Article 74.7.3) to fix a specific phenotype for the name.

CONCLUSION

The Oeneis melissa (Fabricius, 1775) “neotype” designations of Lukhtanov and Eitschberger

(2000; 2001) do not meet several critical requirements of the ICZN and are therefore invalid. In addition,

the locality data is too vague to be taxonomically useful, and their “neotype” specimen is a specimen of

the taxon generally known as O. melissa semplei , and acceptance of their specimen as neotype would

change the meaning of the taxon Oeneis melissa. Hence, I reject their neotype designation.

A neotype Oeneis melissa (Fabricius, 1775) is designated from Nain, Labrador with careful

consideration of the Articles of the International Code of Zoological Nomenclature. A name-bearing type

of Oeneis melissa (Fabricius, 1775) is necessary to define the nominal taxon objectively to allow a

taxonomic review of the species, and I have determined that there are no extant specimens identifiable as

the type(s) of Oeneis melissa (ICZN Articles 75.1, 75.2, 75.3.4). The vicinity of Nain, Labrador is a

reasonable choice for the type locality, and is at least as probable as any other location along the northern

Labrador coast (ICZN Article 75.3.6). A female specimen has been selected as neotype with the specific

locality data of “Nain", which is as near as practical to the original type locality (ICZN Article 75.3.6).

The neotype specimen is in the Canadian National Collection of Insects and Arthropods (CNC), Ottawa,

Canada (ICZN Article 75.3.7). The neotype corresponds to the original description of melissa (ICZN

Article 75.3.5) in having wing fringes of alternating patches of white and brown scales (“dentate”), the

overall colour of the upperside is “dark brown” and “unspotted”, and the underside of the hindwings is

“gray- marbled” / “white and black variegated”. The ‘barcode’ mtDNA (COl gene) structure for the

neotype is provided.

The original number of type specimens of Oeneis polixenes is unknown and a holotype was not

designated explicitly or through implication; therefore, the type specimens are syntypes (ICZN Article

73). There is one specimen that has been identified as a syntype of O. polixenes in the Natural History

Museum in London (formerly the British Museum of Natural History), and no other extant specimens are

known. There are at least two different phenotypes (potentially different species or subspecies) of O.

polixenes in Labrador, one inhabiting northern tundra habitats and one inhabiting southern Labrador with

at least some populations in bog habitats. I have expressly and deliberately designated the specimen in the

collection of the Natural History Museum in London, as the lectotype of Oeneis polixenes (Fabricius,

1775) (ICZN Article 74.7.3) to fix a specific phenotype for the name.

ACKNOWLEDGMENTS

Norbert G. Kondla provided comments and suggestions throughout the many years this paper has

been in progress. Christian Schmidt provided access to the specimens in the Canadian National Museum

of Insects and Arthropods (Ottawa, Canada). Many others have provided specimens of Oeneis and

taxonomic comments for my on-going research on the genus.

LITERATURE CITED

Butler, Arthur Gardiner. 1869 [1870]. Catalogue of diurnal Lepidoptera described by Fabricius in the

collection of the British Museum. London; Taylor & Francis [Order of the Trustees, British Museum],

8vo: v + 303 pp.; 3 pis.

Cartwright, George. 1792. A Journal of Transactions and Events, During a Residence of Nearly Sixteen

Years on the Coast of Labrador; Containing Many Interesting Particulars, Both of the Country and Its

Inhabitants, Not Hitherto Known. 3 vol.: [xxii]; x; x, 287; 505; 248, 15pp. Newark.

Dos Passos, Cyril F. 1949. The distribution of Oeneis tarygete Geyer in North America with descriptions

of new subspecies (Lepidoptera, Satyridae). American Museum Novitates 1399: 1-21.

Fabricius, J.C. 1775. Systerna Entomologiae, sistens insectorum classes, ordines, genera, species, adiectis

synonymis, locis, descriptionibus, observationibus. Officina Libraria Kortii, Flensburgi et Lipsiae

[Flensburg and Leipzig, Germany], 8 vol: pp. xxxii + 832.

International Commission on Zoological Nomenclature [ICZN]. 1999. International Code of Zoological

Nomenclature. Fourth Edition. London: International Trust for Zoological Nomenclature, xxix + 306 pp.

Layberry, R. A., P. W. Hall and J. D. Lafontaine. 1998. The Butterflies of Canada. University of Toronto

Press. 280.

Lukhtanov, Y.A. and U.F.J. Eitschberger. 2000. Butterflies of the world. Part 11: Nymphalidae V, Oeneis.

Kektern: Goeke & Evers and Canterbury: Hillside Books. 12 pp. + pi. A + 26 pi. + pi. B.

Lukhtanov, V.A. and U.F.J. Eitschberger. 2001. Catalogue of the genera Oeneis and Davidina

(Nymphalidae, Satyrinae, Oeneini). Butterflies of the world, Supplement 4. Kektern: Goeke & Evers. 37

pp.

Lysaght, A.M. 1971. Joseph Banks in Newfoundland and Labrador, 1766: His Diary, Manuscripts and

Collections. Berkeley, CA: University of California Press. 512 pp.

Miller, L.D., and F.M. Brown. 1981. A catalogue/checklist of the butterflies of America north of Mexico.

Lepidopterists’ Society Memoir 2: i-vii, 1-280.

Pelham, J.P. 2008. A catalogue of the butterflies of the United States and Canada, with a complete

bibliography of the descriptive and systematic literature. Journal of Research on the Lepidoptera 40: i-

xiv+1-658.

Zimsen, Ellen. 1964. The type material of I. C. Fabricius. Copenhagen: Munksgaard. 656 pp.

The Taxonomic Report

is a publication of

The International Lepidoptera Survey (TILS)

The International Lepidoptera Survey is registered as a non-profit Limited Liability Company (LLC) in

the state of Virginia, U.S.A. The Taxonomic Report (TTR) is published for the purpose of providing a

public and permanent scientific record. It appears in digital, open-access form, is regularly disseminated

in hardcopy form to select institutional repositories and is also available as printed copy upon request at

the discretion of authors and/or the editor. Printing and postage costs may apply. Contents are peer-

reviewed but not necessarily through the anonymous review and comment process preferred by some

publishers of serial literature. Copies of all TTR papers are available via the following digital

repositories: Internet Archive (https://archive.org/) . Biodiversity Heritage Library

(https://www.biodiversitvlibrary.org) , Zobodat (https://www.zobodat.at/) and at the archival TTR website:

( http://lepsurvev.carolinanature.com/report.html ).

TILS Purpose

TILS is devoted to the worldwide collection of Lepidoptera for the purpose of scientific discovery,

determination, and documentation, without which there can be no preservation.

TILS Motto

“As a world community, we cannot protect that which we do not know”

Articles for publication are sought

They may deal with any area of research on Lepidoptera, including faunal surveys, conservation topics,

methods, etc. Taxonomic papers are especially welcome. There are no page charges for authors. Before

sending a manuscript, simply write to TTR editor, Harry Pavulaan, 606 Hunton Place NE, Leesburg,

VA, 20176, USA to initiate discussion on how to best handle your material for publication, and to discuss

peer review options; or email to intlepsurvev@ gmail.com .

Visit The International Lepidoptera Survey on the World Wide Web at:

http://lepsurvey.carolinanature.com

Join the discussion at our list serves on Yahoo! Groups at:

http://groups.yahoo.com/group/TILS-leps-talk/

http://groups.yahoo.com/group/TILS-moth-rah/