Volume 8 Number 7 6 November 2020

The Taxonomic Report

OF THE INTERNATIONAL LEPIDOPTERA SURVEY

ISSN 2643-4776 (print) / ISSN 2643-4806 (online)

Genomic evidence suggests further changes of butterfly names

Jing Zhang’, Qian Cong’, Jinhui Shen’, Paul A. Opler’ and Nick V. Grishin'*”

"Howard Hughes Medical Institute and Departments of Biophysics and Biochemistry, University of Texas Southwestern

Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390-9050, USA;

*Institute for Protein Design and Department of Biochemistry, University of Washington,

1959 NE Pacific Street, HSB J-405, Seattle, WA, 98195, USA;

* Department of Agricultural Biology, Colorado State University, Fort Collins, CO 80523-1177, USA.

“Corresponding author: grishin@chop.swmed.edu

ABSTRACT. Further genomic sequencing of butterflies by our research group expanding the coverage of species and

specimens from different localities, coupled with genome-scale phylogenetic analysis and complemented by phenotypic

considerations, suggests a number of changes to the names of butterflies, mostly those recorded from the United States and

Canada. Here, we present evidence to support these changes. The changes are intended to make butterfly classification more

internally consistent at the genus, subgenus and species levels. I.e., considering all available evidence, we attempt to assign

similar taxonomic ranks to the clades of comparable genetic differentiation, which on average is correlated with the age of

phylogenetic groups estimated from trees. For species, we use criteria devised by genomic analysis of the genetic

differentiation across suture zones and comparison of sympatric populations of closely related species. As a result, we resurrect

4 genera and | subgenus from subgeneric status or synonymy, change the rank of 8 currently used genera to subgenus,

synonymize 7 genus-group names, summarize evidence to support 19 taxa as species instead of subspecies and 1 taxon as

subspecies instead of species, along with a number of additional changes. One new genus and one new subspecies are

described. Namely, the following taxa are treated as genera Tharsalea Scudder, 1876, Helleia Verity, 1943, Apangea Zhdanko,

1995, and Boldenaria Zhdanko, 1995. Tetracharis Grote, 1898 is a valid subgenus (not a synonym of Anthocharis Boisduval,

Rambur, [Duménil] & Graslin, [1833]) that consists of Anthocharis cethura C. Felder & R. Felder, 1865 (Miller, 1764),

Anthocharis midea (Hubner, [1809]), and Anthocharis limonea (A. Butler, 1871). The following are subgenera: Speyveria

Scudder, 1872 of Argynnis Fabricius, 1807; Aglais Dalman, 1816 and Polygonia Hubner, [1819] of Nymphalis Kluk, 1780;

Palaeonympha Butler, 1871 of Megisto Hubner, [1819]; Hyponephele Muschamp, 1915 of Cercyonis Scudder, 1875; Pyronia

Hubner, [1819] and Aphantopus Wallengren, 1853 of Maniola Schrank, 1801 and Pseudonymphidia Callaghan, 1985 of

Pachythone. Lafron Grishin, gen. n. (type species Papilio orus Stoll, [1780], parent subfamily Lycaeninae [Leach], [1815]) is

described. Dipsas japonica Murray, 1875 is fixed as the type species of Neozephyrus Sibatani & Ito, 1942. The following taxa

are junior subjective synonyms: Falcapica Klots, 1930 of Tetracharis Grote, 1898; Habrodais Scudder, 1876, Favonius

Sibatani & Ito, 1942, Neozephyrus Sibatani & Ito, 1942, Quercusia Verity, 1943, Chrysozephyrus Shirdzu & Yamamoto, 1956,

and Sibataniozephyrus Inomata, 1986 of Hypaurotis Scudder, 1876; Plesioarida Trujano & Garcia, 2018 of Roeberella Strand,

1932; Papilio temenes Godart, 1819 (lectotype designated herein) of Heraclides aristodemus (Esper, 1794), Speyeria hydaspe

conquista dos Passos & Grey, 1945 of Argynnis hesperis tetonia (dos Passos & Grey, 1945), and Erycides imbreus Plotz, 1879

of Phocides polybius polybius (Fabricius, 1793). The following are revised genus-species combinations: Pachythone lencates

(Hewitson, 1875) Pachythone flocculus (Brévignon & Gallard, 1993), Pachythone floccus (Brévignon, 2013), Pachythone

heberti (P. Jauffret & J. Jauffret, 2007), Pachythone marajoara (P. Jauffret & J. Jauffret, 2007) and Cissia cleophes (Godman

& Salvin, 1889). The following species are transferred between subgenera: Anthocharis lanceolata Lucas, 1852 belongs to

Anthocharis Boisduval, Rambur, [Duménil] & Graslin, [1833] instead of Paramidea Kuznetsov, 1929 and Danaus eresimus

(Cramer, 1777) belongs to Danaus Kluk, 1780, and not to Anosia Hubner, 1816. The following taxa are distinct species rather

than subspecies (of species shown in parenthesis): Heraclides ponceana (Schaus, 1911) (not Heraclides aristodemus (Esper,

1794)), Colias elis Strecker, 1885 (not Colias meadii W. H. Edwards, 1871), Argynnis irene Boisduval, 1869 and Argynnis

nausicaa W. H. Edwards, 1874 (not Argynnis hesperis W. H. Edwards, 1864), Coenonympha california Westwood, [1851] (not

Coenonympha tullia (Muller, 1764)), Dione incarnata N. Riley, 1926 (not Dione vanillae (Linnaeus, 1758)), Chlosyne

coronado (M. Smith & Brock, 1988) (not Chlosyne fulvia (W. H. Edwards, 1879)), Chlosyne chinatiensis (Tinkham, 1944)

(not Chlosyne theona (Ménétriés, 1855)), Phocides lilea (Reakirt, [1867]) (not Phocides polybius (Fabricius, 1793)),

Cecropterus nevada (Scudder, 1872) and Cecropterus dobra (Evans, 1952) (not Cecropterus mexicana (Herrich-Schaffer,

1869)), Telegonus anausis Godman & Salvin, 1896, (not Telegonus anaphus (Cramer, 1777)), Epargyreus huachuca Dixon,

1955 (not Epargyreus clarus (Cramer, 1775)), Nisoniades bromias (Godman & Salvin, 1894) (not Nisoniades rubescens

(Moschler, 1877)), Pholisora crestar J. Scott & Davenport, 2017 (not Pholisora catullus (Fabricius, 1793)), Carterocephalus

mandan (W. H. Edwards, 1863) and Carterocephalus skada (W. H. Edwards, 1870) (not Carterocephalus palaemon (Pallas,

1771)), Amblyscirtes arizonae H. Freeman, 1993 (not Ambiyscirtes elissa Godman, 1900), and Megathymus violae D. Stallings

& Turner, 1956 (not Megathymus ursus Poling, 1902). Resulting from these changes, the following are revised species-

subspecies combinations: Heraclides ponceana bjorndalae (Clench, 1979), Heraclides ponceana majasi L. Miller, 1987,

Argynnis irene dodgei Gunder, 1931, Argynnis irene cottlei J. A. Comstock, 1925, Argynnis irene hanseni (J. Emmel, T.

Emmel & Mattoon, 1998), Argynnis nausicaa elko (Austin, 1984), Argynnis nausicaa greyi (Moeck, 1950), Argynnis nausicaa

viola (dos Passos & Grey, 1945), Argynnis nausicaa tetonia (dos Passos & Grey, 1945), Argynnis nausicaa chitone W. H.

Edwards, 1879, Argynnis nausicaa schellbachi (Garth, 1949), Argynnis nausicaa electa W. H. Edwards, 1878, Argynnis

nausicaa dorothea (Moeck, 1947), and Argynnis nausicaa capitanensis (R. Holland, 1988), Argynnis zerene atossa W. H.

Edwards, 1890, Dione incarnata nigrior (Michener, 1942), Chlosyne coronado pariaensis (M. Smith & Brock, 1988),

Cecropterus nevada aemilea (Skinner, 1893), Cecropterus nevada blanca (J. Scott, 1981), Telegonus anausis annetta (Evans,

1952), Telegonus anausis anoma (Evans, 1952), Telegonus anausis aniza (Evans, 1952), Epargyreus huachuca profugus

Austin, 1998, Carterocephalus mandan mesapano (Scudder, 1868) and Carterocephalus skada magnus Mattoon & Tilden,

1998. American Coenonympha subspecies placed under C. tullia other than Coenonympha tullia kodiak W. H. Edwards, 1869,

Coenonympha tullia mixturata Alpheraky, 1897 and Coenonympha tullia yukonensis W. Holland, 1900 belong to C. california.

Heraclides ponceana latefasciatus Grishin, ssp. n. is described from Cuba. Argynnis coronis carolae dos Passos & Grey, 1942

is considered a subspecies-level taxon. Unless stated otherwise, all subgenera, species, subspecies and synonyms of mentioned

genera and species are transferred together with their parent taxa, and others remain as previously classified.

Key words: taxonomy, classification, genomics, phylogeny, biodiversity.

ZooBank registration: http://zoobank.org/9A8DCBC8-A9D5-4083-B640-BA5101827478

INTRODUCTION

DNA-based phylogenies (Zuckerkandl and Pauling 1965) revolutionized the way we view animal

classification and taxonomy, including butterflies (Mutanen et al. 2010). Previously relying on several

carefully selected gene markers, DNA methods have evolved towards sequencing and comparison of

whole genomes. Genome-scale approaches aim at utilizing all DNA of an organism and thus are most

comprehensive and accurate, frequently revealing inconsistencies between phylogeny and current

classification (Kawahara and Breinholt 2014; Espeland et al. 2018; Allio et al. 2019; Li et al. 2019; Zhang

et al. 2019a; Zhang et al. 2019b). Our research group genome-sequenced all butterfly species recorded

from the United States and Canada (USC) (Zhang et al. 2019d) and proposed refinements to butterfly

taxonomy (Zhang et al. 2019c). Currently we are working on extending our genomic datasets to cover

subspecies and populations, in addition to species from other parts of the world. Review of these datasets

suggests additional changes based on the analysis of phylogenetic trees and genetic variation between and

within species. Here, we present these results after explaining the general logic and methods behind them.

Total DNA is extracted from a leg (or other parts of a butterfly), fragmented into short pieces

(unless the specimen is old and DNA is already degraded) and sequenced in 150 base pair (bp) segments.

Thus, every fragment of DNA present in the sample is getting sequenced, resulting in the coverage of the

entire genome, both nuclear and mitochondrial, coding and non-coding (Zhang et al. 2019a). Because this

approach can sequence very short DNA (e.g. 25-50 bp), even very old specimens with degraded DNA

yield usable data (Cong et al. 2019a). In this work, we mostly use DNA sequences of protein-coding

genes, which are computationally selected from the total pool of DNA sequences to match a known

protein set of a butterfly. Butterflies typically have nearly 15 thousand genes, and the total number of base

pairs that we get for phylogenetic analysis is about 10 million (Cong et al. 2015; Zhang et al. 2019d). For

comparison, a good dataset of gene markers typically covers less than 10 thousand base pairs. Due to the

vast size of genomic datasets, phylogenies resulting from them are usually reliable. Reliability of each

node in the tree is indicated by a number next to that node, the closer it is to 1, the more reliable is the

node. Furthermore, the genotype encodes phenotype, thus, all the features of wing patterns and

morphology of butterflies and their life stages (including caterpillar foodplant preferences) are encoded in

these genomic sequences. For this reason, the genomic dataset we sequence may be the best

representation of a butterfly (richer than a pinned adult specimen that we visually inspect), given a

meaningful approach to analyze these genomes.

Armed with genome-scale phylogenetic trees, we have ventured to propose taxonomic changes.

The majority of the changes discussed below deal with a change of rank in the classification. For genus-

group names, we have changed the rank of taxa from genus to subgenus, or move between valid names

and synonyms. For species-group names, mainly we have changed the rank of subspecies to species. The

reason for these changes is to bring these categories in better agreement with their definitions, although

such definitions are never precise and are continuously being refined with additional knowledge gained.

A genus is defined as a monophyletic group (a clade in an accurate phylogenetic tree) of related

species that is below the level of a tribe or subtribe. Currently, there are no objective criteria for grouping

Species into genera. However, the genus level is probably more important than any other classification

level above species, because a species name contains a genus name as the first word. Therefore, for its

optimal practical use, a genus should be defined neither too stringently to encompass only a small group

of very close relatives, nor should it be too broadly defined to include too distant relatives. Subjectively,

taxonomists follow their own intuition about where to draw a boundary of a genus. Our thoughts on the

criteria for a genus are discussed in the Taxonomic Appendix to Li et al. (2019) and the Introduction in

Grishin (2019). First, a genus should be a major and prominent phylogenetic group (i.e., it is best if the

phylogenetic tree branch leading to the last common ancestor of the genus is longer than the nearby

branches). Secondly, genetic diversity is a function of the time since the origin of a genus. Theoretically, a

genus may be defined as all ancestors of a species that lived at some given point in the past. Practically

this definition can be applied through a narrow slice across a time-calibrated phylogenetic tree at a

specific time point (Talavera et al. 2012; Li et al. 2019). While it is not possible to establish a distance

cutoff using COI barcodes (or any other gene markers) when defining a genus due to the reasons

explained by Trujano-Ortega et al. (2020), a comparison of COI distances may be instructive and should

be used as evidence combined with other considerations. Provided these general criteria, it is also best if

most genera are in agreement with how they are currently defined (mostly using phenotypic

considerations, such as similarity in appearance), to avoid additional name changes. Further examples of

how we apply these principles to specific cases are given in the Discussion section below.

Meaningful groups of species within a genus can be given a rank of subgenus. Subgenera are

useful to define clades that are not as prominent as a genus, but represent groups of very close relatives,

mostly recognizable immediately by their appearance as such. Although frequently frowned upon and

synonymized or treated as a genus instead, a subgenus is one of just eight levels of the ICZN Code

hierarchy of names (ICZN 1999). The number of levels in a phylogenetic tree is larger than these eight

categories. Therefore, it seems wasteful to ignore the level that 1s aimed at refining the classification and

indicating phylogenetic substructure within a large and diverse genus. We use subgenus category freely

and suggest that many groups currently viewed as genera may be subgenera instead: it seems more

valuable to stress their relatedness by uniting them in a broader genus, yet indicating their distinction by

keeping them as subgenera. We believe that the consistency criterion is of importance here as well. Le.,

groups defined as subgenera in one lineage should correspond to subgenera of comparable genetic

differentiation and time of origin in another lineage.

Species definitions (~concepts) have been extensively addressed in the literature (Mallet 1995).

Comparing many species concepts that have been proposed (Aldhebiani 2018), our view is closest to what

Claridge (2017) described as a "broadly based biological species concept", which seems similar to the

"genomic integrity species definition" of Sperling (2003). I.e., species are defined by some reproductive

barrier, which is not absolute but porous (Mallet et al. 2016); hybrids are characterised by lower fitness

and usually are eliminated from the population, thus allowing each species to maintain its genetic

uniqueness (=integrity) that persists in time despite on-going hybridization with other species. This

definition does not include phenotypic distinction between species, and allows for a possibility of

"cryptic" species that look superficially indistinguishable, but are to some extent reproductively isolated

from each other. Equally, this definition does not exclude hybrid species, 1.e. those that originate by a

significant gene influx of one species into a population of another that occurred over a relatively short

period of time. If this population that experienced the influx persists in time and is reproductively isolated

from both of its parent species to the extent comparable to isolation in other related species, then it can be

called a hybrid species, in particular, if it expands its range and further diversifies.

Traditionally, species are defined by morphological distinctiveness. Morphological distinctiveness

accumulates with time as a result of reproductive isolation, but it does not necessarily contribute to it.

Therefore, using a morphological consideration does not provide direct evidence of reproductive isolation

and thus speciation. On the contrary, using genomic DNA sequences, we can study reproductive isolation

directly and look for segments of DNA from different species in a species' genome under study. Presence

of such segments would indicate hybridization and the fraction of such segments would indicate the

extent of hybridization. Thus, analysis of genomic sequences may be the best practical approach to

species definition available today.

We carried out a study to devise genomic criteria for distinguishing different species from

populations of the same species (Cong et al. 2019b). We studied sister butterfly populations across a

central Texas suture zone. Suture zones are geographic boundaries common for many pairs of closely

related species (counterparts) (Remington 1968). This central Texas suture zone is old (Newton 2003),

therefore pairs that attained species status across it are likely to be more strongly isolated reproductively

than more recently speciated pairs. Therefore, our criteria obtained using this old zone are likely to be

conservative. We analyzed transcriptomes (mostly protein-coding RNA) of 25 pairs of western and

eastern counterparts around the central Texas suture zone. Some of these counterparts were different

species like Heraclides cresphontes (Cramer, 1777) and H. rumiko Shiraiwa & Grishin, 2014, others were

populations of the same species from the north and south Texas, e.g. Hylephila phyleus (Drury, 1773).

We found that two DNA-based measures best separate distinct species from conspecific

populations. These measures were fixation index (Fst) and the extent of gene flow (measured by Gmin),

both computed on the sex Z chromosome-encoded genes. Male butterflies have two Z chromosomes,

while females have one Z and one W, which is a special female chromosome. Fst is frequently used in

population genomics. Fst compares DNA divergence of specimens within each population (or species) to

DNA divergence between populations (species). Fst ranges between 0 and 1. If Fst between two

populations is low, near 0, then these populations are similar to each other. If Fst is high, above 0.5, then

these two populations differ and are likely to be different species. Gmin is the fraction of segments of a

different population (species) in a genome of a given population (species), thus it gives an estimate of

gene exchange between populations or species (Geneva et al. 2015). Values of Gmin near 0 indicate the

lack of gene exchange between populations suggesting that these populations are different species. Higher

Gmin corresponds to more gene exchange and the lack of reproductive barrier meaning conspecificity.

These two measures (Fst and Gmin) partition the 25 pairs of counterparts into two distinct and

well-separated groups: the one corresponding to little genetic isolation and thus being the same species,

and the other characterized by higher Fst (more than 0.2) and smaller Gmin (less than 0.06, 1.e. about 6%),

which corresponds to distinct species. Studies on human populations show that maximal Fst between

human populations is about 0.2 (Nelis et al. 2009) and our species (Homo sapiens) has about 1.5% - 2.1%

genes introgressed from Neanderthals (Homo neanderthalensis) (Wall and Yoshihara Caldeira Brandt

2016). Therefore, our criteria applied to humans confirm that modern humans are the same species, but

Neanderthal was a distinct species.

In this work, we compute Fst/Gmin on population pairs that we test for a possibility that they

represent distinct species. When the values are, for instance 0.45/0.01, then it is most likely that we are

dealing with distinct species (Fst is above 0.2 and Gmin is below 0.06). However, if the values we get are

0.16/0.2, then these populations are conspecific (Fst is below 0.2 and Gmin is above 0.06). These criteria

are useful, but they should not be taken absolutely and separately from other evidence. While large Fst

values above 0.5 and small Gmin values below 0.01 are more definitive indicators of speciation, when

they are closer to the "gray zone" (e.g. Fst is between 0.18 and 0.25 and Gmin between 0.03 and 0.07)

further evidence is necessary. Additional problem may arise with siblings that are low in genetic diversity,

because their genomes are various recombinations of their parents' genomes, or with inbred populations,

for a similar reason. Inclusion of these closely related individuals elevates Fst due to low diversity within

siblings or inbred populations. To avoid this undesirable effect, we used specimens from different

localities when possible.

We also analyzed COI barcode divergence, which for distinct species is typically above 2% in the

presence of phenotypic distinctiveness (Hebert et al. 2003) and inspect genomic trees. It should be taken

into account that less than 2% barcode divergence has been reported for distinct species (Burns et al.

2007). Conversely, due to introgression, conspecific individuals may differ in their barcodes by more than

2% (Zakharov et al. 2009; Cong et al. 2017).

Furthermore, distinct species usually form distinct and well-supported clades (support values near

1 by these clades) in phylogenetic trees. Branches supporting distinct species are typically longer than

internal branches within a subtree of conspecific specimens. Each terminal branch in the tree is usually

long, because of individual variation and uniqueness of each specimen, and also because sequencing

errors and contaminations (not being common for any pair of specimens) tend to be reflected in the

terminal branch. For conspecific populations, specimens may be intermixed in the trees, or support values

for separation of populations are smaller (closer to 0 than to 1), due to significant gene exchange between

these populations, when some genes cluster individuals differently from other genes.

Yet another advantage of genomic analysis is its robustness to small number of specimens

analyzed. Phenotypic analysis must rely on a large number of specimens to gauge the range of variation,

which is shaped by the interactions of genotype with the environment. DNA variation is not affected by

the environment, and each specimen contains two genomes: from mother and from father, which in turn

contain information from "grandparents". Therefore, even a couple of specimens from distant localities

(i.e. no close kinship) is sufficient to estimate intraspecific variation with reasonable accuracy.

For brevity, we do not review phenotypic differences between most of the taxa we deal with, and

interested readers should consult other publications. All these taxa have been previously described and

their phenotypic characters given elsewhere. These characters do not contribute to our decision to change

ranks of these taxa, although they may be looked at as complementary supporting evidence that increases

confidence in the results. The evidence presented here is based on genomic analysis. The data we offer are

new and they allow us to interpret known phenotypic differences between these taxa from a different and

complementary perspective. The purpose of this work is to propose taxonomic changes that are gleaned

from genomic data, so that the new name combinations can be used in other publications. A more detailed

evolutionary analysis of genomic data will be published elsewhere.

The taxonomic rearrangements we propose are supported by genome-scale phylogenetic trees, Fst

and Gmin statistics, and sometimes complemented by phenotypic considerations. The sections are

presented in standardized format. The taxonomic act is the title of each section. Relevant genera,

subgenera and their type species, are specified. When the species are listed with their original genus

name, author names are given without parenthesis. For each species and subspecies with revised rank,

type locality is given. A section is usually illustrated with a small segment of a nuclear genomic tree (or

other trees as stated in the text) including taxa necessary to support the conclusions. Previous, not newly

proposed, genus-species and species-subspecies combinations are used in the figures (per Pelham 2020

<http://www.butterfliesofamerica.com/US-Can-Cat.htm>, version revised 7 August 2020, except those

name changes adopted before this publication based on our genomic results). New name combinations are

given in the text. Taxa of major focus are shown in red, other taxa of interest are shown in blue, magenta

or green. The section ends with a conclusion and in many cases with a list of species with revised genus-

Species or species-subspecies name combinations. The sections are ordered by family and typically in

their taxonomic order from Zhang et al. (2019d) (except in Nymphalidae, where the arrangement was

altered to better fit larger images on pages while keeping them next to relevant text). Finally, whole

genome shotgun datasets we obtained and used in this work are available from the NCBI database

<https://www.ncbi.nlm.nih.gov/> as BioProject PRJNA672791, and BioSample entries of the project

contain the locality and collection data of the specimens sequenced.

Family Papilionidae Latreille, [1802]

Heraclides ponceana (Schaus, 1911) is a species

distinct from Heraclides aristodemus (Esper, 1794)

Initially proposed as a species and currently treated as a subspecies of Heraclides aristodemus (Esper,

1794) (type locality Haiti), Papilio ponceana Schaus, 1911 (type locality USA: Florida, Miami) shows

profound genetic differentiation from H. aristodemus by a magnitude characteristic of species-level taxa.

Phylogenetic trees reveal partitioning of the taxa previously placed in H. aristodemus into two prominent

clades, including the tree constructed from proteins encoded by the Z chromosome (Fig. 1). The Fst

between H. a. ponceana and H.

GaraRaes aristodemus ‘temenes' Ce eet

. 7 : 2 —— raclides aristodemus ‘temenes'|14101H 03IMICuba Guantanamo|1900

aristodemus populations 1S 0.43, ane Heraclides Siecotents eo cee FL,Key Largo|1i972

hi h : di h x 0.28 -—— as eee eer Sie lesa Rll Upper Key ae

ee Heraclides aristodemus bjorndalae|15021409|M|Bahamas, Great Inagua Islan

whic In icates t cir strong r Heraclides areas Blomdalae|275 Seen sie bala North Caicos Island|1990

: * 4s : : Heraclides aristodemus temenes ub

differentiation, and Gmin 1S 0.02, o i ih otebadlc pa aristodemus Perea eee

hi h l h : fa an eraclides ce ta Hehe 18079F08 St IMiCabalprior to aes

; Heraclides aristodemus aristodemus|2882|M|Dominican Republic:Pedernale to El Ace|2013

whic suggests OW gene CXC ange roa Heraclides aristademus aristodemus|2880|M|Dominican Republic: Padernales, road ae El Ace|2013

h f h = Heraclides aristodemus temenes|18079F07|ST|M|Cubalprior to 1819|MNHP

between them. COI barcodes of the

Fig. 1. Heraclides ponceana (red: new ssp., magenta) and H. aristodemus (blue).

two also differ by 3.2% (~21

different base pairs). Moreover, it 1s possible (see below) that H. a. ponceana and H. aristodemus are (or

were) sympatric in Cuba. Therefore, we reinstate Heraclides ponceana (Schaus, 1911) as a species-level

taxon. Due to their genetic and morphological similarities, we consider Heraclides ponceana bjorndalae

(Clench, 1979) (type locality Bahamas: Great Inagua Island) and Heraclides ponceana majasi L. Miller,

1987 (type locality Bahamas: Crooked Island) to be subspecies of H. ponceana, new combinations.

Papilio temenes Godart, 1819 is a junior subjective synonym

of Heraclides aristodemus (Esper, 1794)

The short version of the original description of Papilio temenes Godart, 1819 (page 21) is: "Dessus des

ailes d'un brun-noirdtre, avec deux bandes jaunes, maculaires, disposées en sautoir sur les supérieures: les

inférieures en queue: le dessous de celles-ci jaunatre, avec une bande bleue, flexueuse, sur le milieu"

(Godart 1819). It can be translated word-for-word as: "Above the wings of a blackish-brown, with two

bands yellow, macular, arranged in sautoir [=crosswise] on the forewings: the hindwings [end] in tail: the

underside of these [hindwings, not tails] yellowish, with a band blue, flexuous, in the middle", and

interpreted as: "Wings above blackish-brown, forewings with two yellow macular bands that cross each

other, hindwings with tails, underside of hindwings yellowish with a blue flexuous band in the middle."

Perhaps the most significant word here is "sautoir" defined in Dictionary.com as "A ribbon, chain, scarf,

or the like, tied around the neck in such a manner that the ends cross over each other" (Dictionary.com

LLC 2020), and by Merriam-Webster dictionary as "a chain, ribbon, or scarf worn about the neck with the

ends forming a St. Andrew's cross in front" (Merriam-Webster 2020). It is important because this

character (crosswise vs. more parallel arrangement of yellow forewing bands) is diagnostic of H.

aristodemus (crosswise) vs. H. ponceana (more parallel, images in Warren et al. (2016)). Today, the name

temenes is applied to a broad-banded form of H. ponceana that flies in Cuba (see below). Here we argue

that this is a misidentification, and the Godart's temenes is H. aristodemus instead.

We see that, although the Godart's description of P. temenes is brief, two of its details agree better

with H. aristodemus than with the broad-banded subspecies of H. ponceana from Cuba: crisscrossing

bands and blue flexuous band. In the broad-banded subspecies, the outer band is more parallel to the inner

band and does not give an impression of crossing it. And the blue spots on the hindwing underside look

more like a row of lunules than an irregular blue band. In H. aristodemus, forewing bands indeed give an

impression of crossing bands, and the blue spots on the hindwing below look like an irregular blue band.

Furthermore, an extended description of P. temenes on page 63 states that the forewing bands are narrow

and macular ("étroites, maculaires") (Godart 1819), instead of being broad and continuous. Besides this

additional detail, the extended description reiterates other points of the short description. We note that

some H. aristodemus females may have broader and more continuous yellow bands that are more similar

to those in H. ponceana (Fig. 2e), but the P. temenes description does not mention this possibility,

simplifying the application of the name.

Next, we inspected all potential syntypes of P. temenes, two specimens in Paris, France (Fig. 2ab)

and one (only photograph inspected) in Edinburg, UK (Bland 2019). These 3 specimens closely agree

with the original description of P. temenes, carry historical labels and labels indicating their type status

("type", "co-type", or "?co-type") and therefore are likely to be true syntypes of this taxon. These

Specimens phenotypically are H. aristodemus and not H. ponceana, differing from the broad-banded

subspecies from Cuba. Furthermore, we sequenced two syntypes in Paris (one labeled "TYPE", the other

labeled "CO-TYPE") and they are H. aristodemus by genomic DNA (Fig. | blue), in agreement with their

wing patterns. In conclusion, our analysis of the original description and the likely syntypes leaves little

doubt about the identity of P. temenes as H. aristodemus, which is a species different from the broad-

banded H. ponceana "temenes" found on Cuba today (Fig. 1 red).

temenes

MNHP

,{ MUSEUM DE PARIS

DNA sample ID:

NVG-18079F08

c/o Ni ishin

temenes

FMNH ZMHB

DNA sample ID; S

NVG-14102A07 Rveeisnsned

Nick V. Grishii ji

c/o Nick V. Grishin c/o Nick V. Grishin

Tipi/e ar) ato aemes

Soon ‘Camenes

temenes

LACM

DNA sample !D:

ZMHB

DNA sample ID;

NVG-15029C11

c/o Nick V. Grishin

latefasciatus ssp. n.

kV. Grishin

AMNH

ie DNA sample ID: 1

NVG-14101H10 ‘ estion

c/o Nick V. Grishin

latefasciatus ssp. n.

latefasciatus ssp. Nn.

Fig. 2. Heraclides aristodemus (a—e) and H. ponceana (f-h). Green arrows point at equivalent positions in different specimens.

Due to misapplication of the name temenes to a taxon different from that in the original description

and for the future stability of the name, we designate the syntype in the Muséum National d'Histoire

Naturelle, Paris, France (MNHP) shown in Fig. 2a and possessing all the characters stated in the original

description, with the following 4 rectangular white (Some faded to brownish) labels: printed red || TYPE ||;

framed, lined and printed with green, first line handwritten in black || Anc. Collection | MUSEUM DE

PARIS ||; printed, with a square barcode on the right side || MNHN, Paris | EL63126 ||; printed || DNA

sample ID: | NVG-18079F07 | c/o Nick V. Grishin ||, the lectotype of Papilio temenes Godart, 1819. The

red, rectangular, printed label || LECTOTYPE < | Papilio temenes | Godart, 1819 | designated by Grishin

|| will be added to this specimen. This specimen was chosen as the lectotype because it is labeled "type"

rather than "co-type", and it yielded genomic dataset of a good quality for a specimen that old.

It appears that Oberthtir (1897) was the first to incorrectly apply the name P. temenes to the broad-

banded subspecies of H. ponceana from Cuba, inconsistently with the original description and now with

the identity of the lectotype of P. temenes. Oberthiir illustrated one such specimen. While we have not

investigated the reasons behind Oberthiir's mistake, we note that it has been followed in subsequent

literature. Interestingly, we found 3 century-old H. aristodemus (i.e. true P. temenes) specimens labeled

"Cuba", in ZMHB and FMNH (Fig. 2c—e). Further studies may answer the question whether both species

(H. aristodemus and H. ponceana) co-occurred in Cuba, or the old records from Cuba were mislabeled.

In summary, we conclude that Papilio temenes Godart, 1819, syn. n., is a junior subjective synonym

of Heraclides aristodemus (Esper, 1794). The type locality of temenes should remain as stated on page 63

(Godart 1819): "Antilles & dans l'Amérique septentrionale", i.e., "West Indies and North America", which

is not necessarily Cuba. It remains to be investigated whether H. aristodemus has been found or still

occurs in Cuba. In any case, as detailed above, the broad-banded subspecies of H. ponceana from Cuba

does not have a name, and it is described here as new.

Heraclides ponceana latefasciatus Grishin, new subspecies

http://zoobank. org/C835D721-548C-4822-9280-E241A1C94866

(Figs. 1, 2fh)

Definition. This taxon differs from H. aristodemus in that the outer band of yellow spots on the forewing

is more parallel to the inner band (and the outer margin) rather than approaching the inner band at an

angle and giving an appearance of crossing the inner band; on the hindwing below there are more

prominent red spots and more crescent-shaped blue spots that are better separated from each other, rather

than forming a continuous band. This subspecies differs from all other H. ponceana subspecies by broader

yellow central bands on both wings, less extensive brown coloration on the forewings below, a paler basal

area and the lack of red spotting in the postdiscal area on hindwing above.

Type locality. Cuba: Guantanamo province, Rio Seco, San Carlos Estate.

Distribution. Known only from Cuba.

Etymology. The broad yellow bands are the most distinctive feature of this subspecies. The name is

formed from the Latin words /atus (wide, broad) and fascia (band, stripe). The name is an adjective.

Type material. Holotype male (Fig. 2g), deposited in the American Museum of Natural History, New

York, NY, USA (AMNH), with the following 4 rectangular white (some faded to brownish) labels:

printed, the date crossed out || San Carlos Est. | Guantanamo | Cuba. 4-8-8 ||; handwritten || May 1 '00

||; printed with the numbers handwritten || Am. Mus. Nat. Hist. | Dept. Invert. Zool. | No. 20976 ||; printed

|| DNA sample ID: | NVG-14101H09 | c/o Nick V. Grishin ||. The red, rectangular, printed label ||

HOLOTYPE < | Heraclides ponceana | latefasciatus Grishin || will be added to this specimen. Ten

paratypes (when known, localities are given in parenthesis after specimen numbers): 5 males (NVG-

14101H10 in AMNH and NVG-14106A11 (Matanzas), NVG-14106A12 (Santiago), NVG-14106B01

(Guantanamo) & NVG-14106B02 in USNM) and 5 females (NVG-14114B09 & NVG-14114B10 in

LACM and NVG-14106B03 & NVG-15104A01 (both from Santiago) & NVG-15104A02 in USNM).

Barcode sequence of the holotype. aacattatatTTTaTTTTTGGTGTTTGAGCAAGAATATTAGGAACTTCTCTTAGTTTATTA

ATTCGAACTGAATTAGGAACTCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACCATTGTTACAGCTCATGCTTTTATTATAATTTTTT

TTATGGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAA

TATAAGATTTTGACTTTTACCTCCTTCTTTAACTCTTTTAATTTCAAGTATAATTGTCGAAAATGGAGCTGGAACTGGATGAACTGTTTATCCT

CCCCTTTCTTCTAATATTGCTCATGGAAGAAGTTCAGTAGATTTAGTTATTTTTTCTCTTCATTTAGCGGGTATTTCTTCAATTTTAGGAGCAA

TTAATTTTATTACTACTATTATTAACATGCGAATTAATAGAATATCCTTTGATCAAATACCTTTATTITGTTTGAGCTGTAGGAATTACAGCTTT

ATTATTACTCTTATCCTTACCCGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTICATTCTTTGATCCTGCAGGA

GGAGGAGATCCTATTCTATACCAACACTTATTT

Instead of proposing a new name for the Cuban broad-banded subspecies of H. ponceana, we entertained

a possibility to request ICZN to designate one such specimen as the neotype of P. temenes, consistent

with the current usage of this name, but contrary to the original description and the identity of three extant

syntypes. However, we decided against this route for the following reasons. First, the name H. a. temenes

is not in very wide use being applied to an uncommon endemic of a single island to warrant a special

consideration by ICZN. Second, it seems most fair to respect original research that lead to creation of this

name, and the original identity of this species that is quite clear even from its description alone (see

above). Third, it is conceivable that the true P. temenes occurred (or even still occurs) in Cuba, and further

research may show that it is not a synonym, but a valid subspecies of H. aristodemus, in which case it will

be without a name if the neotype is designated to preserve the current usage of "temenes" as a subspecies

of H. ponceana. It would create a nuisance situation when the original P. temenes would need a new

name. Finally, a valid name that is suggestive of a diagnostic character (/atefasciatus) has an advantage of

being easier to attribute to the taxon (compared to temenes) and thus may be easier to remember.

Family Pieridae Swainson, 1820

Colias elis Strecker, 1885 is a species

distinct from Colias meadii W. H. Edwards, 1871

Previously considered a subspecies of Colias meadii W. H. Edwards, 1871 (type locality USA: Colorado),

Colias elis Strecker, 1885 (type locality

4 : : 7 Colias nastes streck atl 114D02 2|ii|cansda: ‘Alberta|2003

Canada: Alberta) is not monophyletic with — Gclige ned Ui MAC YuLoe Rey ator) 199

7p 1 1 038 Colias tanianens a ie Pay olM CafadarNWt Schulte take eepies Lane

o meadii In the genomic trees (Fig. 3, Lye Callas Johansen TFT Ped F|Canado Northwast Territories| 1988

Ithough with low su ort) including the - ee eer siaiaosoro7 EFieiesnadaral ‘alberta|priar to 4885]FMNH

a g Pp a g a . a Sul tea ae Ca me eae eae eres ra fen

~ a a

tree constructed from Z chromosome- : Colee monies s03sF12 ae anaemia se dec Mtns. Jasper Ph|1986

t : of = molids Pea eS eC eae Le Re adaiAB Prospect Mountain mo

. — A 6

encoded genes. The identity of the C. elis Golias meadilembiensial 19063 me WY Park cor] 2607

ialebia- supecHeds by «A Piige | iNet a aeeeateerenee paneer ee

Clade 1S SUppO ec iy Cc sequence OF 1s Collas meadil ress ea ru 4:CO,Clear Creek Co.,Loveland Pass|2016

Syntype from the Field Museum National Sanaa eer iumech i Ladeaaoe| veh ALCO Route Co) Mul Pass|1998

? YP - Eglas gigantea mM ay 2744004 Co ge aneCe ape eee eland P 20

: : : a a ee

History collection (Fig. 3). Furthermore, C. — Callas occid fentals ouanseeltsltia CA, Colita Co, ae Camp|2017

elis and C. meadii show genetic differences om Colas alexandra apache aap Oe

Collas vitabundal|1so04 IFlCan ye 016

that are larger than a number of other on “Colas er hylel S421 MUSA: eet Co. SUSE Nona Park|2017

@ li S ecies airs e C li ri h ] W — cole durytheme|6530/F (Usa, cane ea wc Bas" SSE Florissant|2016

ee Na at cm ra ae oe —oieleaci tte yBbes lees ag cal

Collas interior dornteldi|1 06281 1/MiU SA:MT Missoula Co, {1994

H. Edwards, 1876 (type locality Canada: i Coliag sh inneri[17114D BF IUSA “WY, Fremont C

whe 7 Colias behrii|18038A05|M|USA:CA,Mono Co, W008

British Columbia) and Colias eurytheme

Boisduval, 1852 (type locality USA:

California). Fst/Gmin statistics for the comparison of C. elis and C. meadii are 0.40/0.03, but those for C-

meadii meadii and C. meadii lemhiensis are 0.18/0.14 (can be used as a control of conspecific taxa).

Therefore, we reinstate Colias elis Strecker, 1885 as a species-level taxon.

Fig. 3. Colias elis (red), C meadii (blue) and others w/ patch (magenta).

Tetracharis Grote, 1898 is a valid subgenus that includes Anthocharis cethura C.

Felder & R. Felder, 1865 (Miiller, 1764), Anthocharis midea (Hiibner, [1809]), and

Anthocharis limonea (A. Butler, 1871)

The genomic tree of representative species of Anthocharis Boisduval, Rambur, [Duménil] & Graslin,

[1833] (type species Papilio cardamines Linnaeus, 1758) including all type species of available genus-

group names considered subgenera or junior subjective synonyms of Anthocharis revealed an unexpected

but highly confident clade consisting of Anthocharis cethura C. & R. Felder, 1865 (type locality USA:

California, Los Angeles Co.), Anthocharis sadinthocharis sara sara[5638|USA:CA,San Diego Co.

: . é ; au Enea ane sulla. a aS CQ, Peele ey a

midea (Hiibner, [1809]) (type locality USA: aAnthocharis. igncealata ianosolata|PACGSIUSA, :CA,Sierra Co.

Georgia, Wilmington Island) and Anthocharis ee ee

limonea (A. Butler, 1871) (type locality anthecharis Himoriea]2949[Me icon Mewes Go me

M 1 Fi 4 d Th ] d 1 : Bi aenerieecel hnus| 190 ia bapan Korea

exico) (Fig. red). e clade is puchion tagisiis0 39HO6lSpain

sonides Epler Ae ala B rae |on. CO,Grand Co,

unexpected, because currently A. cethura is etichloe lottalPAOs9 11USAINV Elk

placed in the subgenus Anthocharis, while the Fig. 4. Subgenera Anthocharis (blue), Tetracharis (red)

other two species are placed in the subgenus and Paramidea (green) with Euchloe as outgroups.

Paramidea Kuznetsov, 1929 (type species: Anthocharis scolymus Butler, 1866). Curiously, neither of

these species in the red clade are monophyletic with the type species of subgenera they are currently

assigned to: A. (Anthocharis) cardamines 1s in the blue clade (Fig. 4) and A. (Paramidea) scolymus 1s in

the green clade. Therefore, the current classification is incorrect. Out of genus-group names that are

available for the red clade, Tetracharis Grote, 1898 (type species Anthocharis cethura C. & R. Felder,

1865) is older than Falcapica Klots, 1930 (type species Papilio genutia Fabricius, 1793, which is a junior

homonym of Papilio genutia Cramer, 1779, the oldest available name for this species is Mancipium

midea Hiibner, [1809]). As a result, we treat Tetracharis as a valid subgenus, new status, that includes

three species: A. cethura, A. midea, and A. limonea, making Falcapica its junior subjective synonym.

Anthocharis lanceolata Lucas, 1852 belongs to subgenus Anthocharis Boisduval,

Rambur, |[Duménil] & Graslin, [1833] instead of Paramidea Kuznetsov, 1929

Our genome-level phylogeny strongly supports the placement of Anthocharis lanceolata Lucas, 1852

(type locality "Californie") as sister to the Anthocharis sara Lucas, 1852 (type locality "Californie")

Species group, which belongs to the subgenus Anthocharis Boisduval, Rambur, [Duménil] & Graslin,

[1833] (type species Papilio cardamines Linnaeus, 1758) (Fig. 4, blue). The A. sara group taken together

with A. /anceolata is sister to the subgenus Jetracharis (type species Anthocharis cethura C. & R. Felder,

1865) and thus is not monophyletic with Anthocharis scolymus Butler, 1866, the type species of

Paramidea Kuznetsov, 1929. In other words, Paramidea Kuznetsov, 1929 is sister to a clade formed by

subgenera Anthocharis and Tetracharis. Therefore, A. lanceolata does not belong to Paramidea, but

instead is in the subgenus Anthocharis. Apparently, the falcate shape of the forewing vs. rounded

forewing apex is not a character that indicates phylogenetic groupings within the genus Anthocharis and

has originated more than once.

Family Lycaenidae [Leach], [1815]

Tharsalea Scudder, 1876, Helleia Verity, 1943, Apangea Zhdanko, 1995 and

Boldenaria Zhdanko, 1995 are genera distinct from Lycaena [Fabricius], 1807

Discovering non-monophyly of Lycaena [Fabricius], 1807 (type species Papilio phlaeas Linnaeus, 1760)

in a pioneering DNA-based phylogenetic analysis (van Dorp 2004) but stopping short of imminent

taxonomic lumps or splits, de Jong and van Dorp (2006) concluded: "we propose that first the

interrelationships as suggested by the present study are confirmed by further genetic markers." We

accepted this challenge and used not some further markers, but all protein-coding genes in 34 Lycaeninae

Species, including the type species of 22 out of 28 available genus-group names (two of which share valid

name of the type species with another genus-group name). The results confirm that Lycaena is not

monophyletic (Fig. 5). Notably, Jophanus Draudt, 1920 (type and the only species Chrysophanus (’?)

pyrrhias Godman & Salvin, 1887) originates within Lycaena and is sister to most other American species

with strong support. This placement is unexpected due to the prominent phenotypic similarities between

Iophanus and Melanolycaena Sibatani, 1974 (type species Melanolycaena altimontana Sibatani, 1974).

Even using genitalic morphology, /ophanus

pyrrhias (type locality Guatemala) was

associated with the (largely) Palearctic clade

(Fig. 5 blue) by Klots (1936) who wrote:

‘pyrrhias ... relation-ship is undoubtedly with

the Palaearctic rather than with the Nearctic

series, and is possibly rather ancient." As the

genomic tree suggests, Klots was incorrect on

both counts: /. pyrrhias is a relatively recent

offshoot of the (largely) Nearctic clade (Fig. 5

red). To the contrary, Melanolycaena is sister

to Lycaena boldenarum White, 1862 (type

locality New Zealand) and they form a clade

that is sister to all other Lycaeninae we have

Lycaena boldenarum|19079D11|New Zealand|1979

Melee saan altimontana|19079E02|Papua New Guineal|1973

Heliophorus senal190/79E03|Pakistan|1976

Heliophorus epicles|19079D12|Malaysia:Pahang|1991

Heliophorus yunnani|19079E05|China:Yunnan|1996

, Heliophorus gloria] 19079E01|Myanmar: racimllaae

Heliophorus tamu 19079E04|Himalayalold

Lycaena pang|19093B812|China:Sichuan|i902

Lycaena helle|19079D10|Russia:Siberia,Sayan Mountains|1970

, Lycaena phlaeas ursadental17115HO5|USA: WY, Park Co.J1997

1 yeaena phlaeas Sal ts a insist ag

p98 Lycaena alciphron|19093B11|Ukraine,Kiev|1969

Lycaena cupreus lapidicola|PAQ475|USA: C4,Mono Co,|2017

Lycaena aoelides|17066G09|PT|Tajikistan| 199g|

Lycaena thersamon|19079D07 |Tajikistan:Pamir|1988

7 Lycaena tityrus|PAOEO2|France|2017

Lycaena virgaureae|PAOEDS|Switzerland|2017

Lycaena dispar|19079D006|Ukraine,Kiev|1967

Iophanus pyrrhias| 17066G11|Guatemalal 1967

Lycaena caspius|19079E06|Iran,Schakuh|old

Lycaena hermes|6685|US54:C4,San Diego Co,|2011

Lycaena arota virginiansis|PAO449|USA: cA, ae Co,|2017

2 Lycaena rubidus|P40126|US4:WY,Laramie Co, |201

o4¥caena xanthoides|17114D11|USA: CA,Santa piers Co,|2007

PEycaena editha|PAO60|US4:C4,Sierra Co, |2016

Lycaena ae esa SA: T%, Paneetl Ca, aaaee

Lycaena hyllus|P&O286|(US54:C0,4dams Co,|2016

, Lycaena hareronaa|fa4q/Use: WY, Park Co.|2017

Lycaena gorgon gorgon|P40346|USA:CA,Santa Cruz ae |2017

0.94-, Lycaena nivalis browni/6459|US5A4:CO, Grand Co,J2016

‘Lycaena epixanthe epixanthe|6686| Canada: Quebec|2011

Lycaena mariposa penroseae|9440(USA:WY,Park Co,|2017

sequenced, including Heliophorus Geyer,

Lycaena helloides|19077B11/US4:C4,5an Benito Co. ji991

1 ; 1 iy = d F114b12/¢ dat B k|1983

[1832] (type species Heliophorus belenus olgieaena dospassosil17114012|Canada:New Brunswick|1

Geyer, [1832], considered to be a junior Fig. 5. Lycaena (blue), Tharsalea (red), Jophanus (green), Helleia

subjective synonym of Polyommatus epicles | (magenta), Apangea, (cyan), Melanolycaena (purple), Heliophorus

Godart, [1824]). Thus, we were impressed by (orange-brown) and Boldenaria (black).

the intuition of Sibatani (1974) who stated in the last sentence of his work: "the possibility is not

completely ruled out that the New Guinean Melanolycaena and the coppers of New Zealand are

monphyletic [sic!]." Indeed, Melanolycaena 1s sister to Boldenaria Zhdanko, 1995 (type species Lycaena

boldenarum White, 1862) from New Zealand (Fig. 5), despite phenotypic dissimilarities. For these

reasons, genomic phylogeny implies that the division of Lycaeninae into two sections (Lycaena and

Heliophorus) as suggested by Eliot (1973) was indeed tentative and needs to be revised because these

sections are not monophyletic.

Here, armed with genomic data for ~80% of the available genus-group names, we attempt such a

revision. One solution to restore monophyly is to treat the whole subfamily as a single genus Lycaena that

subsumes Melanolycaena and Heliophorus among others. This super-lumping solution may be in

agreement with relatively low genetic diversification among all these species. Indeed, Lycaeninae

experienced some of the slowest evolutionary rates among Lycaenidae as revealed by relatively shorter

branches within the Lycaeninae clade compared to others (Zhang et al. 2019d). The difference in COI

barcodes between distantly related Lycaeninae species ranges from about only 5% (35 bp, L. boldenarum

and L. phlaeas, a difference common for closely related congeners) to about 8% (53 bp, Heliophorus sena

Kollar, 1844 and Lycaena pang Oberthiir, 1886, a difference typical for distantly related congeners). This

high similarity in COI underscores the idea that it is meaningless to impose a strict cutoff on divergence

values due to the differences in evolutionary rates in different lineages. However, even American species

of Lycaena are estimated to have diverged over 20 million years ago (Zhang et al. 2019d), which is larger

than for a typical diverse genus; 1.e., it is larger than the divergence between Anthocharis and Euchloe

Hiibner, [1819] (Pieridae) and about the same as between Vanessa [Fabricius], 1807 and Nymphalis Kluk,

1780 (Nymphalidae). Furthermore, Heliophorus has been traditionally maintained as a genus-level taxon.

Therefore, we reject the super-lumping solution of a monotypic subfamily Lycaeninae.

The opposite extreme would be to find a meaningful level closest to the leaves of the tree that defines

genera. Ideally, there would be situations in the tree where many lineages diverge at about the same level

(i.e. at the same distance from the root, meaning at about the same time in the past) and then stay as single

lineages for some time (i.e. form longer branches). This rapid diversification immediately followed by a

relative lack of further diversification creates a level in the classification, i.e. the tree looks more like a

bush or a comb than a bifurcating tree at that point. Taking the (largely) Nearctic group (Fig. 5 red), we

see exactly this situation: at its base, this group diversifies into five prominent clades, and then two of

these clades diversify further, also at approximately the same time point in the past. These five clades

form a level in the tree and can be used as genera, offering the splitting solution. Notably, every one of

these clades already has a genus-group name (Pelham 2008), including Palearctic Hyrcanana Bethune-

Baker, 1914 (type species Polyommatus caspius Lederer, 1870). Apparently, these clades were also

obvious from phenotypes: that is how they were defined and named to begin with (Scudder 1876; Klots

1936; Miller and Brown 1979). This level of classification can be propagated to other parts of the tree,

although they are currently poorly covered by species. It is a meaningful level that can be chosen to define

genera, but a significant number of such genera will be monotypic (e.g. two out of five in the Nearctic

clade), and excepting knowledgeable aficionados of this group, such genera carry little information about

their interrelationships. Hence, we looked for a compromise between the splitting and lumping solutions.

Inspection of the tree reveals a rapid diversification point between its root and the diversification of

the red clade (Fig. 5): i.e. orange-brown, cyan, magenta, blue and red + green clades diverged at

approximately the same time in the past. This divergence is followed by the lack of immediate further

divergence, creating long and prominent branches in the tree and resulting in a meaningful level for

classification. We have chosen to take this intermediate level to suggest division of Lycaeninae into

genera. Most of these genera are unambiguously apparent from the tree: black, purple, orange-brown,

cyan, magenta, blue and red clades stand for seven genera, all of which have previously proposed names.

Two instances require further elaboration. First, Heliophorus sena (Kollar, [1844]) stands out from the

rest in the genus (Fig. 5 orange). The type species of subgenus Nesa Zhdanko, 1995, it may be a genus-

level taxon. However, it is monophyletic with Heliophorus and we leave it there as a subgenus to

emphasize this relationship, awaiting further studies. Second, Jophanus (Fig. 5 green) is at about the same

divergence from the rest of Nearctic species (Fig. 5 red) as H. sena from other Heliophorus. For now, we

decided to keep this monotypic genus, because it is currently treated as such, and because its earlier

divergence time sets it apart from the rapid diversification of the red clade. The name for the red clade is

Tharsalea Scudder, 1876 (type species Polyommatus arota Boisduval, 1852), as chosen by Klots (1936),

probably because this name was proposed before others in the paper (Scudder 1876).

In summary, we refrain from partitioning Lycaeninae into tribes and revise the status of the

following names treating them as genera: Tharsalea Scudder, 1876, Helleia Verity, 1943 (type species

Papilio helle Denis & Schiffermiiller, 1775), Apangea Zhdanko, 1995 (type species Chrysophanus pang

Oberthiir, 1886) and Boldenaria Zhdanko, 1995. Furthermore, in agreement with previous studies

(Sibatani 1974; van Dorp 2004; de Jong and van Dorp 2006), we conclude that the endemic South African

Species currently placed in Lycaena represent the 9th genus of Lycaeninae that is named next. We are

looking forward to testing this hypothesis with genomic data.

Lafron Grishin, new genus

http://zoobank.org/ODB9D8C5-E666-46A3-822B-50E96448C82A

Type species. Papilio orus Stoll, [1780].

Definition. In male genitalia (Fig. 2 in de Jong and van Dorp 2006), differs from others in the subfamily

Lycaeninae, except Melanolycaena, by a saccus-like pouch on juxta (Sibatani 1974); separated from

Melanolycaena (Fig. 4 in Sibatani 1974) by juxta connected to valva at its more ventral part, as in other

Lycaena. In wing patterns and shape, resembles a sympatric hairstreak Chrysoritis lycegenes (Trimen,

1874) (possible mimicry), i.e. wings are more rounded than most Lycaena and forewing black spots are

closer to the margin, hindwing without tails and patterned more similar to Polyommatinae than to most

Lycaena: pale-brown with darker marginal Iunules and with paler spots usually darker in the middle.

Etymology. The name is a masculine noun in the nominative singular, formed as L[ycaen|a + [A|fr[ica] +

on to indicate African origin of the genus and reach gender agreement with the type species name.

Species included. The type species and Lycaena clarki Dickson, 1971, both from South Africa.

Parent taxon. Subfamily Lycaeninae |Leach], [1815].

Lycaeninae genera, subgenera and their available synonyms

Here, we update the Appendix of Sibatani (1974) and suggest the following treatment of Lycaeninae

grouped into nine genera. Placements of Lafron Grishin, gen. n. and Phoenicurusia Verity, 1943 are

provisional due to the lack of both genomic data and unambiguous phenotypic evidence, and follow

published works based on morphology and limited DNA analysis (Klots 1936; Sibatani 1974; van Dorp

2004; de Jong and van Dorp 2006). The list is preliminary and further changes are expected in groups

poorly covered by our genome-based phylogeny. Junior subjective synonyms are preceded by "=".

Unavailable names are not listed. Type species are given in parenthesis with their original genus name.

Genus Lafron Grishin, gen. n. (Papilio orus Stoll, [1780])

Genus Lycaena [Fabricius], 1807 (Papilio phlaeas Linnaeus, 1760)

Subgenus Lycaena [Fabricius], 1807 (Papilio phlaeas Linnaeus, 1760)

Subgenus Thersamolycaena Verity, 1957 (Papilio dispar Haworth, 1802)

Subgenus Heodes Dalman, 1816 (Papilio virgaureae Linnaeus, 1758)

=Loweia Tutt, 1906 (Papilio dorilis Hufnagel, 1766)

=Thersamonia Verity, 1919 (Papilio thersamon Esper, 1784)

=Palaeochrysophanus Verity, 1943 (Papilio hippothoe Linnaeus, 1760)

=Alciphronia Kocak, 1992 (Papilio alciphron Rottemburg, 1775)

=Mirzakhania Kogak, 1996 (Chrysophanus kasyapa F. Moore, 1865)

Genus Helleia Verity, 1943 (Papilio helle Denis & Schiffermuller, 1775)

Genus Tharsalea Scudder, 1876 (Polyommatus arota Boisduval, 1852)

Subgenus Epidemia Scudder, 1876 (Polyommatus epixanthe Boisduval & Le Conte, [1835])

=Hyllolycaena L. Miller & F. Brown, 1979 (Papilio hyllus Cramer, 1775)

=Hellolycaena Kocak, 1983 (=Polyommatus thoe Guérin-Méneville, [1832], which is Papilio hyllus Cramer, 1775)

Subgenus Chalceria Scudder, 1876 (Chrysophanus rubidus Behr, 1866)

=Gaeides Scudder, 1876 (Chrysophanus dione Scudder, 1868)

Subgenus T7harsalea Scudder, 1876 (Polyommatus arota Boisduval, 1852)

Subgenus Hermelycaena L. Miller & F. Brown, 1979 (Chrysophanus hermes W. H. Edwards, 1870)

Subgenus Hyrcanana Bethune-Baker, 1914 (Polyommatus caspius Lederer, 1870)

=Sarthusia Verity, 1943 (Polyommatus sarthus Staudinger, 1866)

Subgenus Phoenicurusia Verity, 1943 (Polyommatus phoenicurus var. margelanica Staudinger, 1881)

=Athamanthia Zhdanko, 1983; (Polyommatus athamantis Eversmann, 1854)

Genus Iophanus Draudt, 1920 (Chrysophanus (?) pyrrhias Godman & Salvin, 1887)

Genus Heliophorus Geyer, [1832] (=H. belenus Geyer, [1832], which is Polvommatus epicles Godart, [1824])

Subgenus Heliophorus Geyer, [1832] (=H. belenus Geyer, [1832], which is Polyvommatus epicles Godart, [1824])

=llerda E. Doubleday, 1847 (Polyommatus epicles Godart, [1824])

=Kulua Zhdanko, 1995 (Polyommatus tamu Kollar, 1844)

Subgenus Nesa Zhdanko, 1995 (Polyommatus sena Kollar, 1844) [not a homonym! Nesa Leach, 1818 is a misspelling]

Genus Apangea Zhdanko, 1995 (Chrysophanus pang Oberthtr, 1886)

Genus Melanolycaena Sibatani, 1974 (Melanolycaena altimontana Sibatani, 1974)

Genus Boldenaria Zhdanko, 1995 (Lycaena boldenarum White, 1862)

Habrodais Scudder, 1876, Favonius Sibatani & Ito, 1942, Neozephyrus Sibatani & Ito,

1942, Quercusia Verity, 1943, Chrysozephyrus Shirézu & Yamamoto, 1956, and

Sibataniozephyrus Inomata, 1986 are junior subjective synonyms

of Hypaurotis Scudder, 1876

Inspecting genomic phylogenetic trees of US butterfly species (Zhang et al. 2019d), we noticed a close

relationship between the only two New World genera from the tribe Theclini Swainson, 1830: Hypaurotis

Scudder, 1876 (type species Thecla crysalus W. H. Edwards, 1873) and Habrodais Scudder, 1876 (type

species Thecla grunus Boisduval, 1852). Despite dissimilar wing patterns and colors, divergence between

the type species of these genera is indeed comparable to that of congeners (Fig. 6 top) and is even lower

than the divergence in some compact genera, such as Chlorostrymon Clench, 1961, Ministrymon Clench,

1961 or Electrostrymon Clench, 1961 (Fig. 6 top), and particularly in more diverse genera such as

Strymon Hubner, 1818, Callophrys Billberg, 1820, or Satyrium Scudder, 1876 (Zhang et al. 2019d). COI

barcodes of Hy. crysalus and Ha. grunus are only 4.3% (28 bp) different: divergence similar to that at

times reported for different individuals of

the same species (Zakharov et al. 2009;

Kodandaramaiah et al. 2013), strongly

suggesting that these two species are

congeneric. The combination Hypaurotis

grunus has been used previously in

publications (Garth 1934), however, we

failed to find the combination Habrodais

crysalus published. Also, H. crysalus has

a slightly broader distribution and is a

more familiar butterfly. Therefore, among

the two names published in the same work

(Scudder 1876), we use Hypaurotis as

Hy¥paurotis crysalus|17117405|(USA:CO, Douglas Co,.J1993

Habrodais grunus|PAO466/US4:c4 Plumas Co,|2017

Favonius (=Quercusia) quercus|200354)

Chlorastrymon simaethis sarital5161|USA x, Starr Co, 12015

,chlorostrymon maesites|18033F11|USA: Fi Monroe oo |2014

Chlorastrymon feins|tp608 Meco ;Tamatlipas| 197

Ministrymon azia|17119F07|US4:FL,Broward Ca, Coral peringe) tae2

119F06|Mexico: Sonorali9

in =a|10610/USA:TX,Culberson Co, fsa”

Ministrymon SMe eee Were aes Cameron Co (2015

Electrastrymoan aoe ee 5G0 4/USA:FL, Miami-Dade Co, j1982

, Electrostrymon hugon|15115F02|Belize: Cayo 2003

Electrostrymon ioval15115FO7IPanama.Canal Zoneli979

al France: Var|20

BeBe urate eyeeiel eal SA:ca polug)as Ea:

sozephyrus smaragdinus|GU372

Hebrodais grunus|PA Peace AAP ee Co:

Neozephyrus Japonicu ae

Fav ees onlentalis[4B19

Fayo Ug I= Q Quercusia) que 035404|France

Sibataniozep rus Tu isanusl

Thecla Betul 14540

aelM

Fig. 6. Hypaurotis, Habrodais and others. Nuclear genome tree above,

COI barcode dendrogram below. Specimens without locality given are

from GenBank and their accession numbers are indicated.

valid, and Habrodais as its junior subjective synonym, resulting in Hypaurotis grunus (Boisduval, 1852)

and Hypaurotis poodiae J. Brown & Faulkner, 1982, revised and new combinations.

Next, when a genomic dataset of an Old World species Favonius quercus (Linnaeus, 1758) was

included in the Theclinae tree, it clustered closely with Hypaurotis (Fig. 6 top). The COI barcodes of H.

crysalus and F. quercus differ by 4.7% (31 bp). Because we lack genomic data for other genus-group

names from the Thecla section of Eliot (Eliot 1973), we downloaded available COI barcode data from

GenBank (Sayers et al. 2020). We find that while for most species pairs, e. g., H. crysalus and Favonius

orientalis (Murray, 1875), the barcodes are more similar (6%), for others, e. g., H. crysalus and Thecla

betulae (Linnaeus, 1758) (the type species of Thecla Fabricius, 1807) the difference is larger (8.2%). The

COI barcode distance dendrogram computed using BioNJ (Gascuel 1997) as implemented by the

phylogeny.fr server (Dereeper et al. 2008) reveals close clustering of species we propose to place in

Hypaurotis (Fig. 6 bottom, red) and separation of 7. betulae (green) from this cluster. In the absence of

genomic data, this COI barcode analysis of their type species suggest that in addition to Habrodais

Scudder, 1876 and Quercusia Verity, 1943 (type species Papilio quercus Linnaeus, 1758), the following

four genus-group names Sibataniozephyrus Inomata, 1986 (type species Zephyrus fujisanus Matsumura,

1910), Neozephyrus Sibatani & Ito, 1942 (type species given as Thecla taxila Bremer, 1861, which was,

however, a misidentified Dipsas japonica Murray, 1875; according to the Art 70.3.2. of the ICZN Code

the actual taxonomic identity of this species is chosen and japonica is fixed as type species),

Chrysozephyrus Shirézu & Yamamoto, 1956 (type species Thecla smaragdina Bremer, 1861) and

Favonius Sibatani & Ito, 1942 (type species Dipsas orientalis Murray, 1875) are junior subjective

synonyms of Hypaurotis Scudder, 1876, which is a genus distinct from Thecla Fabricius, 1807. In accord

with genetic similarities, all these species are similar in appearance (Eliot 1973). We expect that future

studies will reveal additional synonyms and possibly a subgeneric structure of Hypaurotis.

Finally, even from a practical standpoint of American butterfly knowledge, it seems more instructive

to treat H. crysalus and H. grunus as congeneric emphasizing on their close kinship (despite apparent

phenotypic dissimilarity), instead of placing them in two monotypic (or nearly monotypic) genera that

accentuate their tenuous (but superficial) uniqueness. Finding their close relatives in the Old World places

Hypaurotis among other Holarctic Theclinae genera such as Callophrys and Satyrium and emphasizes

somewhat unusual but recurrent pattern revealing the connection between the Old and the New Worlds.

Family Riodinidae Grote, 1895

Plesioarida Trujano & Garcia, 2018 is a

junior subjective synonym of Roeberella Strand, 1932

Plesioarida Trujano & Garcia, 2018 (type species Apodemia walkeri Godman & Salvin, 1886) was described

as a genus (Trujano-Ortega et al. 2018) and was treated as a subgenus of Apodemia C. Felder & R. Felder,

1865 (type species Lemonias

mormo C. Felder & R. Felder,

1859) by Zhang et al. (2019e) to

present a more internally consistent

classification of the tribe Emesidini

Seraphim, Freitas & Kaminski,

2018. Continuing with the genomic

sequencing of Riodinidae, we were

surprised to find that a syntype of

the type species of the genus

Roeberella Strand, 1932, Le.,

Lemonias calvus Staudinger, 1887

(type locality Peru: Chanchamayo),

was in the same clade with 2.

walkeri (type locality Mexico:

Guerrero), rendering Plesioarida

paraphyletic in all three trees that

we routinely construct (Fig. 7).

Statistical support for _ the

placement of Roeberella_ calvus

within the subgenus Plesioarida as

sister to both A. walkeri and

Apodemia hepburni (Godman &

Salvin, 1886) (type — locality

A. h. hypoglauca

2 NVG-18048C11

NVG-18048C10

nuclear genome

Roeberella calvus|18054E06|ST|M|Peru,chanchamayol|prior to 1887|ZMHB

Apodemia walkeri|4514|M|USA:TX Hidalgo Co.|2015

Apodemia hepburni hepburni|17066E05|/Mexico:Sonora|2003

Apodemia palmerii arizona|10226|USA:A27,Pima Co.|2017

Apodemia murphyi|17066006|M|Mexico:Baja California Sur|2004

Apodemia hypoglauca hypoglauca|18048C11|M|Costa Rica: Guanacaste|1973

Apodemia ares|17114H01 De ceeae Co,,Pine Canyon|1991

podemia arnacis|18045F11|M|Mexico:Gaxaca|1990

Apodemia zela Pee cl ieaeatawen Cruz Co.,Coronado N.F.|2017

Apodemia chisosensis|154|F|USA:TX,Brewster Co.,Big Bend National Park|2004

Apodemia nais|P40145|/U54:C0,Gilpin Co.,Golden Gate Canyon S. P.|2016

Apodemia multiplaga|7635|F|USA:TX,Cameron Co, ,Brownsville|1974

Apodemia virgulti virgulti|15105E04|NT|M|USA:CA,Los Angeles Co.[1951|/CAS

Apodemia mormo mormo|17107E02|M|USA:WA,Kittitas Co.|1990

24 Apodemia mejicanus mejicanus|13383BrockC10|F|USA:AZ Santa Cruz Co./1990

“Apodemia duryi] 7O0|M|USA4&:TX Brewster Co,,Big Bend National Park|2009

Z chromosome Roeberella calvus|18054E06|ST|M|Peru,chanchamayolprior to 1887|ZMHB

Apodemia walkeri[/4514|M|USA:TX Hidalgo Co,[2015

Apodemia hepburni hep urnil 17066605 |Mexico:Sonora|2003

; Apodemia palmerii arizonal10226|USA:AZ,Pima Co,|2017

Apodemia murphyi|17066006|M|Mexico:Baja California Sur|2004

- Apodemia hypoglauca hypoglauca|18048C11|M|Costa Rica:Guanacaste|1973

Apodemia ares|17114H01 a reece Co,,Pine Canyon|1991

Apodemia arnacis|18045F11|M|Mexico:Oaxacal|1990

Apodemia zela cleis|B217|FIUSA:AZ Santa Cruz Co.,Coronado N.F.|2017

Apodemia chisosensis|154|F|USA:TX,Brewster Co.,Big Bend National Park|2004

Apodemia nais|P40145|US54:C0,Gilpin Co,,Golden Gate Canyon S. P.|2016

Apodemia multiplagal7635|[F|USA:TX,Cameron Co,,Brownsville|1974

Apodemia virgulti virgulti|15105E04|NT|M|USA4:CA,Los Angeles Co.|1951/CAS

Apodemia mormo mormo|17107E02|M|USA:WA,Kittitas Co.|1990

= Anodemia mejicanus mejicanus|13383BrockC10|F|USA:AzZ,Santa Cruz Co,|1990

0.01 “Apodemia duryi/7O0|M|USA:TX,Brewster Co.,Big Bend National Park|2009

mitochondrial genome

Roeberella calvus|18054E06|ST|M|Peru,chanchamayol|prior to 1887|ZMHB

Apodemia walkeri|4514|M|USA:TX Hidalgo Co.|2015

Apodemia Dea haraete ines Wiemann Cece ear

Apodemia palmeril arizona|10226|USA:47 Pima Co.|2017

Apodemia murphyi|17066006|M|Mexico:Baja California Sur|2004

4podemia hypoglauca hypoglaucal18048C11|M|Costa Rica: Guanacaste|1973

Apodemia ares|17114H01|/M|USA:NM,Hidalgo Co.,Pine Canyon|1991

Apodemia arnacis|18045F11 M|Mexico:Oaxaca/1990

Apodemia zela cleis|8217|FIUSA‘AZ Santa Cruz Co.,Coronado N.F.|2017

Apodemia chisosensis|154|F|USA:TX,Brewster Co.,Big Bend National Park|2004

Apodemia nais|P40145|/US4:C0,Gilpin Co. ,Golden Gate Canyon S. P.|2016

Bera Mta eee carck Co,,Brownsville| 1974

Te Sbodemia virgulti virgulti|1S5105E04|NT|M|USA:CA,Los Angeles Co,|1951/CAS

Apodemia mormo mormo|17107E02|M|USA:WA,Kittitas Co,|1990

Apodemia mejicanus mejicanus|13383BrockC 10(F|USA:AZ Santa Cruz Co./1990

Apodemia duryi|700|M|USA:TX Brewster Co,,Big Bend National Park|2009

Fig. 7. Subgenus Roeberella (red), and other Apodemia (blue).

A. (Roeberella, =Plesioarida) calvus

A. walkeri

On | syntype;

type species

NVG-18048D04

NVG-18054E06

Fig. 8. Previously unnoticed but apparent phenotypic similarity between Roeberella calvus (c, syntype and the type species

of Roeberella, Peru: Chanchamayo, NVG-18054E06 in ZMHB, here placed in Apodemia), and representative species of the

subgenus Plesioarida (here synonymized with Roeberella): Apodemia walkeri (d, the type species of Plesioarida, Mexico:

Morelos, NVG-18048D04 in USNM) and Apodemia hypoglauca (a, Costa Rica, NVG-18048C11; b, Mexico: Morelos,

NVG-18048C10 both in USNM). Dorsal above, ventral below. This similarity was uncovered by genomic analysis.

Mexico: Chihuahua) is strong in the protein coding regions of the entire nuclear genome, Z-chromosome

and mitochondrial genome: 100% of all segment trees contained the clade of these three species. Such a

result was unexpected, because the type species of Roeberella (South American) was not previously

compared with Apodemia (North American), and we suspected a possibility of error or contamination.

However, COI barcodes of R. calvus and A. walkeri differ by only 5.2% (34 base pairs), a difference

smaller than that between 4. walkeri and A. mormo (8.5%, 56 bp). Moreover, R. calvus is phenotypically

similar to Plesioarida species (Fig. 8) and shares a falcate forewing with Apodemia hypoglauca (Godman &

Salvin, 1878) (type locality "Mexico"). The similarities are most prominent in the ventral wing pattern (Fig.

8bc bottom). Interestingly, the wing shape of R. calvus appears more like that of female Plesioarida (Fig.

8b). Dorsally, R. calvus reminds us of an aberrant Plesioarida. Therefore, due to genetic and phenotypic

similarities, we conclude that Plesioarida syn. n. is a junior subjective synonym of Roeberella, and

consequently we place Roeberella as a subgenus (new status) of Apodemia.

We think this find is particularly interesting for several reasons. First, it extends the range of

Apodemia, previously not recorded from South America, to Peru, with all evolutionary and

biogeographical implications of this fact. Second, it underscores the importance of a more comprehensive

phylogenetic analysis before proposing new genus-group names to avoid creation of unnecessary

synonyms (Trujano-Ortega et al. 2018; Trujano-Ortega et al. 2020). Third, it reiterates the power of

genomic approaches and the value of the type concept, both in species and genus-group names.

Sequencing of the syntype of the type species of the genus-group name Roeberella solidifies our

conclusions, eliminating a possibility of misidentification or incorrect inference from a non-type species.

Lemonias lencates Hewitson, 1875 currently placed in Roeberella Strand, 1932

belongs to Pachythone H. Bates, 1868

Genomic sequencing of a specimen of Roeberella lencates (Hewitson, 1875) (type locality not given,

species recorded from Costa Rica to Brazil) and comparisons among the type species of available genus-

group names reveal that R. /encates (Fig. 9, red) is not monophyletic with the type species of Roeberella

Strand, 1932 (Lemonias calvus Staudinger, 1887, type locality Peru: Chanchamayo, a syntype sequenced,

Fig. 9, magenta), but instead belongs to Pachythone erebia peal tal Da a rd eel hde r]2015

. negate strati (=corculum) {Pixus}|19031409|Panamal1981

Pachythone H. Bates, 1868 (type species ’ acy au eee obs, persed See :Grol1977

Pachythone erebia Bates, 1868) (Fig. 9,

blue). The tree includes the type species of

elle menander {Men

all available genus-group names in z ee tg

a ta ey a j aye aaa Emesis tenedia {Tenedia iBo44Hioe Costa Rical2010

Emesidini placed among other Riodinidae 32 ——_Emasis brimo brimo {Brimia}|18045E01 Costa Rica|2008

i ‘i : SO ene se Eee ae 09|Guyana|19

(Fig. 9, taxa currently placed in Apodemia iL oe "Einesis posse (Posasia}|19044603)ho03 3[2000.

° pee Curvie emesia {Curvie}|5245 T

are in green font). Therefore, we transfer R. Roeberella calvus {Roaheralla) |ae0s420¢|st)Perulbetore 1887

. ; + Apodemia walker! {Plesioarida }|4514|USA:TX|201

lencates and a number of its close allies as Snademiamanna mayms fapodemia} 17 107607|USa.wal1990

p 1

Riodina lysippus imiodina| 19026H04|Ecuador|1988

Fig. 9. Emesidini and Pachythone among others. Genus-group names

each species is the type of are given in brackets.

suggested by their phenotypic similarities

from Roeberella to Pachythone, forming the

following new combinations: Pachythone

lencates (Hewitson, 1875), Pachythone flocculus (Brévignon & Gallard, 1993), Pachythone floccus

(Brévignon, 2013), Pachythone heberti (P. Jauffret & J. Jauffret, 2007) and Pachythone marajoara (P.

Jauffret & J. Jauffret, 2007). Furthermore, due to close clustering in the genomic tree (Fig. 9) comparable

to that within other genera (e.g., Periplacis Geyer, 1837 in addition to Emesis Fabricius, 1807 and

Apodemia) and phenotypic similarities in wing patterns (e.g., compare with Pachythone strati (Kaye,

1925) and Pachythone rubigo (H. Bates, 1868)), we suggest that Pseudonymphidia Callaghan, 1985 (type

species Emesis clearista Butler, 1871. Fig. 9, cyan) is a subgenus (new status) of Pachythone (Fig. 9, the

clade labeled with the name in red font highlighted in yellow).

Family Nymphalidae Rafinesque, 1815

Speyeria Scudder, 1872 is a subgenus of Argynnis Fabricius, 1807

A close relationship between the New World genus Speyeria Scudder, 1872 (type species Papilio idalia

Drury, 1773) and the Old World genus Argynnis Fabricius, 1807 (type species Papilio paphia Linnaeus

1758) has been suggested (Simonsen 2006; Simonsen et al. 2006). In these studies, Simonsen proposed to

treat Speyeria as a subgenus of pa Argynnis paphia|/PAOQE21|German Bavaria near Graswang|2017

, = Advan iaediet 190) 1c 04| Kora Sepad enor a3 Hae

Argynnis. Although this suggestion abs, nobel “ iiowitzenand Park ca BabeT 2017 Aeniaeny

. 1 eye 8

has been followed in a number of = oye se OLA ae eee 78 017

works (Wells et al. 2011; Scott and see iain al aaa NgArco Scsicurts Mie stay

. . eyera mormoania eurynome ar Qo Bow stone

Fisher 2014), it has not been magppeyena adiaste ent reece NP|2017

: ISpeyeria edwards si[FAG ory CI4d O16,

universally accepted (Pelham 2008; wipeiere sual 9 ae

Onyl

De Moya et al. 2017; Pelham eyeria z

Baan chee a oes eee amet: oe

eye espe ae

), likely due not to scientific see atlantis atlantis] Lehee = So O "ato ee Pel ce

but historical reasons. Several Bo Tet is{tZ SAWS eee co,| four a

generations of American naturalists FL Alcanada: Albe lal iateau Mtn.

were raised being accustomed to nee chariclea cage Ae Bsa ve Co 12003

& aA ot i Balin patarhat ee i Bat Northwest Torntories|1988

the name Speyeria and are less = olen tiga s Aos[usA: ay,c9:)1996,

familiar with the name Argynnis, E polonal ebithats Spitnare cA Si pisligg

thus being resistant to abandonin Boloria Helatiets dau (ese Pane igham £9 a oie

u & & , euptolsta hegesial3374/USA:TX aero een [2015

Speyer la aed se ens Dale: Our ee Fig. 10. Argynnis (blue) and its subgenus Speyeria (red).

nomic studies also support the view

that Speyeria should be considered a subgenus within Argynnis. The two groups are very close to each

other genetically (Fig. 10). The COI barcode difference between the type species of Speyeria and

Argynnis is 8.2%, and the estimated time of divergence is 9.1 Mya according to De Moya et al. (2017)

(Brenthis Hubner, [1819], which is sister to the clade that includes Argynnis and Speyeria diverged from

them 11.1 Mya), but likely about 7.5 Mya according to Chazot et al. (2019), who show that Brenthis

diverged from Argynnis at 9.2 Mya (9.1*9.2/11.1~7.5). This divergence is nearly the same as (or less

than) between the two species of Euptoieta E. Doubleday, 1848 (Fig. 10): COI barcode difference 8.8%,

estimated time of divergence about 8 Mya according to Zhang et al. (2019d). Moreover, Argynnis is also

quite close to Boloria Moore, 1900 (type species Papilio pales [Denis & Schiffermiller], 1775)

(estimated divergence 14.6 Mya (Chazot et al. 2019)), and they together form a more prominent group in

the phylogenetic tree than either of them does separately (Fig. 10). Thus, it is even conceivable to take the

next step and treat Boloria sensu lato as a subgenus of Argynnis. Currently we refrain from their

unification, because the genetic distance between Argynnis and Boloria is still within the limits possible

for distinct genera, and the pronounced phenotypic distinction between these two genera exists making

their visual recognition straightforward. However, butterfly classification would be more inconsistent if

Speyeria stays a genus distinct from Argynnis. Therefore, we agree with Simonsen et al. (2006) and place

Speyeria as a subgenus within Argynnis.

Argynnis irene Boisduval, 1869 and Argynnis nausicaa W. H. Edwards, 1874 are

Species distinct from Argynnis hesperis W. H. Edwards, 1864

Argynnis atlantis W. H. Edwards, 1862 (type locality USA: New York, Green Co., mostly eastern in

distribution) and Argynnis hesperis W. H. Edwards, 1864 (type locality USA: Colorado, Jefferson Co.,

mostly western in distribution) form a species complex that requires further investigation (Dunford 2009).

We obtained whole genome shotgun sequences for nearly all its taxa considered valid by Pelham (2020).

A number of these taxa were represented by their primary type specimens to ensure correct application of

their names (Fig. 11, indicated as HT for holotype and LT for lectotype). Because protein-coding regions

of species in the subgenus Speyeria are quite conserved in their sequences, in order to provide better

discrimination between taxa, we used all genomic sequences mapped to Argynnis (Speyeria) diana

Speyerta idalia So oe E aa TU USA: CO,Kit Carson Se tata Speyerta Idalia Se eee ea HEAT Kit Carson Co,|1987

Speyeria nokomis nitocris|18062B01]USA:NM,Catron Co,,Mogollon Mts.[1978 peyernia nokomis nitocris|18062B01| SA:NM,Catron Co.,Mogollon Mts.|1978

Speyeria diana|9Q190)USA:AR Polk Co,.Quachita National Forest|2017 Of Speretia Oe ea aes Polk Co.,Quachita National Forest|2017

Speyeria aphrodite ethne|/PAO220|USA:CO,Larimer Co.,2 miles NNE Virginia Dale|2016 Spar etia mormonia eurynome|93so|USA:WwYy,Park Co,,¥ellowstone National Park|2017

Speyeria edwardsii|P40218|US4:CO,Larimer Co,,2 miles NNE Virginia Dale|2016 Speyeria adiaste adiaste|19051HO9|USA:CA,Santa Cruz Co,,Saratoga Gap|1959

Speyeria adiaste adiaste| 1905 1H09/USA:CA,Santa Cruz Co,,Saratoga aaiaaia Speyeria hydaspe rhodope|9433/USA:WY,Park Co. Yellowstone National Park|2017

Speyerla hydaspe Te aaa USA:WY,Park Co. Yellowstone National Park[2017 Speyeria aphrodite ethne|PAO220|USA:CO,Larimer Co.[2016 |

Speyeria callippe|9516|USA:UT, Davis Co.,Wasatch NF[2017 : ent Speyeria Se ea Gl eee Clark Co.,Spring Mountains|1967

Speyeria eglels utahensis|9532|USA:UT,Davis Co.,Wasatch National Forest|2017 Speyeria coronis halcyone|P, 0143|USA:WY,Goshen o,,Lone Tree Canyon|2016

- Speyeria hesperis nausicaa|11627|USA4;AzZ,Greenlee Co,|2018 pe; Speyeria hesperis nausicaa|11629|USA:AZ,Greenlee Co,|2018

2 opeyeria hesperis nausicaa|11628|USA:A7,Greenlee Co,[2018 35 Speyeria hesperis nausicaa|11628|USA:AZ Greenlee Co.|2018

=" Speyeria hesperis PSUS ee Eee et ee alee oe Co,J2018 0.87 3 Speyeria hesperis Palaibee| | lped yee Greenlee este

2 Speyeria hesperis nausicaa|18037HO4|USA‘AZ Apache Ca,/2005 ; peyeria hesperis nausicaa|1803 HO4[USALAZ pache Co,/2005

peyerla hesperis capitanensis|19043G12|HT|USA:NM,Lincoln Cao.|before 1988 Speyerla hesperis capitanensis|19082G06|USA:NM,Otero Co,|198

Speyeria hesperis capitanensis|19082G06|USA:NM,Otero Ca.[1981 Speyeria hesperis Boro esta aa Wave Sandoval Co,|before 1947

= Speyeria hesperis schellbachi|19061C09|H [USA:AZ, Coconino Co.|1947 Speyeria hesperis schellbachi|19061C09| |USA:AZ,Coconino Co.|1947

pee?) «6S Peyeria hesperis electa|18037HOS|USA:CO,La Plata Co.,Rockwood Rd.|1983 Gees Speyeria hesperis electa|18037HO5|USA:CO,La Plata Co.,Rockwood Rd.|1983

: Speyerla hesperis electa|19083F10/US54:C0,Eagle Co,|1968 : peyeria hesperis elacta|19083F10/USA:CO,Eagle Co.,3 mi NE Basalt|1968

3 Speyeria hesperis tetonia (=wasatchia)|19044B10|HT|USA:UT,Utah yee 1945 5 Speyeria hesperis tetonia [ueaate Oa Tee UT Utah Co,|before 1945

Speyeria hydaspe rhodope (=conquista)|19043HOS|HT|locality unclear|before1945 : Speyeria hesperis tetonia|19044B08|HT|USA:WY,Teton €o,,Teton Mts. |before 1945

a peyeria hesperis greyiJ19044401 HT|USA:NV, Elko Co.,Ruby Mts. [before 1950 Speyeria hesperis greyi/19044401|/HT|USA:NYV,Elko Co.,Ruby Mts.|before 1950

a Speyerla hesperis greyiJ/19113G04|USA:NV,Elko Co,,Lamoille ee — Speyerla hesperis greyl/19113G04/USA:NV,Elko Co,,Lamoille Canyon|1969

0.96

sey «Speyeria hesperis greyi[19113G02|USA:NV,Elko Co,,Lamoille Canyon[1972 Speyeria hesperis greyi/19113G03/USA:NV,Elko Co,,E, Humboldt Mts,|1971

er Speyeria hesperis greyiJ19113G03|/USA:NV,Elko Co,,E. Humboldt Mts.)1971 —= Speyeria hesperis qreyi[19113G02|USA:NV,Elko Co.,Lamoille Can cue (fe

Speyeria hesperis viola[19044B09/HT|USAID,Custer Co,,Sawtooth Mts,|before 1945 Speyeria hesperis viola| 19044809] TIUSA:ID,Custer Co,,Sawtooth Mts.|/before 1945

te ane rate hesperis Bee enna | on ok Co.,Ochoco Mts.]1983 Speyeria hesperis hanseni[19061801|HT|US4:C4,Tehama Co,.[1968

4 Speyeria hesperis do Be eOBO LICE HT|USA:OR,Douglas Co.|before 1931 Speyeria hesperis hanseni| 18037H10|USA: CA Mendocino Co,/1974

=“Speyeria hesperis irene/18069B01/LT/USA:CA,Sierra Co.|before 1869 — Speyeria hesperis dodgei/19043HO8|HT|USA:OR Douglas Co,|before 1931

Speyeria hesperis hanseni[19061B01|HT|USA:CA, ehama Co.|1968 as SPeyerla hesperis irene|19061C04 [invalid NT of rupestris[USA:CA,Mariposa Co.]1984

Speyeria hesperis brico|01506C04|HT|Canada:British Columbia,S of McBride|1995 1 Sneyeria hesperis hutchins![19062G05|USA: WA,Okanogan Co,,Brewster|1959

Speyerna hesperis brico]19083E11|Canada:BC,18 mi NW Houston|1979 sz «Sbevyeria hesperis hutchinsi|/19062G04|Canada:Manitoba,The Fadel

#2 Speyeria hesperis hutchinsi|19062604|Canada:Manitoba,The Pas/2002 — Speyeria hesperis dennisi[19083E12| anada:Manitoba,Gnanole| 980

ss Speyerla hesperis Sa ea €a./1959 a- Speyerla hesperis hutchins!|19062608|US4:W4,Okanagan Co,,Brewster|1959

0.59

Speyeria hesperis hutchinsi|19062608/US4:W4,Okanagan Co,|1959 pa: SHeyeria hesperis hutchinsi[19065C10[/USA:MT,Lincaln Co,[1994

Speyeria hesperis ratonensis/18037H06/USA4;NM,Colfax Co,|199 = Speyerla hesperis beani/18069402|H |Canada‘Albertalbefore 1926

ae Speyeria hesperis ratonensis i i

Speyeria hesperis hesperis|19083012|U

SA:

19061A403/HT|USA:NM,Colfax Co.J1972 rit Aare hesperis FE ee ee an Co,,Brewster|1959

, : : 1 A:CO,Jefferson Co.|1973 ae : : |19083E 1 ston| 1979

ear Speyeria hesperis Steel Er peepee at ee a een ati ee —= Speyeria hesperis Sea eee euene ee) Sees

eyerla hesperis brica 11|Canada:BC,18 mi NW Houston]

Her Sneyeria hesperis hutchinsi[19065C10|USA:MT,Lincaln Co.[1994 St Speyeria hesperis SE ee ae ne Colfax pode

—— Speyeria hesperis lurana|/19044408]H JUSA:SO,Custer Co,|before 1945 Speyerla hesperis ratonensis|18037HO6|US :NM,Colfax Co,,1996

— Speyeria atlantis sorocko|19044B07|HT|USA:CO,Clear Creek Co,|1989 Speyeria atlantis atlantis|19065CO5|USA:NY,Hamilton Co.|1977

sag SPeyeria atlantis atlantis] 19065C04|USA:ME,Chester|1982 — Speyeria atlantis hollandi[19062G02|Canada:Manitoba,Sandilands|1956

sar «USpeyeria atlantis atlantis?|19065C07/USA: WV, Tucker Co.J1985 ae Speyerla atlantis hollandi|19062G06|Canada:Manitoba,The Pas|2002

<= Speyeria atlantis atlantis|19065C05|USA:NY,Hamilton Co,/1977 ““Spayeria atlantis atlantis|i9065C03|Canada:Ontario|2013 |

Speyeria atlantis atlantis|19065CO06|USA:NY Hamilton Co.|1977 am Speyeria atlantis hollandi|19062G01/Canada:Manitoba ill ill 1954

Speyeria atlantis SOS OOo eae ereet Co.,Catskills|before1862 nas SPeveria atlantis canadensis|19065C0 Waele ae else da 1981

-" Speyeria atlantis eee ee ee eee eel 1981 ed oes atlantis Soe neaaeae eee A:NY Hamilton Co,|1977

4, Speyeria atlantis hollandi|19062G06|Canada:Manitoba,The Pas|2002 Loar peyena atlantis hollandi[01506C03|HT|Canada:Manitoba,Riding Mts.|1934

nies atlantis Baa eee ee eee a cents a dela a — Speyeria atlantis atlantis|19055D05|LT|USA:NY,Green Co.,Catskills|betare 1862

peyeria atlantis hollandi|19062G01|Canada:Manitoba,Vivian|1954 aa7 SPeyeria atlantis Bee een HT[USA:SD Pennington Co.|before 1998

Speyeria atlantis hollandi|19062G02|Canada:Manitoba,Sandilands|1956 bo Speyeria atlantis ollandi]19065C09 USA:MT,Lincaln Co.[1994

Speverila atlantis hollandi|19065CO09|USA:MT,Lincoln Co,J1994 —"Speyeria atlantis atlantis|19065C04/USA:ME,Chester|1982

Fig. 11. Argynnis irene (red), hesperis (magenta), atlantis (blue) and nausicaa (green).

Trees constructed from nuclear genomic regions from (a) autosomes and (b) Z chromosome.

reference genome (Zhang et al. 2019d). Furthermore, we considered the autosomes and Z chromosome

separately due to their distinct roles in evolution and differences in resistance to introgression (Cong et al.

2019b). The trees constructed from concatenated coding and non-coding regions of autosomes (Fig. | la)

and Z chromosome (Fig. 11b) revealed evolutionary complexities of the taxa included. First, as expected,

the entire group consisting of A. hesperis (Fig. 11 green, red and magenta) and A. atlantis (Fig. 11 blue) is

monophyletic in both trees. Second, in both trees, A. hesperis is paraphyletic with respect to A. atlantis,

and a clade composed of south-central subspecies of A. hesperis (Fig. 11, green), including 4. hesperis

nausicaa W. H. Edwards, 1874 (type locality USA: Arizona, Graham Co.) is sister to all other taxa

combined. Third, the position of the clade consisting of northern and eastern subspecies of A. hesperis

that include the nominotypical subspecies (Fig. 11 magenta) is different in autosome and Z chromosome

trees. In the autosome tree (Fig. 11a), this clade is sister to A. atlantis, and in the Z chromosome tree (Fig.

11b), it is sister to the clade of western subspecies of A. hesperis that include A. hesperis irene

(Boisduval, 1869) (type locality USA: California, Sierra Co.).

Thus, the trees reveal four groups of taxa in this complex, and applying the oldest name in each

group, we call them atlantis, hesperis (sensu stricto), irene and nausicaa. To probe whether these groups

are species, we used the Fst/Gmin Z chromosome tests (Cong et al. 2019b) obtaining the following

Statistics. First, traditionally treated as distinct species, atlantis and hesperis groups show differences

consistent with their species-level distinction: 0.23/0.07, albeit marginally (Fst for distinct species is

typically above 0.2, with 0.5 and above indicating strong differentiation, and Gmin is less than 0.1, with

0.02 and below indicating strong isolation). Second, the differences between the atlantis and nausicaa

groups are even more pronounced than those for atlantis and hesperis: 0.36/0.026, which is in agreement

with the nausicaa group being sister to the clade consisting of the three other groups in both autosome

and Z chromosome trees (Fig. 11). Third, the differences between hesperis and nausicaa are of about the

same magnitude as for others: 0.26/0.05, indicating that A. nausicaa is a distinct species rather than a

group of subspecies within paraphyletic A. hesperis. Fourth, the hesperis and irene groups did not reveal

species-level differences in the Z chromosome: 0.13/0.13, suggesting that they may be conspecific, which

is in agreement with their close clustering together in the Z chromosome tree (Fig. 1 1b).

Although the irene group is not strongly different from the hesperis group in Z chromosome, it is

placed differently in the autosome tree: as sister to both hesperis and atlantis groups, rendering the

species A. hesperis that includes irene paraphyletic. While a species paraphyletic in a tree built from

concatenated genomic alignments is not inconceivable due to the possibility of extensive introgression

from some other species in a part of the species range, such a situation calls for further investigation.

Analysis of the trees built from various segments of the nuclear genome revealed that some segments in

the hesperis group are similar to the atlantis group, while other segments are similar to the irene group.

Hence, we hypothesize that A. hesperis is a hybrid species of A. irene and A. atlantis, because it shares

20% and 67% of its autosome-linked genome, and 71% and 20% of its Z-linked genome with the latter

two species respectively, while it possesses only 0.17% of unique polymorphisms, compared to 0.5% and

0.28% unique polymorphisms in A. irene and A. atlantis, respectively. We see that a significant fraction

of the A. hesperis genome is shared with either A. irene or A. atlantis, and the number of unique mutations

in the A. hesperis lineage is smaller than that compared to either of its putative parental species,

suggesting a hybrid origin of A. hesperis. Consequently, we consider A. irene (consisting of four

westernmost subspecies presently associated with A. hesperis, Fig. 11) to be a species-level taxon, and the

Z chromosome similarity with A. hesperis is therefore explained by the hybrid origin of A. hesperis,

which inherited larger segments of this chromosome from A. irene. This scenario of species originating by

hybridization is not covered by the Fst/Gmin Z chromosome test for species distinction (Cong et al.

2019b). The COI barcodes of A. irene are closer to A. atlantis (2.5%, 17 bp difference) than to A. hesperis

(5%, 33 bp difference), probably because A. hesperis possesses mitogenomes introgressed from A.

nausicaa and does not reveal differences in the barcodes with the latter species. As a side note, the earlier-

named species A. hesperis is likely to a be a hybrid species with one of the parental species being a named

later (A. irene), illustrating that biological reality has little to do with the order species were named in.

Finally, we find (Fig. 11) that the holotype of Speyeria hydaspe conquista dos Passos & Grey, 1945

(type locality USA: New Mexico, Santa Fe Co., presumed to be in error), presently placed as a synonym

of Argynnis hydaspe rhodope W. H. Edwards, 1874, clusters closely with the holotype of Argynnis

hesperis tetonia (dos Passos & Grey, 1945) (type locality USA: Wyoming, Teton Co.) and is therefore

placed as a synonym of tetonia, new placement.

In summary, genomic data suggest that the atlantis-hesperis complex consists of four species: A.

atlantis, A. hesperis, and two others with reinstated status: A. irene and A. nausicaa. The following

subspecies are assigned to 4. irene to form new combinations: Argynnis irene dodgei Gunder, 1931,

Argynnis irene cottlei J. A. Comstock, 1925, and Argynnis irene hanseni (J. Emmel, T. Emmel &

Mattoon, 1998). The following subspecies are assigned to A. nausicaa to form new combinations:

Argynnis nausicaa elko (Austin, 1984), Argynnis nausicaa greyi (Moeck, 1950), Argynnis nausicaa viola

(dos Passos & Grey, 1945), Argynnis nausicaa tetonia (dos Passos & Grey, 1945), Argynnis nausicaa

chitone W. H. Edwards, 1879, Argynnis nausicaa schellbachi (Garth, 1949), Argynnis nausicaa electa W.

H. Edwards, 1878, Argynnis nausicaa dorothea (Moeck, 1947), and Argynnis nausicaa capitanensis (R.

Holland, 1988). The names for other taxa in this complex remain unchanged.

Argynnis zerene atossa W. H. Edwards, 1890, new combination,

is not a subspecies of Argynnis adiaste W. H. Edwards, 1864

Described as a species Argynnis atossa W. H. Edwards, 1890 (type locality USA: California, Kern Co.),

this likely extinct butterfly was placed as a subspecies of Argynnis adiaste W. H. Edwards, 1864 (type

locality USA: California, Santa Cruz Co.) due to its prominent wing pattern similarities, in particular, the

washed out ventral hindwing devoid of silvery spots and reduced black markings above, especially on its

hindwing. To our surprise, none of the trees (concatenated protein-coding regions of the entire nuclear

genome, of Z chromosome and mitochondrial genome) placed atossa with adiaste (Fig. 12). Instead, the

atossa Clade originated within Argynnis zerene Boisduval, 1852 (type locality USA: California, possibly

Plumas Co.), which is phenotypically strongly spotted, both in back above and silvery below. Argynnis

adiaste was sister to Argynnis hydaspe Boisduval, 1869 (type locality USA: California, possibly Sierra

Co.) in a clade remote from A. zerene. Using Fst and Gmin statistics, atossa and A. adiaste adiaste are

characterized by 0.48 and 0.012, respectively, indicating strong genetic isolation. However, atossa and A.

zerene show the values Fst=0.13 and Gmin=0.15, which are within the range characteristic of

conspecificity. For comparison, A. adiaste adiaste and A. adiaste clemencei J. A. Comstock, 1925 (type

locality USA: California, San Luis Obispo Co.) exhibit Fst/Gmin of 0.06/0.21, sav less genetic

differentiation from each

other than atossa from A.

zerene. COI barcodes of

atossa and adiaste adiaste

lectotypes differ by 2.7%

(18 bp), but the 4. zerene

myrtleae (dos Passos &

Grey, 1945) holotype and

atossa lectotype differ by

1.2% (8 base pairs). We

think that the evidence

presented here to support

that atossa is not A. adiaste

is strong. However, while

currently we do not have

data to justify it, a

possibility that atossa is a

Species distinct from A.

zerene exists, if A. zerene is

later found to be a complex

of several distinct species.

For the lack of a_ better

option, we place atossa as a

subspecies of A. zerene,

where it fits genetically not

worse than a number of

other A. zerene subspecies,

Speyeria oe omis nitecris|18062B0

peyeria idalia Ri pide tialig|

Speyer Bele cybele| USA: ea

Suen ele cybele

Sbeyeria p ree te ethine spAb

eyerla hesperis ni el

peyeriah atlantis at Bore 130

SRerena mormon HAS

Speyeria é ae iil

oD;

aa OTe

a NINE Aarginia BBL. le

o cnt

key Seach

oa 7

E Virginia Dale

‘Britis pyeeLy Lillooet, Mount McLeal1926

eham aco ad) 5 at Government 1965

= "--

Ye Sonate Nationa L Pat aude

cnr PUPS C

nou Ee sbo

GO he;

hydaspe minor

5 eyeria hy asp aspen i

peyeria hi eene rhodopela

Speyer hy aspe rhadone ae

S ee ydaspe rhodope|963

hydaspe tehamal[PAo

Speyeria YF aane ydaspe| a 694,

aa ce e hyda

aie viral

Spoysbe hydasps davisi]19

Speyerla adiaste a ee

ncot

Pras

o, Umatilla Nationa Forest x17

fo. Mende alt ra aoe do

Vis

ee Ch, sisi ay ou Peano to 1877

i USA:CAK Gre

umboldt ca. wMcc Sua Mountain pLesss bl1987

Oga

aga ee na

X Mulder cise |1960

nae Santa ee AS Sararena Gap|1959

ta Cruz_C 1982

pe 3 anta Cruz Co, rene Gap|19

goa lens adiaste adiaste i anta Cruz Co, santa Cruz Bee 1990

eyerla painete adiaste|19055 santa Cruz Co.,Santa ft Be z\guRt to 1864

speyeria adiaste clemencel|19061 haa ca Co. (Chews Ril

abeyeue adea cleme nace ‘CA,San Luis Obis “Bei ron pxradeade ral ae

laste sence ue FIUSA:CA,San Luis ispo Co, Atascadero|19

‘cs kern/Lo anges es *Cos., syel0 n io

USA: CAKe nfl

onterey Co, che ge ee ctige

lamnsua Co.|1973

CA, goa ee ae »>chews Ridge|1977

CA.Monterey Co. uehe AL 1984

Monterey a ee mil N gel1994

rae Go. 2h we Ridgelao 2

ews aoe 211990

AN Monterey Co.,Chews Ridge[1990

tidnal Forest co

DOnGE

Pommp=

7 UN TT

Speyeria adiaste clemenceij 19061

sBgree adiaste clemencel| A

vate a [19

aa adiaste clamencel]19

laste clamencel| 19062

eyeria ue clemence| eee

0 aps yerla adiaste c See ace

De adia clemencei|1

Speyeria ea pe Davis ae

Speveria nae u eee USA:

se[ i004 AD6]

zou

UrOBes

275

ie ==re

Conn

WL T> >

>=:

aes

zO0 t-Cb

Mout Park ae to 1942

i Sed ‘Mountains|196

= Ct orig Mountains 1367

ALC Ba uMt, Pinos|prior to 1934

SA. n€o,,Ca scade Mountains|before 1945

n Co. crane ee. Cany on ee

rCo, a miles NNE vis ve Dale|2016

Ei ae chews al rar

Fini a 08 Nationa Paes S016

pres

peyeria coronis raiere ah

Speyerla coronis coranis|PAQ?

aves Se snydern|JPAO68

era ae ne malcolm

Speyeris zerene ma alealmy PAGS

Speyerla zerene sere ae

J houp!

BOS

5255

PDE

oxime

oD i

> ape eo

sole

Oo, zd mE of C Ipine gol

an acing Co.,Me cino Pa

USA CA, Sonat Barbara o! ‘or Ventura Cos,,Sierra M) 1922

Speyerla adiaste oe a CA,Kern Co.,le

Speyeria ad adiaste ala eens a o3 SMT ELUs USA: A,Los a al ea 18 jon region|1923

re 043H Mi inols River Pree to 1

og > rene elerleia STIR a

cra elicits zerene fea: u goo ico7 HTMiUs ISAC ells fete a:

myrtleae|190 Off iMlus ACA Sa alprior t

na Speyerla crate BOnrareyS 2 iu a CA, Mann EG can e453 orto Leas

1 Speyerla zerene myrt eee A eae SiS ye) eae CO., cng Co OBE

Speyerla zerene sonomensis|

La op

Speyerla zerene zerene|

Speyerla zerene PAO4

= obeyera adiaste at

re A

3.05

oeataea Ferene iat canal a Thiuse i Co ae:

Bp era zerene gunderi (=cynna ror

ae zZerene picta FH arr ttl is eT en WEI SH an "|

o.,Humboldt bial bejore 1945

eyerla zerene platina ee Ga a Utah Co.,Met. L

a yerla Zerene sinop sine Co Rocky ountain

peyerla zerene Baeoe La04ae bled Bat olumbia a,4spen Gro

Speyerla zerene sinope ee Lee SA: i Gra cana Co,,4. 34 ie mi SE Ha t Su Wiphuy Spa 16

Speyerla zerene pictal9626|MIUSA:OR, Umiauill a Ca, ‘Uimiatil a National Forestl2

ees 1945

Fig. 12. Argynnis zerene atossa (red) is not A. adiaste (cyan), but A. zerene (green).

although it differs strongly from all other 4. zerene subspecies in wing patterns.

The association of atossa with zerene came as a surprise due to their phenotypic dissimilarity. The

reasons behind the wing pattern similarities between atossa and adiaste, and the lack of such similarity

between atossa and zerene remain unclear. We sequenced the primary types of both atossa (in the

Carnegie Museum of Natural History, collected prior to its description in 1890) and fejonica J. A.

Comstock, 1925 (in the Los Angeles County Museum, considered a subjective junior synonym of atossa,

has spots weakly silvered, collected in 1923 in Los Angeles County, California) in addition to a specimen

from Colorado State University collection (collected in 1922 in Sierra Madre Mountains, California).

These specimens were collected in different localities and different years, and handled differently

throughout the years, but they cluster together in all trees, forming a distinct clade within zerene. It does

not seem likely that legs of yet unsequenced population of zerene were glued to all these 3 specimens, or

similar contaminant affected these samples processed in our lab on different days (and for some of them,

years) and sequenced in different lanes and batches. Therefore, we conclude that Argynnis zerene atossa

W. H. Edwards, 1890, new placement, represents an unusual example of phenotypic convergence that

hindered its taxonomic placement, now revealed through genomic sequencing.

Argynnis coronis carolae dos Passos & Grey, 1942 is a subspecies-level taxon

Described as a subspecies of Argynnis (Speyeria) coronis Behr, 1864 (type locality USA: California,

possibly Santa Clara Co.), Argynnis coronis carolae dos Passos & Grey, 1942 (type locality USA:

Nevada, Clark Co.) was elevated to species by Emmel and Austin (Emmel and Austin 1998) due to a

number of its unique features, including the isolated locality. Our genomic trees revealed that carolae

forms a compact clade consistent with its isolation, however, not separately, but deep within A. coronis,

sister to Argynnis coronis hennei Gunder, 1934 (type locality USA: California, Ventura Co.) and near the

nominal A. coronis (Fig. 12 magenta inside blue clade). This placement in the tree is geographically

meaningful, but makes it difficult to accept the species status of carolae because it renders coronis non-

monophyletic. Furthermore, Fst/Gmin for carolae vs. coronis are 0.23/0.11. Fst is somewhat elevated due

to genetic closeness of individuals within apparently strongly inbred carolae population, but the gene

flow between carolae and coronis is more than two times higher than the 0.05 threshold characteristic of

different species. The COI barcodes of the A. carolae holotype and A. coronis differ by ~0.5% (3 bp).

Therefore, we reinstate this taxon as a subspecies: Argynnis coronis carolae dos Passos & Grey, 1942.

Aglais Dalman, 1816 and Polygonia Hiibner, [1819]

are subgenera of Nymphalis Kluk, 1780

In agreement with others (Opler and Malikul 1992; Layberry et al. 1998; Savela 2020), we propose that

Aglais Dalman, 1816 (type species Papilio urticae Linnaeus, 1758) and Polygonia Hubner, [1819] (type

species Papilio c-aureum Linnaeus, 1758) are better treated as subgenera of Nymphalis Kluk, 1780 (type

species Papilio polychloros Linnaeus, 1758) rather than as distinct genera. These three distinct

phylogenetic groups are close to each other genetically with genetic distances between them of the same

magnitude as those for taxa considered congeneric in closely related lineages, such as Vanessa

[Fabricius], 1807 (type species Papilio atalanta Linnaeus, 1758) (Fig. 13). The times of divergence

between Nymphalis and Polygonia

Ag aie o|[PAO ae ‘Bavaria,near Grasswan g|2017

1 Ag als Urticae|/PA So eeien cae ee ack Swangl20

and between Nymphalis and Aglais By eahygone neers Fehon 4 aise we ene National Par:|2017

have been estimated as ~7 and ~11 Bol sly onla satyrus saree ee a TelUSA A cANontarey Co,Old Coast Road off SH1/2016

: Polyg s silenus|1711 BOS (M ORY Il Co.J19

Mya, respectively (Chazot et al. ‘Pal lf gahia gracis #6 RN RTE a amin soot Simapanli 94

7 Polygon faunus | ae PAY ener Ca a Ranch Road off pial

2019). COI barcode difference Nie by ane Bn cha snlanid Fu rua Be oie Fathead Lael 12

between N. polychloros and P...c- Nie Piphal ig anuopa (= af NDE: NY Schoharie Ct Ee nail 1857

. ih moval antiopal|® au tero Co,,Lincaln Nehonal Eorest| 36 17

aureum iS 6.7% (44 bp), and Ste nee ea etedie ae ae

b / hl d A Vanessa annabellal9 ates ee foes Nations Forest|2017

etween N. po YC oros anh ISA Ba ales GS Ballas, White Rock Creek|2015

urticae iS 7.9% (52 bp). This eae Dallas Co. qaleee White Rock Lake Par|2017

yico: ax

fanico: Oaxacal 1987

Fig. 13. Were eee and Poweonia (magenta) are Nymphalis (blue).

divergence is comparable to that

between Vanessa annabella (W. D.

Field, 1971) and Vanessa atalanta (Linnaeus, 1758) at 6.2% (41 bp), but smaller than the divergence

between V. atalanta and N. polychloros of 9.7% (64 bp). While it is not possible establish a meaningful

COI cutoff for the genus-level divergence, these numbers comparatively indicate genetic similarity of

these butterflies, and they also loosely correlate with their divergence times. Inspection of the genomic

tree (Fig. 13) reveals that the most prominent internal branches (the longest) are indeed those that support

Vanessa and its sister clade consisting of Nymphalis, Polygonia and Aglais. The clade of the latter three

taxa is compact (Fig. 13), prominent, and genetic divergence within it agrees with the expected

divergence within a genus. Therefore, unification of the three genera under a single genus (Nymphalis)

would be more consistent with how other genera (e.g. Vanessa) are classified. These showy butterflies are

quite diverse in their wing patterns and attracted significant attention, which is likely responsible for their

oversplit classification. Also, we confirm the expected sister relationship between Nymphalis antiopa

(Linnaeus, 1758) and N. cyanomelas (E. Doubleday, [1848]) (Fig. 13). In summary, in a move towards a

more consistent classification, we suggest treating Ag/ais and Polygonia as subgenera of Nymphalis.

Coenonympha california Westwood, [1851] is species

distinct from Coenonympha tullia (Miiller, 1764)

In agreement with Kodandaramaiah and Wahlberg (2009), we find substantial genetic differentiation

between European Coenonympha tullia (Miller, 1764) (type locality Denmark: Zealand Island) and North

American Coenonympha california Westwood, [1851] (type locality USA: California, near San

Francisco) (Warren et al. 2016). The latter has frequently been treated as a subspecies of the former

(Pelham 2008; Pelham 2020). Coenonympha tullia See eareaae mie Sweden docehyttan| 1978

Fst/Gmin statistics for C lli = SE PoE naN Wanted ia lay 1909746 Coach ne blicBoh 1976

a oenonympha tullia tullia zech Republic,Bohemia

St Mun Statisucs for : tu la VS. a a Cecsone Hehe tulle octet gue 9SHO3|USA:AK Kodiak Is ones

‘. : . . . — Coenonympha tullia mixturata?| SOB TORTUGA: AK Kotzebuel195

california are 0.22/0.02, indicating oa Coenonymoha tullia yuk conensis| 190981106 |USA:C Canada,Yukon Terr.[1961

4 : Es ae a eee cnenee [19097812 FIUsA, Yukon pers 11903,

— oenonympha tullia california arin Ca

very limited gene exchange between pie Coenonympha tullia ampelos =| 29098H1 i{fusa. CAplumss Co119

h 6 l f l l l t d 88 - een EET tullia Loe ear pee TUS 1A neR 1094 Ea, SLO79/USNM

Er oenonympha tullia eunomia

t ese taxa, typica OF Close yi relate a5 Coenereeche tullla ochraceali9098 a1 {lusAsMt Mt Soy al Co,[198

. . . Coenonympha tullia See aaa n SAWY, Park Co, ‘Yellowstone National Park|2017

species rather than subspecies. This =a Coenonympha tullia er aos Se Canada:Albertal 2003

5 . ; aa Coe ete re la Been 1 0|MiCanada: raigy nes

ha oenonympha tullia benjamini anada:Alberta

differentiation strongly suggests that — Beene nae tullia Benjani, 12098098 /58 A‘NE,Cherry Co,/1985

Womiieieoindeed ; Fa Seen eka err el soossus usa be Meader 95

oenonympha tullia inornata Washington

C. ca ifornia IS imndee a species on ee eacie bee 98D io 2 (USA A, conor Co,J1974

wes 5 0.35 Coéenonympha tullia inornata|19098D04|USA: NY Woe Co,|2005

distinct from C. tullia. Moreover, We — Coenonympha tulllia meisaaci|19098C07|Canada: aa ae

Soenonympha tulls FACE ES ITT ete tees acwetgie soad

‘ Coenonympha tullia nipisiqui anada:New Brunswick,Bathurs

find that the northernmost American a Aeon re tullia Eee 19098D01|M|Canada:New Brunswick| 1952

Cem ne tullia nipisiquit] 19098C12|M|Canada:New Brunswick Mos

taxa from this complex form a clade Fig. 14. Coenonympha tullia (blue and magenta) and california (red).

that is sister to C. tullia (Miller,

1764) and not to C. california Westwood, [1851] (Fig. 14). These populations are currently attributed to

subspecies C. tullia kodiak W. H. Edwards, 1869 (type locality USA: Alaska, Kodiak), C. tullia mixturata

Alpheraky, 1897 (type locality Russia: Kamchatka; it remains to be investigated if this name applies to

the Nearctic taxon) and C. tullia yukonensis W. Holland, 1900 (type locality Canada: Yukon and USA:

Alaska). Compared to European C. tullia, they show Fst/Gmin of 0.14/0.05, which are in the range for

conspecific populations, however with a more limited gene exchange than typical (Gmin is less than 0.1).

Therefore, until further research shows otherwise, we leave these three subspecies with C. tu/lia. Future

genomic studies of Coenonympha tullia viluiensis Ménétries, 1859 (type locality Russia: Vilyuy River)

are also needed, because if it falls in the same clade with the three subspecies of C. tullia from North

America, it would be the oldest name in this clade. And if this clade is found to be a species distinct from

C. tullia, it will be the name of this species. In summary, according to our genomic analysis, both C. tullia

and C. california are present in North America, and all American taxa of the tud/ia complex other than the

northernmost subspecies C. t. kodiak, C. t. mixturata and C. t. yukonensis belong to C. california.

Palaeonympha Butler, 1871 is a subgenus of Megisto Hiibner, [1819]

The New World genus Megisto Hiibner, [1819] (type species Papilio eurytus Fabricius, 1775, a junior

homonym, considered a synonym of Papilio cvmela Cramer, 1777) became monotypic after the transfer

of Euptychia rubricata W. H. Edwards, 1871 : Palaeonympha opalinal19114B02|Taiwan|1957

: oe eee pees pave en ears

(type locality USA: Texas, McLennan Co.) to Mégisto cymala cymela| 8531 |Usa: 1X Harrison ¢o.12017

rood 1 if] ae ma gb |SAlINDS 7454 ee ey Lita ee

Cissia Doubleday, 1848 (type species Papilio ar spilt ideale AMINOS7 45443): st a ee Sat

7 ° ° ° ° ¥o ImMo|qes Pacta Brazil aco rea

t Pais 7Gosic R

clarissa Cramer, [1780], a eee subjective yonthimoides borasta|SAMNO8 Costa Rica AC Wns eaerseieeis

synonym of Papilio penelope Fabricius, 1775) peed sr Cras a co ores Ane

7, t al. 2018). A Pal h [0.8 se Gissia penelope SAMINOS #acsjetuader|2014

( acca Cl al. ). genus ardeonympna — esate AMNO9745454|Brazil:Sao pit 2014

Butler, 1871 was proposed for a newly described Fe a ee eT eA US R Aceene senile Ca 2013

species P. opalina Butler, 1871 from China and _ | Fig. 15. Palaeonympha (red) is Megisto (blue), Cissia (magen-

remained monotypic since. In wing patterns, it ta), Vanima (brown). IDs with "SA" are from NCBI database.

bears an uncanny resemblance to M. cymela (Fig. 16), and was indeed sister to Megisto both in gene

marker-based (Zacca et al. 2018) and genome-scale phylogenies (Espeland et al. 2019). Genomic

sequencing confirms a close relationship between monotypic Megisto from the New World and monotypic

Palaeonympha from the Old World (Fig. 15 blue and red), closer than many species of Cissia are to each

other (Zacca et al. 2018;

Espeland et al. 2019) and

about the same divergence

as two species of Vanima

Zacca, Casagrande & O.

Mielke (Fig. 15 brown).

The COI barcodes of

cymela and opalina differ

by 8.8% (58 bp), within

the range of many con-

geners. To emphasize this

close kinship between

these two disjunct species

(cymela and opalina)

apparent from their geno- Se

types and phenotypes, we Megisto (Megisto) cymela M. (P.) opalina

propose that, instead of Fig. 16. Megisto opalina (Taiwan, sequenced as NVG-19114B02 & NVG-19114B03)

each being placed in its and M. cymela (USA: OK, Carter Co., Murray Lake, 9-Apr-1999).

own monotypic genus, they are congeneric. We assign a new status of subgenus to Palaeonympha,

resulting in Megisto opalina Butler, 1871, new combination. Thus, Megisto becomes a Holarctic genus,

yet again indicating elaborate connections between the Old and the New Worlds.

NVG-19114B03

Cissia cleophes (Godman & Salvin, 1889) does not belong to Megisto Hiibner, [1819]

Placed in Megisto recently on the basis of morphological similarities (Zacca et al. 2020), Euptychia

cleophes Godman & Salvin, 1889 (type locality Mexico, Guerrero, Fig. 17) is not monophyletic with the

type species of Megisto (Fig. 15

magenta vs. blue) and therefore

does not belong to Megisto,

unless this genus is expanded to

include species placed in other

genera, such as Yphthimoides

Forster, 1964, Vanima and

Cissia. In our tree (Fig. 15),

cleophes falls within Cissia: it is

in the clade with C. penelope,

which is a valid name for the type

species of Cissia. Therefore, because the tree strongly supports that cleophes does not belong to Megisto,

we suggest to leave this species in Cissia (where it may belong and was placed previously, but statistical

support for this clade is weaker) pending genomic analysis of other species from this and nearby clades.

Fig. 17. Cissia cleophes sequenced as NVG-19118BO01.

Hyponephele Muschamp, 1915 is a subgenus of Cercyonis Scudder, 1875

In the genomic tree (Fig. 18), Hyponephele Muschamp, 1915 (type species Papilio lycaon Rottemburg,

1775) is sister to Cercyonis Scudder, 1875 (type species Papilio alope Fabricius, 1793, placed as a

subspecies of Papilio pegala Fabricius, 1775), in agreement with previous findings (Pefia et al. 2006).

The tree reveals that the genetic divergence between Hyponephele and Cercyonis is smaller than that

within Erebia Dalman, 1816 (type species Papilio

Cercyonis pegala texana|4506|USA:TX,Wise Co,[2015

‘ : Ik

ligea Linnaeus, 1758). The COI barcodes of H. lycaon 2 ere ee cAMéndocne Co.l2047

. . reyonris stnenele an rransico LoO,[o

and C. pegala ditier by 7.9% (52 bp). We give Hypobephele yeagn(s0 aoe Neth Macescnig 980

1 1 H hele dysd 19115E11|Tajikist 1975

Hyponephele a new status of a subgenus within oe Mariolatelmassia|i9{-U5|Greecel ine

Cercyonis. This change may not be welcomed by the sar — Pyronia {thonus|19113+10[France 2008

F ronia bathseba pain

Old World Lepidopterists who are used to the name Aphantopus hypsrantus Ease ana

Hyponephele applied to its many species, similar to —— grabia vidler|$004[USA;WA (hateom Co,[1980

how uray aaa weleomed sine eaeea ic iaolua Secale ecoe Gas gaCR cane Ce

OW ellis IS not welcomed 1n ers O Include Erebia magdalena|6549/USA4:CO, Park Co.|2016

Speyeria as its subgenus. However, this name change soso olkcoidalla| 798s Vel raise eT

Erebia disal16106E08|Canada:Yukon Territory|2016

highlights the close relationship between the two

; Fig. 18. Cercyonis (blue), Hyponephele (red), Maniola

subgenera (Hyponephe le and Cer Cy ONES ) making (green), Pyronia (magenta), and Aphantopus (cyan).

Cercyonis a Holarctic genus, similar to Erebia

Dalman, 1816 (type species Papilio ligea Linnaeus, 1758) in divergence and distribution. This is yet

another step towards more internally consistent genus-level classification in butterflies.

Pyronia Hiibner, [1819] and Aphantopus Wallengren, 1853

are subgenera of Maniola Schrank, 1801

The genomic tree reveals that Pyronia Hiibner, [1819] (type species Papilio tithonus Linnaeus, 1771) is

not monophyletic (Fig. 18), and Pyronia bathseba (Fabricius, 1793) is sister to Aphantopus Wallengren,

1853 (type species Papilio hyperantus Linnaeus, 1758) with strong support (Fig. 18). Two other Pyronia

Species we sequenced are not monophyletic either: the type species of the genus is sister to Maniola

Schrank, 1801 (type species Maniola lemur Schrank, 1801, which is a junior subjective synonym of

Papilio jurtina Linnaeus, 1758). To restore monophyly, it is possible to break Pyronia into smaller

genera, and these already have names available: Pasiphana de Lesse, 1952 (type species Papilio bathseba

Fabricius, 1793) and Idata de Lesse, 1952 (type species Epinephele ida var. cecilia Vallantin, 1894).

Alternatively, they can be grouped in some ways to form more inclusive monophyletic genera. The tree

(Fig. 18) reveals three clusters of species of equivalent rank. One of these clusters is the genus Erebia.

The other one is the genus Cercyonis as we presently define it (including Hyponephele as a subgenus).

Therefore, it is meaningful to treat the third group as a single genus as well. Hence, we propose that

Aphantopus, Pyronia, Pasiphana and Idata are subgenera of Maniola, new status. It is unfortunate that

genomic data suggest abandoning the familiar Aphantopus and Pyronia as genera, however breaking this

more inclusive but genetically prominent genus Maniola into four or five very small genera is even less

appealing to us.

Dione incarnata N. Riley, 1926 is a species

distinct from Dione vanillae (Linnaeus, 1758)

Inspection of a nuclear genomic tree reveals pronounced divergence between Dione vanillae (Linnaeus,

1758) (type locality South 4 te ees Aelia ae Jeri[4695|USA:FL,Levy Co, ears ceetown|2015 Pot aia

America, probably Surinam) Secon es aaa) UU IU Ma ace cele i ot Giida(@07

fi Jamai d Heliconius erato petivarana[i7117605|M|Mexico:San Luls oie

specimens rom amaica af Dione manetal14114510|USA. TX,Hidalgo Co.,Mission|2014

1 1 Dione 17117B801|[M|Mex san Li Pot 1978

from the USA. (Fig. 19). This i Tae inte pa eM Mexico Sa) ae

divergence is of about the peck vanillae insularis|10272|Jamaica: ae

lone vanillae insularis|10536|Jamaica:3|2017

: EE eT ee eee 2 ot ronda ciy|2017

ione vanillae nigrior iami-Dade Co,,6 mi SW of Florida ity

same magnitude as that 7 Sane vanillae incarnata| 10145|/M|USA: AZ Santa Cruz Co, Pajarito Mtns.|2017

between the distinct species ione vanillae incarnata|3451|M|USA:TX Hidalgo Co,Old Rio Rico Rd, 1.5 air mil2015

Dione moneta Hibner, [1825]

and Dione juno (Cramer, 1779), and somewhat smaller than that between more distant relatives

Fig. 19. Dione incarnata (red) and D. vanillae insularis (blue).

Heliconius charitonia (Linnaeus, 1767) and H. erato (Linnaeus, 1758) (Fig. 19). In contrast to their

separation from Dione vanillae insularis (Maynard, 1889) (type locality Bahamas, Fig. 19 blue), the name

currently applied to Jamaican populations, the two USA subspecies: eastern Dione vanillae nigrior

(Michener, 1942) (type locality USA: Florida, Monroe Co.) and western Dione vanillae incarnata N.

Riley, 1926 (type locality Mexico: Durango), cluster closely with each other (Fig. 19 red). The Fst/Gmin

Statistics for the two groups (red vs. blue) are 0.81/0.0002, indicating nearly absent gene exchange

between these groups, the smallest of all sister species we studied in this work. Search of the BOLD

database (Ratnasingham and Hebert 2007) reveals that Jamaican specimens group closely by their COI

barcodes with specimens from other Caribbean Islands (Cuba, Dominican Republic, Puerto Rico), and in

particular with specimens from the Bahamas (the type locality of D. v. insularis. Therefore, Jamaican

populations may indeed be referred to as D. v. insularis. The COI barcode differences between Jamaican

insularis and USA incarnata is 2.9% (19 bp). For these reasons, D. vanillae insularis is apparently a

species distinct from the USA species consisting of subspecies nigrior and incarnata.

These two species (insularis and the USA species) are distinct phenotypically with wing shapes and

patterns, as described by Maynard (1889). In fact, Maynard proposed Agraulis insularis as a species, and

he considered the USA species to be Agraulis vanillae, characterized by longer wings, smaller black

spots, white dots in forewing black spots compared to insularis. However, both the Merian illustration

(1705), which was mentioned in the original description of D. vanillae (Linnaeus, 1758), and the

lectotype specimen (Honey and Scoble 2001) reveal the insularis phenotype (e.g. extended black band on

the forewing, broader wings) that differs from the USA specimens. In his revision, Michener gave a key

to the vanillae complex taxa (Michener 1942). The first doublet separates incarnata with nigrior from all

other taxa, including the nominotypical vanillae. Therefore, the USA specimens are not D. vanillae, but a

Species that may be referred to by the oldest name applicable to North American populations: D.

incarnata, and we currently leave insularis as a subspecies of D. vanillae. Michener also raised the

possibility that incarnata may be a distinct species, based on incarnata specimen from Colombia, in

which case it would be sympatric with D. vanillae. However, these Colombian specimen might have been

mislabeled. Due to the evidence presented here, Dione incarnata N. Riley, 1926, new status, appears to

be a distinct species, with D. incarnata nigrior (Michener, 1942), new combination, being its subspecies.

Danaus eresimus (Cramer, 1777) belongs to subgenus Danaus Kluk, 1780, together

with Danaus plexippus (Linnaeus, 1758), and not to subgenus Anosia Hiibner, 1816

together with Danaus gilippus (Cramer, 1775)

Danaus eresimus (Cramer, 1777) (type locality Suriname) looks superficially similar to Danaus gilippus

(Cramer, 1775) (type locality Brazil: Rio de Janeiro) and at times it is a an to distinguish these two

Species. On_ the contrary, Danaus Danaus plexippus|4849|USA:FL, le Co,SH997 4.8 mi N of SH90|2015

l | (Linnaeus 1758) (t e *Banaus lexipbus Sia IF|USA Hee Ce FMoabl20%6 RR tracks|2015

Pp exIppus 2 yp eresimus mo re is & stair Eo ae Beane sae

: 5 naus eresimus mon eine arr Co,Rio Grande Ci

locality USA: New York, Orleans Co.) pana eresimus mantezum 0 Co,Chihuahua RR tracks|2015

i i i. eens allio ous eee 3 eee ob ola ue esi Rd|20

anaus gilipous thersippus an Diego Ca

is superficially more different from ® CEE POOE thersippus|41 Sa[r [USA XJetferson Ca,5 of Stine Pass|2015

. ; ae naus gilippus berenice|4 SA4:FL,Monroe Co,key West|2015

either D. ereslmus oOf7 D. gilippus Danaus gilippus berenice ale USA‘FL, Levy Ca, Yank eetown|2017

Tirumala formosa morgeni[19095G O/Cameroon|19 1974

(Warren et al. 2016). Due to these

superficial similarities and differences,

traditionally, only the former, as the type species, belonged to Danaus Kluk, 1780, and the latter two

Species were placed in Anosia Hiibner, 1816 (type species Papilio gilippus Cramer, 1775) (Ackery and

Vane-Wright 1984; Pelham 2008; Pelham 2020). However, among these three species, genomic data

(both nuclear and mitochondrial genomes) place D. eresimus as a sister to D. plexippus with high

confidence (Fig. 20), and D. gilippus is a sister to that clade of the two species, in agreement with

previous DNA-based analyses (Zhan et al. 2014; Aardema and Andolfatto 2016). Therefore, we transfer

Danaus eresimus (Cramer, 1777) from the subgenus Anosia where it does not belong, to the subgenus

Danaus in accord with the phylogeny of these three species. This change has already been implemented

Fig. 20. Danaus plexippus (blue), eresimus (red) and gilippus (magenta).

by Pelham in the most recent version of the catalogue (2020) after the discussion of our genomic data and

previous works with NVG. Here, we simply formalize this change in a publication.

Chlosyne coronado (M. Smith & Brock, 1988) is a species

distinct from Chlosyne fulvia (W. H. Edwards, 1879)

In the /eanira group, Chlosyne fulvia coronado (M. Smith & Brock, 1988) (type locality USA: Arizona,

Pima Co.) has been a

subspecies-level taxon

since its description

(Smith and Brock 1988).

The genomic tree of the

group revealed _ that

Chlosyne fulvia (W. H.

Edwards, 1879) (type

locality USA: “Western

* NVG-20011F12

AZ: Mohave Co., Peach Springs

°\ 3 : ——=

Texas”) is paraphyletic Chi Pa — Thloslne leanira wright (=pelona)

. osyne : Chlosyne leanira elegans| 1906110

with respect to Chlosyne taxa — Chlosyne leanira leanira|PAO352|C

Chlosyne leanira alma|18034D04

= Chlosyne leanira alma|18034D05|N

& Chlosyne fulvia pariaensis|17

cyneas (Godman es

Salvin, 1878) (type BB - wrightii gsyne fulvia coronadal1/109D02|Hy|AZ:Pima C

oCalineMexics @ [) - elegans ° ss [222 — chiosyne fulvia fulvia| 20011G02|Az:Apache Co.

Ocall Vv C€X1Co: axaca), : leanira Chlosyne fulvia Fula pe teal ee 3

and C. fulvia coronado i —leanira hlosyne fuvia va —

with Chlosyne fulvia

pariaensis (M. Smith &

Brock, 1988) (type

locality USA: Utah,

Kane Co.) form a clade | o — type locality:

more prominent than specimens sequenced

[ | — alma SS i Chlosyne fulvia fulvia

Chlosyne fulvia f

- Chlosyne cyneas|17

A- pariaensis

A- coronado

@ — fulvia

Chl osyne leanira (C. no specimens sequenced

Felder & R. Felder, type localities are indicated

1860) (type locality by tiny circles placed inside fee

, . specimen symbols, or small

USA: California, Plumas | circles framed with color of taxa

: (if no specimens from these O

Co.) (Fig. 21). The Fst/ localities were sequenced), labeled f é

Gmin statistics for with names of taxa preceded by =

for junior subjective synonyms,

fulvia and coronado are shown in smaller, thinner font :

0.49/0.015, comparable Fig. 21. Chlosyne fulvia and coronado with relatives. Four specimens from Arizona are

to those of fulvia vs. shown (dorsal: right and ventral: left) and are labeled with their DNA sample numbers on the

leanira: 0.40/0.012. COT L.maP that shows the localities of all sequenced specimens from the USA included in the tree.

“Western Texas”

barcodes are 2.7% (18 bp) different between fu/via and coronado, but are 0% between coronado and

pariaensis. Furthermore, according to the map of sequenced specimens (Fig. 21), fulvia and coronado

may be sympatric in north-central Arizona. For all of these reasons, we propose species status for

Chlosyne coronado (M. Smith & Brock, 1988) new status, and Chlosyne coronado pariaensis (M. Smith

& Brock, 1988) new combination, as its subspecies.

Chlosyne chinatiensis (Tinkham, 1944) is a species

distinct from Chlosyne theona (Ménétriés, 1855)

In their revision of the theona group, Austin and Smith (Austin and Smith 1998) placed Melitaea

chinatiensis Tinkham, 1944 (type locality USA: Texas, Presidio Co.) as a subspecies of Chlosyne theona

(Ménéetriés, 1855) (type locality Nicaragua). While accepting subspecies-level treatment of chinatiensis,

Pelham (2008) writes: "There is considerable

Chlosyne theona eee ‘Nueva Leon

Chlosyne theona chinatiensis|69/|U54:TX Brewster Co

reason to consider this a distinct species from oss 28 Chiosyne theana chinatiensis|7664]Mexico:Nuevo Leon

Chlosyne > fhean paler S|USAITX Star

theona. More investigation is required." We Te. Area Hat et ae agree fleRia Costa Rica

‘ i : ; : : Chlosyne theona theklal10947IUSA:TX Jeff Davis Co.

carried out our genomic investigation by Fig. 22. Chlosyne chinatiensis (red) and theona (blue).

sequencing of three chinatiensis specimens from

the US and Mexico (Fig. 22) and found that their comparison with theona specimens from across the

range (from Arizona, Texas and Costa Rica) results in the following Fst/Gmin statistics: 0.35/0.019,

indicating genetic differentiation and low gene exchange consistent with chinatiensis being a species-level

taxon. The COI barcodes of C. chinatiensis and C. theona thekla differ by 1.4% (9 bp), but those of C.

chinatiensis and C. theona bolli differ by 0.6% (4 bp). Moreover, C. chinatiensis is sympatric with C.

theona bolli in west Texas, e.g. in the Big Bend National Park. Given this evidence, we reinstate

Chlosyne chinatiensis (Yinkham, 1944) as a species.

Family Hesperiidae Latreille, 1809

Phocides lilea (Reakirt, [1867]) is a species

distinct from Phocides polybius (Fabricius, 1793)

A tree constructed from protein-coding regions of their nuclear genomes reveals that specimens of

Phocides polybius (Fabricius, 1793) (type locality "Indiis", likely Suriname) partition into two distinct

clades (Fig. 23). One of the clades

consists of Phocides polybius lilea

lies (malhiellata)|18094cD9|H ‘TX|priar to 1872|CMNH

albicilia ta)| 1809400 O|HT|F[Guatemalal|old| MTD

: : “8 recast al teties lileali Penaana tien: eee oe

(Reakirt, [1867]) (type locality _Phecides poly ae olybius|4 (a0asHt |M|Wenezuela,Meridalold

: . . 2 d h ae Ea Pena a a4 yoiu us polybius|17098G01|Panama|19 978 .

Mexico: Veracruz, Fig. 3 re ). T € — headed palbios oat Hoehne Cayennelald

other clade includes all other taxa of on See ee mons iawe

. 5 3 . 2 Phocides polybius polybius (=imbreus)|15029809|ST|"South 4merica’|ZMHB

Bis Speeles (ie eae) FSU CTRINS || af Paced ott bangs eunmaca 136Ser 890 ifroendna| onc nae

statistics for the 7. chromosome pleas Bal bius bhanias {-unmacua}l TUneeae ?STIM Necartina 1906|MNHP

. Phaocides pialia Alte (=zancle eius)|18025C09|HT|M|Brazil: SC|before 1932|)4MNH

comparison of these two clades are Phocides yokhara|18031C04)Ecuador|2002

: h ij roo Phocides perillus|1803 BOeIM| Colombia, Bogotalold

0.39/0.021, suggesting that they Fig. 23. Phocides lilea (red) and polybius (blue).

represent two distinct species.

Moreover, COI barcodes of /ilea from Mexico and polybius from Guyana show 3% (20 bp) difference.

Therefore, we conclude that Phocides lilea (Reakirt, [1867]) is a species-level taxon, reinstated status.

Furthermore, we sequenced the only known syntype of an enigmatic taxon Erycides imbreus Pl6étz,

1879 from the ZMHB collection, illustrated in Warren et al. (2016). This specimen is a syntype because it

is a uniquely patterned specimen that carries appropriate labels, agrees with the original description and

looks similar to the unpublished Godman copy of the Plétz illustration (@¢n BMNH, inspected by NVG)

(Godman 1907). It is an unusual specimen lacking an orange bar in the forewing discal cell (usually

extending to costa) typical for P. polybius. Evans (1952) treated this name as a distinct species Phocides

imbreus Plétz, 1879 based on a rather poor illustration of this specimen in Draudt (1921)—it is unlikely

that Evans saw the actual specimen. Mielke & Casagrande (2002) inspected the syntype and synonymized

the name with P. polybius lilea due to general phenotypic similarity and the lack of orange coloring on the

fringe around the hindwing tornus. According to our genomic results (Fig. 23), imbreus is confidently

placed with Phocides polybius polybius, revised placement of a synonym, and is probably an aberrant

specimen of polybius, not lilea, lacking any orange coloration on its wings, not just on the fringe, but also

a forewing orange bar. However, the head of the syntype retains the usual orange patterns including

orange palpi and cheeks. Our revised synonymy is further supported by the label data on the specimen

stating "Am. m.", which probably stands for America meridionalis (South America), where P. /ilea is not

known to occur.

Cecropterus nevada (Scudder, 1872) and Cecropterus dobra (Evans, 1952)

are Species distinct from Cecropterus mexicana (Herrich-Schaffer, 1869)

Genomic analysis of Cecropterus mexicana (Herrich-Schaffer, 1869) (type locality Mexico) reveals a

pronounced divergence between its subspecies (Fig. 24) that was analyzed further. The genomic tree

shows separation between some . eee ee Se ee eee cee re ea

ecropterus mexicana blanca ‘CA,Mono Co. White Mountains|2

of them comparable to that from Cecropterus mexicana blanca|P401152|US4:C4 Mono Co!White one ne gate

: ols — Cecropterus mexicana nevada|l14114409 Sit eee ae Co,,sherman Pass areal2003

Cecropterus diversus (E. Bell, “<— Cecropterus mexicana nevada/14114410 ee ee Co,,sherman Pass areal2003

: ores mexicana BORE thes hl a SC eee aa aaa Pale a Sate

. ecropterus mexicana dobra 2 tNM,Qtero Co,,Lincaln National Forest|2

1927) (type locality USA: 7 Pee peters mexicana mexicana Sasi Logs aro 1 STM Meccole ca B

: : . Cecropterus mexicana mexicanal14114601|M|Mexico:Qaxaca,San Jose Pacifico|1986

California, Plumas Co.). While ser Cecropterus mexicana mexicana|14114412|Mexico:Hidalgo,Cuesta Coloradal1981

; ; : SoRrenty re me: pee ea ae Fe Gage voslaca

ecropterus diversus ‘CA, Madera Ca,[2

Fe ee ee ane ee CESSES AHL eo demo UEP WattHS eo. Sh Lea Panacealt980

: : ecropterus bathyllus -FL,Wakulla Co. mi No of Panacea

(Skinner, 1893) (type locality

Fig. 24. Cecropterus nevada (red), dobra (magenta) and mexicana (blue).

USA: Oregon, Klamath Co.,

male syntype sequenced), C. mexicana blanca (J. Scott, 1981) (type locality USA: California, Mono Co.)

and C. mexicana nevada (Scudder, 1872) (type locality USA: California, Sierra Nevada) group closely

together (all three unified under the name nevada below), C. mexicana dobra (Evans, 1952) (type locality

USA: Arizona, Graham Co.) forms a clade distinct from them and C. mexicana. The Fst/Gmin statistics

for these clades are: mexicana vs. dobra: 0.34/0.021, mexicana vs. nevada: 0.37/0.010, nevada vs. dobra:

0.30/0.055. We see that nevada and dobra exchange genes more frequently with each other than do each

of them with mexicana. Differences between COI barcodes in pairs of these species are: mexicana and

dobra: 1.8% (12 bp), mexicana and nevada: 1.1% (7 bp), nevada and dobra: 1.7% (11 bp). For

comparison, the COI barcodes of aemilea, blanca and nevada are 100% identical. Curiously, in contrast

to nuclear genomes (Fig. 24), mitochondrial genomes (as reflected by barcodes) place mexicana closer to

nevada, and dobra farther away from them, which is yet another example of the peculiarity of

mitochondrial evolution. Deriving further support from genitalic and wing pattern differences mentioned

by Evans (1952), we suggest that Cecropterus nevada (Scudder, 1872), reinstated status, and

Cecropterus dobra (Evans, 1952), new status, are species-level taxa, not subspecies of Cecropterus

mexicana (Herrich-Schaffer, 1869). Then, we treat Cecropterus nevada aemilea (Skinner, 1893) and

Cecropterus nevada blanca (J. Scott, 1981), new combinations, as subspecies of C. nevada.

Telegonus anausis Godman & Salvin, 1896, is a species

distinct from Telegonus anaphus (Cramer, 1777), and

Telegonus anausis annetta (Evans, 1952) is its subspecies

A polytypic species Telegonus anaphus (Cramer, 1777) (type locality Suriname), in addition to nominal,

includes four subspecies (Evans 1952), all of which we sequenced and analyzed. Among them, there is a

single representative of the USA

Telegonus anaphus Eee ectinnd MUSA: TX, Starr Co.,Ft. Ringgold|2014

. — Telegonus anaphus annetta|14111HO8|Mexico: Tamaulipas

BOLD Ba SGP SAARI SS aniaia Ey sleds anabrus anaaliso/s0a0Ironaur asl ooo

: Ta elegonus anaphus annetta 2 2| Costa Rica: a - -2

Evans, 1952 (type locality Costa b Telegonus anaphus annetta|17106C09|Costa Rica:ACG/2010|10-SRNP-67024

. 7 ; Telegonus anaphus annetta/19075012|Colombia|1992

Rica). The genomic tree of these : Telegonus anaphus annetta]14113F08|Mexico:Guerrera|1985

Sanus aaa Se ea alee aoa eeeunaiigee

‘ Le elegonus anaphus anoma|MIV -52 rinidad,Point Gourde

taxa reveals a split between the aad se, Telegonus anaphus anausis|19075F06|Puerto Rico|1934

: : — Telegonus anaphus anausis|19075F04|Cuba,Santiagolold

nominotypical T. anaphus and all 2780.- Telegonus anaphus anausis|10688|F|Jamaica,Mandeville|2018

h Fj 25 bl d | d AS ABese FN chien MHOSEHOICeIdoreeee ces 1921

= Telegonus anaphus aniza]18028HO1|Ecuador|1988

others ( 1g. ue vs. re Cla e). = eee Ls ere aE teed ; Pe

1 Da Telegonus anaphus anaphus|19075E11/Brazil:Paraiba|1956

The oldest name 1n the second (red) War Telegonus anaphus etait 86603/HT|BR:Bahial1912|MNHP

. ; * Telegonus anaphus anaphus|19075E10|Brazil:Rondonia/1993

clade is Telegonus anausis Godman Talegonus anaphus anaphus|19087A01|French Guiana,Cayennelold

Telegonus jaira|10323|M|Jamaica|2017

Fig. 25. Telegonus anausis subspecies (red branches) and anaphus (blue).

& Salvin, 1896 (type locality St.

Vincent, Grenada, Dominica, His-

paniola). The Fst/Gmin statistics computed on some of these subspecies are: anaphus vs. annetta

0.40/0.01 and anaphus vs. anausis 0.45/0.009, indicating species-level differentiation. The COI barcodes

are 4.3% (28 bp) different between anaphus and annetta, which is larger than a typical difference between

closely related species. Comparing subspecies within the second cluster (Fig. 25 red clade), we were not

able to gather evidence for their change of status to species. For instance, Fst/Gmin of anausis vs. annetta

is 0.16/0.11, which by itself does not justify Central American annetta as a species distinct from the

Caribbean anausis. Therefore, we reinstate Telegonus anausis Godman & Salvin, 1896 as a species and

transfer all (except the nominotypical) subspecies currently placed in 7. anaphus to T. anausis to form the

following new combinations: 7elegonus anausis annetta (Evans, 1952), Telegonus anausis anoma

(Evans, 1952), and Telegonus anausis aniza (Evans, 1952). A curious accident here is that as a result of

genomic work, the name originally proposed (Godman and Salvin 1896) as Telegonus anausis is now

returned to its original combination and status nearly 125 years later.

Epargyreus huachuca Dixon, 1955 is a species

distinct from Epargyreus clarus (Cramer, 1775)

We obtained whole genome shotgun sequences of specimens from all known distinct groups of US

populations currently assigned to Epargyreus clarus (Cramer, 1775) (type locality "Suriname", later

corrected to USA: Virginia, Eparayreus clarus calitornicus|18037E12|USA:CA,Riverside Co,

A 0 ee LePuS aoe Seer eae O4|USA;CA Tulare CO. a. ‘CA,Eldorado C

pargyreus clarus californicus orado Co

Rockingham Co.). A tree made = Epargyreus clarus californicus|1511 Sabai CA,Tulare Co,

‘ ‘ : Epargyreus clarus|19125401|Canada:Ontario

from protein-coding regions of ore Eparayreus clarus clarus|4283|USA:IN Montgomery Co,

O44 pargyreus Game eae seine AYTX,D

: pH Epargyreus clarus clarus|3526[USA:TX, es Santo En,

the Z chromosome (Fig. 26) D3 eT ua Epargyreus clarus clarus|6155/USA: ay ce eae Co,

l 5 F 5 Epargyreus oe 5 igtzanizlusa.in e

= Epargyreus clarus|19124H12|USA MT, tee an ‘Co.

reveals a prominent sp it into ae Epargyreus Carus 19039HO2|(USA:MT, ‘Lincoln Co,

. as Epargyreus clarus|19039HO3/USA:CO, Gunnison ne

two clades (blue and red) with = Epargyreus clarus|19039HO4|USA:CO|Boulde

i E oSrae sts Cte sailed ; ca 130956 07(HTIUSA: Az, Cochise Go,

aoe pargyreus clarus huachuea Z,Cachise Cc

divergence comparable to that — Epargyreus clarus ae ee aa ERA Goren Sonora

2 oF Epargyreus clarus pata ual Tes B/USA:NM,Grant Co

between Epargyreus orizaba Epargyreus clarus profugus| TS038A1 1 [ATUSA: NV,Clark Co.

Epargyreus clarus Se etek AZ Cee Co.

— | f 15116HO8|USA:AZ,M c

Scudder, 1872 and Epargyreus a Epergyreus aaa ee 151461 ‘OIL USALAZ ae Co,

cruza Evans, 1952, shown as Se searsus pa wong | uses Oeanion co

outgroups. The holotypes of Epargyreus cruza|16107G12|Costa Rica: ACG|09-SRNP-73319

both E. clarus huachuca Dixon,

1955 (type locality USA: Arizona, Cochise Co.) and E. clarus profugus Austin, 1998 (type locality USA:

Nevada, Clark Co.) have been sequenced, along with a possible type specimen of E. clarus californicus

MacNeill, 1975 (type locality USA: California, El Dorado Co.). The Fst and Gmin between E. clarus

clarus and E. clarus huachuca are, 0.35 and 0.03 respectively, compared to those of 0.04 and 0.16

between FE. clarus huachuca and E. clarus profugus. The difference in COI barcodes of E. clarus clarus

and E. clarus huachuca is about 2% (~13 bp difference). For these reasons, we suggest that Epargyreus

huachuca Dixon, 1955 is a distinct species, new status, and it includes Epargyreus huachuca profugus

Austin, 1998, new combination, as a subspecies. We found that genetic differentiation between

populations of E. clarus californicus is lower than between others (Fig. 26, a tight cluster of specimens

with shorter terminal branches) suggesting either a recent dispersal or a bottleneck. Whether this genetic

purge resulted in any degree of reproductive isolation of E. clarus californicus from other groups of E.

clarus populations remains to be investigated.

Fig. 26. Epargyreus clarus (blue) and huachuca (red) with outgroups.

Nisoniades bromias (Godman & Salvin, 1894) is a species

distinct from Nisoniades rubescens (Méschler, 1877)

Considered a Junior subjective synonym of Nisoniades rubescens|17116A07|M|Mexico:Tamaulipas|1974

Nisoniades rubescens (Méschler, 1877) (type Co Ere eet pj calomna/1972

0.98

‘ - hag A N d b 4968(M|F he Id

locality Suriname), Pellicia bromias Godman & Nisoniades ephora} 18089603 panama(iged

= Nisoniades mimas|18059612/Peru/1982

Salvin, 1894 (type locality Mexico, Guatemala,

Costa Rica, Panama) reveals 1.2% (8 bp)

Fig. 27. Nisoniades bromias (red) and N. rubescens (blue).

difference in COI barcode, which by itself is not large enough to draw definitive conclusions, but it

prompted further investigation. The Fst/Gmin statistics computed on two pairs of specimens from distant

localities (Fig. 27) were 0.27/0.05, suggesting that Nisoniades bromias (Godman & Salvin, 1894),

reinstated status, is a distinct species.

Pholisora crestar J. Scott & Davenport, 2017 is a species

distinct from Pholisora catullus (Fabricius, 1793)

Recently described as a subspecies on the basis of wing pattern differences (Scott et al. 2017), Pholisora

catullus crestar J. Scott & Davenport, 2017 (type locality USA: California, Tulare Co.) was synonymized

with Pholisora catullus (Fabricius, 1793) + Pholisora catullus crestar | 1908302 ipsa CA,Tulare Co, ee a

l li "Indiis". likel a ee le eatullus catuls ee a CaSO Co.120i0| | 2006|/CSUC

(type locality "Indiis", likely eastern US) ee Baa lgcratcanuiiuistca: us| 10424 uADS Mewes Hideiceltobe

by Pelham (2020). As a part of on-going sae Brolasea els cata taie suas Menten psy fp 12042

i ? i hoalisora catullus eatiileeite 7O02(USA:TX,Jeft ae Co,]/2016

olisora mejicanus Olfax La, TREO

genomic sequencing inventory of the apc! Atel Gse NbE cote o eae?

Fig. 28. Pholisora crestar (red) and P. es (blue).

primary type specimens of Hesperiidae,

we obtained and analyzed whole genome shotgun reads of the holotype and two paratypes of crestar.

Surprisingly, their comparison with P. catullus populations from several distant localities revealed

prominent genetic differentiation (Fig. 28). Moreover, one of the crestar paratypes (from CA: Mono Co.,

NVG-17066H12, Fig. 28) apparently is P. catullus, not crestar. Fst/Gmin statistics for the crestar/catullus

comparison are 0.34/0.014, suggesting distinctness of crestar as a species. Gene exchange between

catullus and crestar (0.014) is very low (for conspecific populations it is typically above 0.1), strongly

supporting reproductive isolation between these taxa. Peculiarities of COI barcode evolution in Pholisora

have been reported previously by Pfeiler (2018) and COI barcodes of the crestar holotype and the catullus

specimen from Texas (NVG-3990) differ by 1.7% (11 bp). Due to strong genetic differentiation, we

suggest that Pholisora crestar J. Scott & Davenport, 2017, new status, is a species-level taxon.

Carterocephalus mandan (W. H. Edwards, 1863) and

Carterocephalus skada (W. H. Edwards, 1870) are species-level taxa and

not subspecies of Carterocephalus palaemon (Pallas, 1771)

Proposed as a species, Hesperia mandan W. H. Edwards, 1863 (type locality Canada: Manitoba) has

mostly been considered a subspecies of Carterocephalus palaemon (Pallas, 1771) (type locality Russia:

Samara Oblast) (Pelham 2008). Although it has been recently reinstated as a species (Pohl et al. 2010),

this suggestion was not universally followed (Pelham 2020). Genomic comparison of the Old and New

World palaemon-like populations reveals three clusters in the tree (Fig. 29): two corresponding to the

abovementioned taxa (red and blue), and the third one (green) for Carterocephalus palaemon skada (W.

H. Edwards, 1870) (type locality USA: AK, Kodiak) together with Carterocephalus palaemon magnus

Mattoon & Tilden, 1998 (type locality USA: California, Sonoma Co.). The largest separation is observed

between the Old World C.

Carterocephalus palaemon Me en ee aed Bp eerie Manitoba

- Carterocephalus palaemon mandan|16106E03|US4:MN,Lake of the Woods Co,

palaemon and the New Carterocephalus palaemon mandan|16106E02|USA:MN,Lake of the Woods Co

1 : Cart mee eae ee creed Ms. seatea Beak Fatbanks Nort Ne ton ¢

W arterocephalus palaemon skada oc 5 segrega 8 eton Co.

orld taxa. The Fst/Gmin : Carterocephalus palaemon eee CUS PAOBSIUSA CA,5 eal

ne 7 ; Carterocephalus palaemon magnus|PAO427 Usa ICA, Mendeene Co.

Statistics for the comparison ; Carterocephalus palaemon magnus|17109A05|HT|USA:CA,Sonoma Co.

: . pee ee ale PalaaieD nariis|17067C02|USA;CA,Sé Sonoma ( a Co,

: arterocephalus palaemon magnus

of pairs of these 3 clusters Careeiceenalun palaemon palaemon (=ab, peat soe

ll h l b L_ ey paseo palaemon| 17087808 Germany:Bay

a aoe alus palaemon palaemon

(we Ca t c green C uster iy: Carterocephal alaemo ee vente Rare a| Ruealet Orenburg Prov.

: , P Carterocaphalus silvicola(180 38G04| naga ee jatia

its oldest name: skada) are: Carterocephalus silvicolal 18092F07 |

Caitarnen ah aie Ueda eR eae ewaden

palaemon vs. mandan 0.50/

0.016, palaemon vs. skada

0.56/0.005, and mandan vs. skada 0.36/0.025. All of these numbers indicate strong genetic differentiation

and very low gene exchange between clusters. Analysis of COI barcodes reveals an unusual situation.

Fig. 29. Carterocephalus mandan (red), skada (green) and palaemon (blue).

First, barcode difference of palaemon vs. mandan is the same as palaemon vs. skada: 1.5% (10 bp).

Second, mandan barcodes are not much different from skada (0.3%, 2 bp), which can be explained by

introgression, but the mandan neotype and magnus holotype exhibit larger difference of 0.76% (5 bp)

between them. Third, for comparison, two widely sympatric Old World species C. palaemon and

Carterocephalus silvicola (Meigen, 1829) exhibit Fst/Gmin of 0.72/0.0006 (indicating very strong

isolation), but barcode difference between them is only 0.6% (4 bp). A number of similar instances of

distinct butterfly species not strongly different in their barcodes have been documented (Burns et al. 2008;

Cong et al. 2017), thus barcode differences and similarities cannot be considered separately from all other

evidence. In summary, we suggest to reinstate Carterocephalus mandan (W. H. Edwards, 1863) and

Carterocephalus skada (W. H. Edwards, 1870) as species, and additionally propose the following revised

combinations: Carterocephalus mandan mesapano (Scudder, 1868) and Carterocephalus skada magnus

Mattoon & Tilden, 1998.

Amblyscirtes arizonae H. Freeman, 1993 is a species

distinct from Amblyscirtes elissa Godman, 1900

Described as a subspecies of Amblyscirtes elissa Godman, 1900 (type locality Mexico: Guerrero), A. e.

arizonae H. Freeman, 1993 (type locality USA: Arizona, Santa Cruz Co.) has not caused much attention

being invariably kept as a subspecies —_ Amblyscirtes elissa arizonae|15096405|HT|M|USA:47 Santa Cruz Co

7 442 Amblyscirtes elissa arizonae|19064B12|M|USA:A42, Santa Cruz Co. [1986

(Pelham 2008). We sequenced primary *“amblyscirtes elissa arizonae|9685|F|USA:AZ,Santa Cruz Co. |2017

aa Steet or tan IL ‘Sonoral198s

1 ; Amblyscirtes elissa elissa|18083E05|ST|M|Mexico:Guerrero

type specimens of both A. €. arizonde - ay case elissa Sofa ecanace wince :Chiapas|1989

i . lyscirtes elissa elissa|19042G02|M|Mexico:Guerrero|1951

and A, elissa and compared them with = Amblyscirtes elissa elissa]19042603|M|Mexico:Morelos|1942

i ee mag Tale Ses Saeed Mexico:Tamaulipas, ae wrsvile|20

mblyscirtes celia/4501|/M|USA:TX,Cameron Co,E of Brownsville|2015

specimens from other localities. The amply sartes call S096Hos| St Ih|USArTX;Comal Co. CNINH

. . = “amblyscirtes célia|1671|/USA:TX,Travis Co, Platt Lane|2011

genomic tree revealed two prominent Amblyscirtes belli|i8025E02|HTIMIUSA‘TX,Dallas Co

. : : : es ae ‘TX, Dallas Co, ;Dallas|2015 Kl

Amblyscirtes belli[1240|/USA:TX Brazos Co,,Lick Creek Park]2013

clusters with separation similar to that = Sree tes eing|1os72iniUsa vache’ Rael Co,

2 : Amblyscirtes carolina|10672|M|USA:VvA,Chesapeake|1970

between A. belli H. Freeman, 1941 and AMnIgeTtaG carolina 18012C05|M|USA:NC,R aehmand Co.|1984

. — See sce s reversal aan aes (er VA, ;Nansemond a

; = Amblysecirtes reversa|18012C03|F(USA:NC Brunswick Co.[1995

A. celia Skinner, 1895, and between A. 04 “Amblyscirtes reversal 18012C06|M|USA:NC,Cumberland Co.{1984

AnibWEEirhae reversal 10673/M|USA:VA, Virginia Beach| 1971

carolina (Skinner, 1892) and A. reversa Fig. 30. Amblyscirtes arizonae (red), A. elissa (blue) and others.

F. Jones, 1926 (Fig. 30). The Fst/Gmin

statistics for them were 0.60/0.002, implying strong genetic differentiation and virtually no gene exchange

between these taxa. The COI barcodes of A. elissa and A. e. arizonae primary type specimens differ by

2.6% (17 bp). For these reasons, we suggest that Amblyscirtes arizonae H. Freeman, 1993 is a distinct

Species, new status.

Megathymus violae D. Stallings & Turner, 1956 is a species

distinct from Megathymus ursus Poling, 1902

Initially proposed as a species, Megathymus violae D. Stallings & Turner, 1956 (type locality USA: New

Mexico, Eddy Co.) was placed as a

dyggatyms ursus Baus ee hl ee AZ, Pima oak Rincon Mtns.

subspecies of Megathymus ursus

a os ursus ursus|2

athymus ursus ursus ve

siflega ymnus ursus usual ee

i Sado we ta ee core

Arizona, Pinal Co.) by dos Passos Ceapegethymus arsu scart sageeos MU MRAeN ARES GROSS,

(1960). Genomic comparison of a a Oe ga ec See

rae : Qdegathymus Ursus vislael 178) gan A NM Fon ae Co,

specimens of both taxa across their ee eccrine erie iaele USEC El Paso-Co..Franklin Mountains SP

uegathy mus ursus vio 2 i7fosoori TF A Guipersen Co [1955

ranges, including the holotypes, saga aehy mos unas asl sue ek of ca

revealed their prominent separation ae eitedathymus. ar sls Vilas) 2{d Hole sterco o fig Ben 15)8 National Bee

in the tree with the distance close to ofa dathymus Beulshse beulatlog Rest i guitare saalaoas 37

Apache Co.,SE of Holbrook

a Veaet ymus streckert streck ery

Meqathymus cofagqui cofaquili1 SEIE I is Gk. Burke Co. NW of Girar

that between Megathymus yuccae

(Boisduval & Le Conte, [1837]) and

Fig. 31. Megathymus ursus (blue) and violae (red), compared to others.

Megathymus beulahae D. Stallings & J. Turner, 1958 (Fig. 31). The Fst/Gmin statistics for comparison of

ursus and violae groups are 0.56/0.001 (note close to 0 gene exchange between these taxa). The COI

barcodes of the WM. ursus and M. violae holotypes differ by 1.8% (12 bp). For these reasons, we reinstate

Megathymus violae D. Stallings & Turner, 1956 as a species-level taxon.

Discussion: genomic trees, branch lengths and genera

Near the end, coming back to the Introduction, we elaborate on and illustrate the reasons behind the

classification decisions that we have chosen to make about genera. Traditionally, species were grouped

into genera by phenotypic characters. For butterflies, these were mostly wing patterns and shapes, and

genitalic morphology. When differences in these phenotypic aspects were deemed to be significant

enough according to a subjective opinion of an individual researcher, they formed a basis for defining a

genus. This system served its purpose until a consensus opinion was formed among taxonomists that each

genus should be monophyletic. It is exceedingly difficult to predict monophyletic taxa from their

phenotypes, and DNA-based phylogenetic trees provide the most reliable inference of monophyletic

groups. Therefore, genera should be defined using phylogenetic trees constructed from DNA sequences.

Each individual feature of an organism can experience rapid evolution and fool researchers into

making incorrect classification decisions. Genitalia that are commonly used in Lepidoptera classification

are prone to such rapid changes as well. For instance, Steinhauser (1989) proposed a genus Thessia on the

basis of unique shape of genitalic valvae. However, even a very short, 654 base pair region of DNA, such

as the COI barcode, reveals the paraphyly of Achalarus Scudder, 1872 (as it was circumscribed at that

time) with respect to Thessia (Pfeiler et al. 2016), suggesting that the unique valva is a result of

accelerated evolution within Achalarus rather than a character originated after Thessia and Achalarus

have (supposedly) diverged from each other. Therefore, a decision to erect the genus Thessia was a

mistake, because Thessia is a subclade within (as it was then defined) Achalarus. Nevertheless, the

barcode DNA region itself is a single feature, and as any other such feature, can experience evolutionary

irregularities. To reduce such mistakes, it is better to use information from as many features as feasible.

Complete genomes offer the ultimate DNA dataset for classification decisions. Genomic analysis suggests

that Achalarus itself is a junior subjective synonym of the subgenus Thorybes Scudder, 1872, and Thessia

is actually a junior subjective synonym of the subgenus Murgaria E. Watson, 1893 (Li et al. 2019).

Genomic trees summarize integral information about the entire organism, not just some of its

features. For this reason, we use them to make decisions about classification of genera. Here, we explain

how we atrive to these decisions using examples from this work and our previous publication (Zhang et

al. 2019c). A maximum likelihood tree constructed using IQ- TREE program (model GTR+I+G) (Minh et

al. 2020) from concatenated protein-coding regions of nuclear genomes is shown in Fig. 32. To best

follow our logic, a reader may close the tree on the right (Fig. 32b, the final result) and look only at the

tree on the left (Fig. 32a), which is the same as the tree on the right, but without the final results being

marked in order not to bias the reader. This tree was constructed without assuming a molecular clock and

reveals differences in evolutionary rates between species: 1.e., species names are placed at difference

distance from the left side of the page (=from the root of the tree). We see that Emesis evolved the fastest

(the farthest from the left), and Ephyriades Hubner, [1819] evolved the slowest (closest to the left). In a

tree, only horizontal (left-to-right) distances matter. Vertical (top to bottom) distances are arbitrary and

are set to place species names evenly along vertical dimension, so that the names do not overlap and are

not too far away from each other to save space.

Tree branches have different lengths. Again, only horizontal branches have evolutionary meaning,

and vertical lines in the tree are set to avoid overlap of names and to connect branches to nodes. The

length of a horizontal branch is proportional to the number of estimated changes in DNA (=fixed

mutations) that happened along the branch. The tree has a scale bar near the bottom (Fig. 32). The length

of that bar, as indicated, corresponds to 6 changes per 100 base pairs (=0.06, or 6%). Using this bar, we

can measure evolutionary distances between taxa in DNA changes. Long branches correspond to many

Ephyriades doraiieens ls teO 2407 Ephyriades dominic neers

7 Ephyriades arcas|17095D09 z Ephyriades arcas|17095D09

Ephyriades brunnea]17095E06 Ephyriades brunnical 12033506

Erynnis pelias|18068D08 Erynnis pelias|18068D08

,Erynnis marloyi]17107A11 Erynnis marloyi]17107A11

ge4 Erynnis pathan|18068D01 gaa Erynnis pathan|18068D01

264 Erynnis montanus]18068C09 E |\-°Serynnis montanus|18068C09 :

1$FErynnis tages|18022H04 i>‘Erynnis tages|18022H04 Erynnis

i Erynnis popoviana|18038G02 i Erynnis popoviana|18038G02

Erynnis eclusielos Erynnis eelusibiad

q*_ Erynnis lacustra|18035A07 Q Erynnis lacustra eae ao?

tegynnis brizo|6120 obfynnis brizo]6120

rynnis somnus|8286 rynnis somnus|8286

—oea Erynnis martialis] 3900 oe4 Erynnis martialis|3900

—" Erynnis pacuvius[9770 = Erynnis pacuvius]9770

f Epynnis scudderi|9725 7 Egynnis scudderi[9/725

yErynnis Tune rally [te0e ;Erynnis funeralis|4208

1 Erynnis zarucco|4753 i Erynnis ZarUCeg Eos

Erynnis persius|6567 Erynnis persius|6567

LErynnis giranius| £71 12A03 1 Erynnis atrantie Tr ta0s

oe Sek Onis lucilius|18014B07 oe Uekynnis lucilius|18014B07

; rynnis baptisiae|3907 rynnis baptisiae|3907

1 Erynnis horatius|3678 , Erynnis herstiis)ie7 6

1 Erynnis tristis]9715 ; Erynnis tristis]9715

Erynnis meridianus|18022E03 1 Erynnis meri janie] 1BOF2E03 Gesta

Erynnis propertius|PAQ21 G Erynnis propertiusi| A021

1 Bryndis Wuvenells4 610/7D08 , Erynnis juvenalis|16107D08

— Erynnis Sec e Erynnis Shean eo

, Gesta austerus|13386B06 , Gesta austerus|13386B06

r -Gesta austerus|13386B07 , -Gesta austerus|13386B07

t~, Gesta heteropterus|13386B04 , Gesta heteropterus|13386B04

1 Gesta heteropterus|13386B05 ,'— Gesta heteropterus|13386B05

Gesta invisus|19015G09 Gesta Invisus|19015G09

Gesta invisus|}6818 , Gesta invisus|6818

yGesta gesta/10417 iGesta gesta/10417

Gesta gesta|19015H06 | Gesta gesta|19015H06__

Hypaurotis crysalus ame ee H Hypaurotis crysalus

F 17117A05 | =

Lo sfavonius querctis| 200 “ofavgnius quercls 20639A04 Hypaurotis

1 abrodais grunus|PAO466 1 rodais grunus|PAO

Minis man Be TOROS M —— Minis prion "anevicroy) | Mi - t

inistrymon janevicro inistrymon janevicro rym

o8 Ministrymon sereslsou os Ministrymon serss(o2t ints on

Pseudonymphidia clearista|19031A07 P —— Pseudonymphidia clearista

1 oa Roeberella fe peas | Tor Ato 1 [es Bechythone welezauer 9HOS Pach thone

ac one velazquezi velazquezi

if Pachythone strati| 79031 09 ah Pachythone Saab S4 hoo y

Pachythone erebia]19129C01 —— Pachythone erebia]19129C01

O78 Emesis lucinda]|18044B02 E Emesis lucinda|18044B02

1 * Emesis poeas|18044G02 1 Emesis poeas|18044G02

Emesis mandanal eg tb09 —— Emesis mandana eo Ebo9 E z

A Emesis brimo|18045E01 Emesis brimo|18045E01 mesis

0-46 Emesis tenedia|18044H06 Emesis tenedia|18044H06

pa. Emesis fatimella|18044G08 1 Emesis fatimella] 18044G08

1 Emesis cereus|18045C06 1 Emesis cereus|18045C06

Curvie emesia|5245 >———. Currvie emesia|5245

Apodemia ares|17114HO1 Apodemia ares|17114HO1

o.ze\podemia arnacis|18045F11 ae podem arnacis|18045F11

ak podemia zela cleis|8217 podemia zela cleis]8217

I Apodemia nais|17066F02 Apodemia nais|17066F02

ns Apodemia nais|PAO145 Apodemia nais[|PAQ145 5

T Apodemia mormo|17107E02 Apodemia mormo|17107E02 Apodemia

L Apodemia multiplaga| 7635 Apodemia multiplaga| 7635

Apodemia hypoglauca|18048C11 A Apodemia hypoglauéa|

i oeberella calvus|18054E06 i, . Roeberella calvus] 18054E06

p.Apodemia hepburni|17066E05 —, Apodemia hepburni|

; ““Apodemia walkeri| a4 “~"Apodemia walkeri|4514

- Apodemia Balinerit| 0226 1

rT Smyrna blomfildia|17117HO9

Smyrna _karwinskil|17118B06

Aglais io| PAOE20

,Aglais milberti|9460

Aglais cca AOE19

olygonia interposita|19122B06

tRglygonia faunus|PAO270

Pol gonia c-album|PAOE

- Apodemia palmenliTo226

Smyrna blomfildia]17117HO9

Sunyrna kane | 7.18B06

Aglais io] PAOE20

,Aglais milberti[9460

Agials orcas | AOEL9

‘olygonia interposita|19122B06

oRglygonia faunus|PAQ270

rol gonia c-album|PAOE08

AOE08

7s E Polygonia interrogationis|6030 olygonia interrogationis|6030

1Polygonia comma|1711/D09 ; Polygonia comma|17117D09 .

Polygonia satyrus|PAO42 Folygania satyrus|PAO42 N m halis

Polygonia haroldii|17115B06 _ Polygonia hatoldil| 17115B06 ymp

1Polygonia gracilis] PAQ246 i ygoma gracilis| PAQ246

;Polygonia progne|17115B04 ,Po! ygouie progne|17115B04

olygonia oreas|17115B05 olygonia operas ity TteO?

1 Nymphalis |-album|17115B03 Nymphalis l-album|17115B03

Nymphalis pol Cho nOe Wate as Nymphalis polychloros|19093E04

1 Nymphalis cali ornlea| 635 1 Nymphalis cali Bence 635

ymphalis cyanomelas|15101E03 rt yenpnalis cyvanome as|15101E03

Nymip alis antio aleese Nye alis antiopa| 8980

, Vanessa caryelt 121H08 , Vanessa carye]19121H08

Vanessa annabella|9614 1 Vanessa annabelialacis

i , Vanessa itea|19122A11 ——_f 1 Vanessa itea|19122A11

Vanessa gonerilla]19122A12 Vanessa gonerilla[i9122A12

ata Vanessa kershawi[19121H09 V Vanessa kershawi[i9121H09 Vanessa

0. Vanessa cardui|8641 o-—— Vanessa cardui|8641

; Vanessa terpsichore]19121H06 ; Manessa terpsichore]19121H06

1 Vanessa virginiensis|3866 1 Vanessa virginiensis|3866

Vanessa tameamea|17115B02 7,, Vanessa tameamea|17115B02

Vanessa atalanta|9826_ Vanessa atalanta|9826_

i Euptoieta hegesia|3374 uptoieta egesia 13374

Euptoieta claudia|3706 Euptoieta claudia|3706

Boloria eunomia|17114HO7 Boloria eunomia|17114HO7

7 Boloria Se en oar a Boloria alaskensis|17115A07

* Boloria astarte|17115A01 Boloria astarte|17115A01

pies ,Boloria polaris|17114H11 ,Boloria polaris|17114H11

: Boloria alberta|17119E11 Boloria alberta/17119E11

Boloria selene|17114HO08 Boloria selene|17114H08 a

_ Boloria chariclea|6356 Boloria chariclea|6356 Boloria

P- , Boloria natazhati|17115A02 , Boloria natazhati]17115A02

076 Boloria freija|18037HOL Boloria freija|18037HO1

1 ‘- Boloria frigga|17114HO9 r- Boloria frigga |1 74140109

,Boloria kriem ee ;Boloria kriemhild|9479

; Boloria epithore|PAO77 ; Boloria epithore|PAO77

oria improba/i7115A09 Boloria improba/17115A09

oloria peroneal ene oloria palahe uae

Argynnis eocioelt 1077C04 Argynnis japdlcat 077C04

——— 7 .Argynnis sagana]19077C06 7. Argynnis sagana 9077C06

0.06 7 Argynnis paphia|PAOQE21 0.06 Argynnis pap Pepe!

Argynnis niobe|PAOE16 A Argynnis niobe|PAOE16

Speyeria idalia|17115A04 Speyeria idalia|17115A04

1 Speyeria nokomis|18062B01

ogpeyeria diana|9190

8: eyeria aphrodite|PAOQ220

ogpeyeria nese 1628

Speyeria atlantis| 19065C03

oapeyerla mormonia|9380

1 Speyeria nokomis|18062B01

oSpeyeria diana|9190

oppeyeria cybele|9191

eyeria ppnre He eee

eyeria hesperis .

# everia atlantis| {9065C03 Argynnis

ogpeyerla mormonie I 0

peyeria edwardsii|PAO218

eyeria edwardsii|PAO218

@ peveria Seer aloe eyeria zerene|9626

‘Speyeria carolac [18028402 “‘Speyeria carolae baeerene

eyeria coronis|PAQ143 eyeria coronis|PAQ143

eyeria a aeeliaeess ee oppeyeria adiaste| ee

oapeyeria hycaspe [943

eyeria callippe

Beveria Sere soe

O°

peye

eyeria hydaspe |943

a ss cafione (pate b

eyeria egleis|9532

Fig. 32. Delineating genera using a tree constructed from nuclear genomes: unmarked (a) and colored by suggested genera (b).

changes in genomic DNA. Short branches correspond to few changes in genomic DNA. Because larger

number of DNA changes are expected to result in larger number of phenotypic changes, longer branches

correspond to more phenotypic changes on average. These are integral changes and some of them may be

in genitalia, others may be in caterpillar morphology. Regardless of where these changes are, longer

branches are more important than shorter branches. In addition to larger number of changes, longer

branches are also more reliable and support clades that are more likely to be correct. The statistical

reliability of every clade is indicated by a number next to each node. This number is a fraction of trees

(out of 100 trees constructed from various subsets of genomic segments) that contain this node, e.g. a

genome was divided into 100 segments and each segment was used to generate a tree. If a particular node

is present in all 100 trees, the number by that node is 1. Therefore, this number measures consistency

between trees constructed from different partitions of the data. If every DNA segment supports a clade, it

has a number | next to it. If 94 out of 100 segments support the clade, the number is 0.94.

A genus should be a prominent, major clade in the tree that is above species level and below tribe

and subtribe levels. Phenotypic features are difficult to quantify, and due to the possibly uneven speed of

evolution, it is a challenge to determine which phenotypic changes correspond to major clades. Total

genomic changes can be used as a yardstick to quantify each clade. The number of total genomic changes

is proportional to branch lengths in genomic trees (Fig. 32a). Therefore, the task of identifying genera

may be viewed as a task of identifying prominent (i.e. supported by longer branches compared to

surrounding branches) clades in genomic trees that on average correspond to how genera are defined

currently (to avoid unnecessary taxonomic changes). Additionally, we believe that each genus should not

be very different from another genus in terms of genetic differentiation of species placed in a genus, L.e.

genera could be defined consistently, so that genera correspond to clades of approximately the same

differentiation within. Defined consistently, the genus becomes a level (as meant by this word) of a

classification instead of several varying levels, i.e., we can expect a genus to be a group of species bearing

about the same relatedness among them as that in other genera. It would seem unnatural if one

phylogenetic group is oversplit into genera, i.e. genera in that group correspond to very closely related

species, but another group is undersplit, and genera in it correspond to species that are only distantly

related. The measure of closeness as we use it, is overall genomic divergence.

Looking at the clade of Hesperiidae at the top of the tree (Fig. 32a) we see three major clades, not

two and not four. The first clade is Ephyriades and is sister to all other taxa. Then all others split into two

clades of similar genetic differentiation within each clade. We see that each of these clades resembles a

tight bush or a comb, rather than an evenly bifurcating tree, i.e. the internal branches in either clade are

much shorter than a branch that supports the entire clade. The clade with Gesta bifurcates into two

subclades, one consists of Gesta sensu stricto (s. s.). Species from the other subclade were called

"Erynnis" previously (and are called Erynnis in the tree to facilitate communication): it is a subgenus

Erynnides Burns, 1964 (type species Nisoniades propertius Scudder & Burgess, 1870). If we consider

these two subclades to be major clades, then the Hesperiidae tree would consist of four major clades

(Ephyriades, Erynnis s. s., Erynnides and Gesta). However, the branches supporting the two subclades

(Erynnides and Gesta) are nearly three times shorter than the branches supporting the clades Erynnis s. s.

and a clade combining Erynnides with Gesta. Therefore, the Hesperiidae subtree should not be partitioned

into four major clades, because two of these clades (Erynnides, Gesta) would be minor compared to the

other two, and more importantly, compared to the clade combining Erynnides with Gesta.

The remaining alternative to a three-clade partitioning would be a two major clade partition, where

Erynnis s. s., Erynnides and Gesta are all joined together into Erynnis sensu lato (s. |.) The branch

supporting this clade is only slightly shorter than the branch supporting Erynnis s. s., and therefore this

clade is rather prominent in the tree. We reject this solution for the two reasons. First, Erynnis s. |. is not a

homogenous group of species, which we think a genus should be, i.e. the Erynnis s. |. clade does not look

like a bush or a comb. Instead, it splits into two major clades: Erynnis s. s. and Erynnides + Gesta, (we

call this clade Gesta s. |. from now on) each of which individually looks more like a comb than when they

are combined. In other words, Erynnis s. |. itself is composed of two major clades, and does not represent

a Single group of species, but two major groups of species.

The second reason stems from consistency between different genera, i.e. an idea that different genera

should represent the same level in the classification (Fig. 33). Being a level, genera should be groups of

species with comparable divergence within each genus. In this tree (Fig. 32a), where all branches are to

scale, we can compare divergence between Erynnis s. s. and Gesta s. |. to the divergence in Nymphalidae

previously placed in genera Aglais, Polygonia, Nymphalis, and Vanessa. These two subtrees (Erynnis and

Vanessa) are illustrated in Fig. 33. Genetic differentiation of a clade is proportional to the average

distance (average sum of branch lengths) from the last common ancestor of the clade (=node that supports

the entire clade) to the leaves (=species) in the clade. In other words, it is a linear distance (in horizontal

dimension) from the base of the clade to the tips of the tree. On the one hand, we see that Polygonia

divergence is rather small, perhaps comparable to the divergence of the Erynnides subclade with horatius

and juvenalis, and definitely smaller than the divergence within either Erynnis s. s., or Gesta s. |. On the

other hand, the divergence of Erynnis s. 1. is larger than

the divergence of Aglais, Polygonia, Nymphalis and

Vanessa combined. Therefore, having Erynnis s. |. as a

genus is inconsistent with having Polygonia as a genus:

these two groups represent different levels in the

classification. Coming back to Nymphalidae, we see that

branches supporting Aglais, Polygonia and Nymphalis

individually are much shorter than the branches

supporting Erynnis s. s. or Gesta s. 1. Only the branch

supporting Vanessa is somewhat comparable, although

shorter. However, the branch supporting the first three

clades together (Nymphalis s. |.) is more prominent and

is about the same as the branch supporting Vanessa.

In summary, Erynnis s. |. is comparable to Vanessa

s. 1. (Nymphalis s. \. + Vanessa s. s.). A system of two

long,

prominent

branch

~E |

_ Erynnis icelus

Erynnis lacus ra

r o&kynnis brizo|61

rynnis pacuvius

Erynnis scudderi|

i{Erynnis funeralis

+ ‘Erynnis zarucco

- .Erynnis persius|

oo”

prominent

branch

mom

ynnis afranius

‘eeynnis lucilius|

ynnis baptisia

nnis horatius

rynnis tristis|9

rynnis meridian

rynnis propertiu

rynnis juvenalis

elemach

ERu

ly ,Gesta gesta

shorter

branches

Gesta gesta|1

sapiuuAlg

1's smuAsg

|~5.5% bp change

__darre ta cs

| _|~4t.7% bp change

genera (Erynnis s. s. and Gesta s. |.) is comparable to two Aglais io|PAQE2O .

genera Nymphalis s. |. and Vanessa s. s. We attempt to Balygonia interposita

choose an internally consistent solution that agrees the 1 Iygonia c-album|PAOE

yy, g Polygonia interrogationis

most with how these species are assigned to genera in the

current classification. Therefore, we choose the 2-genus

solution for both of these cases, as shown in Figs. 32b

(colored clades E: Erynnis, G: Gesta, N: Nymphalis and

V: Vanessa) and 33 (shaded clades). These four genera

represent a similar level in the classification and correlate

with the current classification of these butterflies. The

choice of Erynnis s. |. would correspond to a consistent

choice of joining all four Nymphalidae genera in

Vanessa, which may represent too much of a lump and

more name changes (Fig. 33).

Another point is that genetic differentiation can be

used to estimate divergence times of these clades through

the tree rescaling and calibration with fossils (primary

calibration) (Chazot et al. 2019) or other time-calibrated trees (secondary calibration) (Zhang et al.

2019a). As we have seen in Hesperiidae (Li et al. 2019), the genus level typically corresponds to

divergence between 10 and 15 million years ago (Mya). Divergence of Erynnis s. |. was estimated to be

about 27 Mya, which is larger than the divergence between Vanessa s. s. and Nymphalis s. |., at about 22

Mya (Zhang et al. 2019d). However, divergences within Gesta s. 1. (~16 Mya), Vanessa s. s. (~16 Mya)

and Nymphalis s. |. (~14 Mya) (Zhang et al. 2019d) are very much comparable to each other, and these

genera represent groups of about the same level. It should be noted that the divergence times are only

approximate, should be considered with caution, and may have errors of possibly up to 50%, especially in

groups with large differences in evolutionary rates. However, the relative comparison of divergence times

estimated within the same tree using the same method is expected to be more accurate.

Finally, a question arises about how these considerations of trees, branch lengths, divergence and

geological times correlate with genera definition based on phenotypic characters. Because phenotypic

characters are encoded by the genotype, longer branches in the tree that correspond to more changes in a

genotype (these are integral genomic trees, not based on several gene markers) should translate to more

changes in the phenotype. We advocate a method to delineate genera from genomic trees first, and then

come back to phenotypic analysis to find the phenotypic characters that correspond to these genera. In the

case of Erynnis and Gesta, the retrospective inspection of morphological characters yields substantial

differences in male genitalia that have been noted and illustrated previously (Evans 1953; Burns 1964).

The uncus is asymmetric, terminally broad in Gesta, but is symmetric, extending into a "beak" in Erynnis.

syeyduiAn

<—

|S essoue/,

— Vanessa cardui|8

— Manessa terpsichore

i — Vanessa virginiensis

prominent —

7,, vanessa tameamea

- Vanessa atalantal982

branches

Taxonomic levels:

(correspond to similar

divergence in DNA)

Scale bar

6% bp change

SNUuUSss£) ESSOUE/

snuad peog

Fig. 33. Taxonomic levels gleaned from trees to

correspond to similar levels of divergence between

taxa of the same taxonomic level.

The valvae are strongly asymmetric with at least one extended harpe in Gesta, but are more symmetric

with shorter harpes in Erynnis. Other differences are stated in the diagnosis of Erynnides by Burns (1964).

Comparing the clades of other groups in Fig. 32a with Erynnis/Gesta and Nymphalis/Vanessa we see

that divergence within Speyeria and Roeberella (a clade containing R. clavus and with Apodemia

hypoglauca at its base), and divergence between Hypaurotis, Favonius and Habrodais is much smaller

than that in the groups we define as genera. We also see that the colored clades (with letters denoting

corresponding genera by each clade) in Fig. 32b are more or less equivalent to each other in terms of

genetic differentiation (distance from the base of the clade to its tips) and prominence (length of the

branch supporting the clade). For these reasons, we suggest that these clades can be treated as genera:

they are prominent, consistent, and reasonably well correspond to how genera have been defined

previously. The changes we suggest combine some more compact in terms of genetic (and phenotypic)

differentiation genera into more internally diverse genera that become more consistent with the

differentiation within many classic genera such as Emesis, Ministrymon, Vanessa, and Boloria.

ACKNOWLEDGMENTS

We acknowledge Ping Chen, Leina Song, and Ming Tang for excellent technical assistance. We are

grateful to David Grimaldi and Courtney Richenbacher (AMNH: American Museum of Natural History,

New York, NY, USA), Blanca Huertas, David Lees and Geoff Martin (BMNH: Natural History Museum,

London, UK), Jonathan P. Pelham (BMUW: Burke Museum of Natural History and Culture, Seattle, WA,

USA), Vince Lee and the late Norm Penny (CAS: California Academy of Sciences, San Francisco, CA,

USA), Jim Fetzner and John Rawlins (CMNH: Carnegie Museum of Natural History, Pittsburgh, PA,

USA), Boris Kondratieff (CSUC: C. P. Gillette Museum of Arthropod Diversity, Fort Collins, CO, USA),

Chris Schmidt and Christi Jaeger (CNC: Canadian National Collection of Insects, Arachnids and

Nematodes, Ottawa, Ontario, Canada), Crystal Maier and Rebekah Baquiran (FMNH: Field Museum of

Natural History, Chicago, FL, USA), Weiping Xie (LACM: Los Angeles County Museum of Natural

History, Los Angeles, CA, USA), Andrew D. Warren and Debbie Matthews-Lott (MGCL: McGuire

Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, University of Florida,

Gainesville, FL, USA), Rodolphe Rougerie (Muséum National d'Histoire Naturelle, Paris, France),

Matthias Nuss (MTD: Museum fiir Tierkunde, Dresden, Germany), Helen Vessels (NMSU: New Mexico

State University, Las Cruces, NM), Edward G. Riley, Karen Wright, and John Oswald (TAMU: Texas

A&M University Insect Collection, College Station, TX, USA), Alex Wild (TMMC: University of Texas

Biodiversity Center, Austin, TX, USA), Jeff Smith and Lynn Kimsey (UCDC: Bohart Museum of

Entomology, University of California, Davis, CA, USA), Robert K. Robbins, John M. Burns, and Brian

Harris (USNM: National Museum of Natural History, Smithsonian Institution, Washington, DC, USA),

Wolfram Mey and Viola Richter (ZMHB: Museum fiir Naturkunde, Berlin, Germany) for granting access

to the collections under their care, help with sampling specimens and for stimulating discussions; to

David H. Ahrenholz, Austin Baldini, Ernst Brockmann, Jim P. Brock, Jack S Carter, Matthew J. W. Cock,

Bill R. Dempwolf, Mathew Garhat, Chuck Harp, Greg Kareofelas, Paul Johnson, the late Edward C.

Knudson (TLS: Texas Lepidoptera Survey, specimens now at MGCL), Jeremy J. Kuhn, Tim McNary,

Harry Pavulaan, James A. Scott, John A. Shuey, Jeff R. Slotten, and Mark Walker for specimens,

including those collected in RNAlater for better preservation, and leg samples, to Gerardo Lamas and

Olaf H. H. Mielke for discussions, to Jonathan P. Pelham and Ken Davenport for insightful discussions

and critical review of the manuscript. Evi Buckner-Opler assisted by providing emotional and logistic

support and helped to collect specimens. We are indebted to California Department of Fish and Game for

collecting permit SC13645, Texas Parks and Wildlife Department (Natural Resources Program Director

David H. Riskind) for the research permit 08-02Rev, to U. S. National Park Service for the research

permits: Big Bend (Raymond Skiles) for BIBE-2004-SCI-0011 and Yellowstone (Erik Oberg and Annie

Carlson) for YELL-2017-SCI-7076 and to the National Environment & Planning Agency of Jamaica for

the permission to collect specimens. We acknowledge the Texas Advanced Computing Center (TACC) at

The University of Texas at Austin for providing HPC resources. The study has been supported in part by

grants from the National Institutes of Health GM127390 and the Welch Foundation I-1505.

LITERATURE CITED

Aardema, M. L., and P. Andolfatto. 2016. Phylogenetic incongruence and the evolutionary origins of cardenolide-

resistant forms of Na(+) ,K(+) -ATPase in Danaus butterflies. Evolution 70(8): 1913-1921.

Ackery, P. R., and R. I. Vane-Wright. 1984. Milkweed butterflies: their cladistics and biology. British Museum

(Natural History); London. x+425

Aldhebiani, A. Y. 2018. Species concept and speciation. Saudi J Biol Sci 25(3): 437-440.

Allio, R., C. Scornavacca, N. Benoit, A. L. Clamens, F. A. H. Sperling, and F. L. Condamine. 2019. Whole genome

shotgun phylogenomics resolves the pattern and timing of swallowtail butterfly evolution. Systematic Biology

69(1): 38-60.

Austin, G. T., and M. J. Smith. 1998. Revision of the Thessalia theona complex (Lepidoptera: Nymphalidae:

Melitaeinae). Jn: Emmel, T. C. (Ed.). Systematics of Western North American Butterflies. Mariposa Press;

Gainesville, pp. 359-396.

Bland, K. P. 2019. Name-bearing types of butterflies (Lepidoptera, Papilionoidea), in the National Museums of

Scotland, Edinburgh. Zootaxa 4559(1): 57-89.

Burns, J. M. 1964. Evolution in skipper butterflies of the genus Erynnis. University of California Press; Berkeley and

Los Angeles. iv + 214

Burns, J. M., D. H. Janzen, M. Hajibabaei, W. Hallwachs, and P. D. Hebert. 2008. DNA barcodes and cryptic

species of skipper butterflies in the genus Perichares in Area de Conservacion Guanacaste, Costa Rica. Proc

Natl Acad Sci U S A 105(17): 6350-6355.

Burns, J. M., D. H. Janzen, M. Hajibabaei, W. Hallwachs, and P. D. N. Hebert. 2007. DNA barcodes of closely

related (but morphologically and ecologically distinct) species of skipper butterflies (Hesperiidae) can differ by

only one to three nucleotides. J. Lep. Soc. 61(3): 138-153.

Chazot, N., N. Wahlberg, A. V. L. Freitas, C. Mitter, C. Labandeira, J. C. Sohn, R. K. Sahoo, N. Seraphim, R. de

Jong, and M. Heikkila. 2019. Priors and Posteriors in Bayesian Timing of Divergence Analyses: The Age of

Butterflies Revisited. Syst Biol 68(5): 797-813.

Claridge, M. F. 2017. Insect Species — Concepts and Practice. /n: Foottit, R. G., and P. H. Adler (Eds.). Insect

Biodiversity: Science and Society. John Wiley & Sons; Chichester, UK, pp. 527-546.

Cong, Q., D. Borek, Z. Otwinowski, and N. V. Grishin. 2015. Tiger swallowtail genome reveals mechanisms for

speciation and caterpillar chemical defense. Cell Reports 10(6): 910-919.

Cong, Q., J. Shen, D. Borek, R. K. Robbins, P. A. Opler, Z. Otwinowski, and N. V. Grishin. 2017. When COI

barcodes deceive: complete genomes reveal introgression in hairstreaks. Proceedings of the Royal Society B:

Biological Sciences 284(1848): 20161735.

Cong, Q., J. Shen, J. Zhang, W. Li, L. N. Kinch, J. V. Calhoun, A. D. Warren, and N. V. Grishin. 2019a. Genomics

reveals the origins of ancient specimens. bioRxiv BIORXIV/2019/752121.

Cong, Q., J. Zhang, and N. V. Grishin. 2019b. Genomic determinants of speciation. bioRxiv BIORXIV/2019/837666.

de Jong, R., and K. van Dorp. 2006. The African copper connection. Entomologische Berichten. Amsterdam 66(4):

124-129.

De Moya, R. S., W. K. Savage, C. Tenney, X. Bao, N. Wahlberg, and R. I. Hill. 2017. Interrelationships and

diversification of Argynnis Fabricius and Speyeria Scudder butterflies. Systematic Entomology 42(4): 635-649.

Dereeper, A., V. Guignon, G. Blanc, S. Audic, S. Buffet, F. Chevenet, J. F. Dufayard, S. Guindon, V. Lefort, M.

Lescot, J. M. Claverie, and O. Gascuel. 2008. Phylogeny.fr: robust phylogenetic analysis for the non-

specialist. Nucleic Acids Res 36(Web Server issue): W465—W469.

Dictionary.com LLC. 2020. <https://www.dictionary.com/browse/sautoir>. Accessed 1 Nov. 2020.

dos Passos, C. F. 1960. Taxonomic notes on Nearctic Rhopalocera. 1. Hesperioidea. Journal of the Lepidopterists'

Society 14(1): 24-36.

Draudt, M. W. K. 1921. B. Grypocera, breitkopfige Tagfalter. /n: Seitz, A. (Ed.). Die Gross-Schmetterlinge der Erde.

Alfred Kernen; Stuttgart, p. 850, pl. 165f.

Dunford, J. C. 2009. Taxonomic overview of the greater fritillary genus Speyeria Scudder and the atlantis - hesperis

species complexes, with species accounts, type images, and relevant literature (Lepidoptera: Nymphalidae).

Insecta Mundi 0090: 1-74.

Eliot, J. N. 1973. The higher classification of the Lycaenidae (Lepidoptera): a tentative Arrangement. Bulletin of the

British Museum of Natural History (Entomology) 28(6): 373-505.

Emmel, T. C., and G. T. Austin. 1998. What is Argynnis carolae? The cytotaxonomy and systematic position of a

Speyeria relic from Nevada (Lepidoptera: Nymphalidae). /n: Emmel, T. C. (Ed.). Systematics of western North

American butterflies. Mariposa Press; Gainesville, pp. 443-450.

Espeland, M., J. Breinholt, K. R. Willmott, A. D. Warren, R. Vila, E. F. A. Toussaint, S. C. Maunsell, K. Aduse-

Poku, G. Talavera, R. Eastwood, M. A. Jarzyna, R. Guralnick, D. J. Lohman, N. E. Pierce, and A. Y.

Kawahara. 2018. A comprehensive and dated phylogenomic analysis of butterflies. Current Biology 28(5):

770-778.

Espeland, M., J. W. Breinholt, E. P. Barbosa, M. M. Casagrande, B. Huertas, G. Lamas, M. A. Marin, O. H. H.

Mielke, J. Y. Miller, S. Nakahara, D. Tan, A. D. Warren, T. Zacca, A. Y. Kawahara, A. V. L. Freitas, and

K. R. Willmott. 2019. Four hundred shades of brown: Higher level phylogeny of the problematic Euptychiina

(Lepidoptera, Nymphalidae, Satyrinae) based on hybrid enrichment data. Mol Phylogenet Evol 131: 116-124.

Evans, W. H. 1952. A catalogue of the American Hesperiidae indicating the classification and nomenclature adopted in

the British Museum (Natural History). Part I. Pyrginae. Section I. British Museum (Natural History). London. v

+ 178 pp., pls. 10-25.

Evans, W. H. 1953. A catalogue of the American Hesperiidae indicating the classification and nomenclature adopted in

the British Museum (Natural History). Part HI. Pyrginae. Section 2. British Museum (Natural History); London.

v + 246 pp., pls. 26-53.

Garth, J. S. 1934. Butterflies of Yosemite National Park. Bulletin of the Southern California Academy of Sciences 34:

37-75.

Gascuel, O. 1997. BIONJ: an improved version of the NJ algorithm based on a simple model of sequence data. Mol Biol

Evol 14(7): 685-695.

Geneva, A. J., C. A. Muirhead, S. B. Kingan, and D. Garrigan. 2015. A new method to scan genomes for

introgression in a secondary contact model. PLoS One 10(4): e0118621.

Godart, J. B. 1819. Pp. 13-328, in: Latreille, P. A., and J. B. Godart (Eds.), Encyclopédie Méthodique. Histoire

naturelle. Entomologie, ou histoire naturelle des crustacés, des arachnides et des insectes. veuve Agasse; Paris,

pp. 328.

Godman, F. D. 1907. Notes on the American species of Hesperiidae described by Plétz. Annals and Magazine of natural

History (7)20(16): 132-155.

Godman, F. D., and O. Salvin. 1896. On the butterflies of St. Vincent, Grenada, and the adjoining islands of the West

Indies. Proceedings of the zoological Society of London 1896(2): 513-520.

Grishin, N. V. 2019. Expanded phenotypic diagnoses for 24 recently named new taxa of Hesperiidae (Lepidoptera). The

Taxonomic Report of the International Lepidoptera Survey 8(1): 1-15.

Hebert, P. D., A. Cywinska, S. L. Ball, and J. R. deWaard. 2003. Biological identifications through DNA barcodes.

Proc Biol Sci 270(1512): 313-321.

Honey, M. R., and M. J. Scoble. 2001. Linnaeus’ butterflies (Lepidoptera: Papilionoidea and Hesperioidea). Zoological

Journal of the Linnean Society 132(3): 277-399.

ICZN. 1999. International Code of Zoological Nomenclature. Fourth edition. The International Trust for Zoological

Nomenclature; London, UK.

Kawahara, A. Y., and J. W. Breinholt. 2014. Phylogenomics provides strong evidence for relationships of butterflies

and moths. Proceedings of the Royal Society B: Biological Sciences 281(1788): 20140970.

Klots, A. B. 1936. The interrelationships of the species of the genus Lycaena Fabricius (Lepidoptera, Lycaenidae).

Bulletin of the Brooklyn Entomological Society 31: 154-170.

Kodandaramaiah, U., T. J. Simonsen, S. Bromilow, N. Wahlberg, and F. Sperling. 2013. Deceptive single-locus

taxonomy and phylogeography: Wolbachia-associated divergence in mitochondrial DNA is not reflected in

morphology and nuclear markers in a butterfly species. Ecol Evol 3(16): 5167-5176.

Kodandaramaiah, U., and N. Wahlberg. 2009. Phylogeny and biogeography of Coenonympha_ butterflies

(Nymphalidae: Satyrinae) - patterns of colonization in the Holarctic. Systematic Entomology 34: 315-323.

Layberry, R. A., P. W. Hall, and J. D. Lafontaine. 1998. The butterflies of Canada. University of Toronto Press;

Toronto, Buffalo & London. 280 pp.

Li, W., Q. Cong, J. Shen, J. Zhang, W. Hallwachs, D. H. Janzen, and N. V. Grishin. 2019. Genomes of skipper

butterflies reveal extensive convergence of wing patterns. Proceedings of the National Academy of Sciences of

the United States of America 116(13): 6232-6237.

Mallet, J. 1995. A species definition for the modern synthesis. Trends Ecol Evol 10(7): 294-299.

Mallet, J., N. Besansky, and M. W. Hahn. 2016. How reticulated are species? Bioessays 38(2): 140-149.

Maynard, C. J. 1889. Description of a new species of butterfly from the West Indies. Contributions to Science

(Newtonville) 1(2): 88-92.

Merian, M. S. 1705. Metamorphosis insectorum surinamensium. In qua erucae ac vermes surinamenses, cum omnibus

suis transformationibus, ad vivum delineantur et describuntur, singulis eorum in plantas, flores et fructus

collocatis, in quibus reperta sunt; tunc etiam generatio ranarum, bufonum rariorum, lacertarum, serpentum,

araneorum et formicarum exhibetur; omnia in America ad vivum naturali magnitudine picta atque descripta.

Gerard Valk; Amsterdam. [iv] + 60 pp., 60 pls.

Merriam-Webster. 2020. <https://www.merriam-webster.com/dictionary/sautoir>. Accessed | Nov. 2020.

Michener, C. D. 1942. A review of the subspecies of Agraulis vanillae (Linnaeus) (Lepidoptera: Nymphalidae).

American Museum Novitates 1197: 1-8.

Mielke, O. H. H., and M. M. Casagrande. 2002. Notas taxondmicas em Hesperiidae neotropicais, com descri¢des de

novos taxa (Lepidoptera). Revista brasileira de Zoologia 19(Suplemento 1): 27—76.

Miller, L. D., and F. M. Brown. 1979. Studies in the Lycaeninae (Lycaenidae). 4. The Higher Classification of the

American Coppers. Bulletin of the Allyn Museum 51: 1-30.

Minh, B. Q., H. A. Schmidt, O. Chernomor, D. Schrempf, M. D. Woodhams, A. von Haeseler, and R. Lanfear.

2020. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol Biol

Evol 37(5): 1530-1534.

Mutanen, M., N. Wahlberg, and L. Kaila. 2010. Comprehensive gene and taxon coverage elucidates radiation patterns

in moths and butterflies. Proc Biol Sci 277(1695): 2839-2848.

Nelis, M., T. Esko, R. Magi, F. Zimprich, A. Zimprich, D. Toncheva, S. Karachanak, T. Piskackova, I. Balascak,

L. Peltonen, E. Jakkula, K. Rehnstrom, M. Lathrop, S. Heath, P. Galan, S. Schreiber, T. Meitinger, A.

Pfeufer, H. E. Wichmann, B. Melegh, N. Polgar, D. Toniolo, P. Gasparini, P. D'Adamo, J. Klovins, L.

Nikitina-Zake, V. Kucinskas, J. Kasnauskiene, J. Lubinski, T. Debniak, S. Limborska, A. Khrunin, X.

Estivill, R. Rabionet, S. Marsal, A. Julia, S. E. Antonarakis, S. Deutsch, C. Borel, H. Attar, M. Gagnebin,

M. Macek, M. Krawezak, M. Remm, and A. Metspalu. 2009. Genetic structure of Europeans: a view from

the North-East. PLoS One 4(5): e5472.

Newton, I. 2003. Speciation and biogeography of birds Academic Press; Amsterdam, pp. xii + 668.

Oberthiir, C. 1897. Description de lépidopteres nouveaux. Bulletin de la Société entomologique de France 1897(11):

173-180.

Opler, P. A., and V. Malikul. 1992. A field guide to eastern butterflies. Houghton Mifflin Co.; Boston, New York &

London.

Pelham, J. P. 2008. Catalogue of the Butterflies of the United States and Canada. Journal of Research on the

Lepidoptera 40: 1-658.

Pelham, J. P. 2020. Catalogue of the Butterflies of the United States and Canada. Revised 7 Aug. 2020. Accessed 1

Nov. 2020. http://www. butterfliesofamerica.com/US-Can-Cat.htm.

Pefia, C., N. Wahlberg, E. Weingartner, U. Kodandaramaiah, S. Nylin, A. V. Freitas, and A. V. Brower. 2006.

Higher level phylogeny of Satyrinae butterflies (Lepidoptera: Nymphalidae) based on DNA sequence data. Mol

Phylogenet Evol 40(1): 29-49.

Pfeiler, E. 2018. DNA barcoding and taxonomic challenges in describing new putative species: examples from

sootywing and cloudywing butterflies (Lepidoptera: Hesperiidae). Diversity 10(4): 111.

Pfeiler, E., M. Ramirez, and T. A. Markow. 2016. Polyphyly in Urbanus and Astraptes (Hesperiidae: Eudaminae)

assessed using mitochondrial DNA barcodes, with a reinstated status proposed for Achalarus. J. Lep. Soc. 70(2):

85-95.

Pohl, G. R., G. G. Anweiler, B. C. Schmidt, and N. G. Kondla. 2010. An annotated list of the Lepidoptera of Alberta,

Canada Zookeys 38: 1-549.

Ratnasingham, S., and P. D. Hebert. 2007. BOLD: The Barcode of Life Data System (http://www. barcodinglife.org).

Molecular Ecology Notes 7(3): 355-364.

Remington, C. L. 1968. Suture-zones of hybrid interaction between recently joined biotas. /n: Dobzhansky, T., M. K.

Hecht, and W. C. Steere (Eds.). Evolutionary Biology. Springer; Boston, pp. 321-428.

Savela, M. 2020. Lepidoptera and some other life forms.

Sayers, E. W., M. Cavanaugh, K. Clark, J. Ostell, K. D. Pruitt, and I. Karsch-Mizrachi. 2020. GenBank. Nucleic

Acids Res 48(D1): D84—D86.

Scott, J. A., K. E. Davenport, N. G. Kondla, P. A. Opler, and M. S. Fisher. 2017. New taxa and geographic variation

of western North American butterflies: based on specimens in the C. P. Gillette Museum of Arthropod Diversity,

Colorado State University. Papilio (New Series) 26: 1-54.

Scott, J. A., and M. S. Fisher. 2014. Argynnis (Speyeria) nokomis nokomis : geographic variation, metapopulations, and

the origin of spurious specimens (Nymphalidae). Papilio (New Series) 21: 1-31.

Scudder, S. H. 1876. Synonymic list of the butterflies of North America, north of Mexico. Part 2, Rurales. Bulletin of

the Buffalo Society of Natural Sciences 3: 98-129.

Sibatani, A. 1974. A new genus for two new species of Lycaenidae (s. str.) (Lepidoptera: Lycaenidae) from Papua New

Guinea. Journal of Australian Entomological Society 13: 95-110.

Simonsen, T. J. 2006. Fritillary phylogeny, classification and larval hostplants: reconstructed mainly on the basis of

male and female genitalic morphology (Lepidoptera: Nymphalidae: Argynnini). Biological Journal of the

Linnean Society 89: 627-673.

Simonsen, T. J., N. Wahlberg, A. V. Z. Brower, and R. de Jong. 2006. Morphology, molecules and Fritillaries:

approaching a stable phylogeny for Argynnini (Lepidoptera: Nymphalidae). Insect Systematics & Evolution 37:

405-418.

Smith, M. J., and J. P. Brock. 1988. A review of the 7hessalia leanira complex in the southwestern United States with

a description of two new subspecies of 7hessalia fulvia. Bulletin of the Allyn Museum 118: 1-21.

Sperling, F. A. H. 2003. Butterfly molecular systematics: from species definitions to higher level phylogenies. /n:

Boggs, C., P. Erlich, and W. Watt (Eds.). Ecology and Evolution Taking Flight: Butterflies as model study

systems. University of Chicago Press; Chicago, USA, pp. 431-458.

Steinhauser, S. R. 1989. Taxonomic notes and descriptions of new taxa in the Neotropical Hesperiidae. Part I. Pyrginae.

Bulletin of the Allyn Museum 127: 1-70.

Talavera, G., V. A. Lukhtanov, N. E. Pierce, and R. Vila. 2012. Establishing criteria for higher-level classification

using molecular data: the systematics of Polvommatus blue butterflies (Lepidoptera, Lycaenidae). Cladistics 29:

166-192.

Trujano-Ortega, M., U. O. Garcia-Vazquez, C. J. Callaghan, O. Avalos-Hernandez, M. A. Luis-Martinez, and J.

E. Llorente-Bousquets. 2018. Two new genera of metalmark butterflies of North and Central America

(Lepidoptera, Riodinidae). Zookeys 729: 61-85.

Trujano-Ortega, M., U. O. Garcia-Vazquez, C. J. Callaghan, O. Avalos-Hernandez, M. A. Luis-Martinez, and J.

E. Llorente-Bousquets. 2020. Challenges for organismic taxonomical revisions in the age of phylogenomics: A

response to Zhang et al. (2019). Zookeys 4838(3): 436-440.

van Dorp, K. 2004. Molecular systematics of Lycaena F., 1807 (Lepidoptera: Lycaenidae) — some preliminary results.

Proceedings of the Netherlands Entomological Society 15: 65—70.

Wall, J. D., and D. Yoshihara Caldeira Brandt. 2016. Archaic admixture in human history. Curr Opin Genet Dev 41:

93-97.

Warren, A. D., K. J. Davis, E. M. Stangeland, J. P. Pelham, K. R. Willmott, and N. V. Grishin. 2016. Illustrated

Lists of American Butterflies. [21-XI-2017].

Wells, C. N., L. Edwards, R. Hawkins, L. Smith, and D. Tonkyn. 2011. A rearing method for Argynnis (Speyeria)

diana (Lepidoptera: Nymphalidae) that avoids larval diapause. Psyche: A Journal of Entomology 2011: 940280:

1-6.

Zacca, T., M. M. Casagrande, O. H. H. Mielke, B. Huertas, E. P. Barbosa, A. V. L. Freitas, L. M. Magaldi, M.

Espeland, S. Nakahara, and K. R. Willmott. 2018. Systematics of the butterfly genus Cissia Doubleday, 1848

(Lepidoptera: Nymphalidae: Satyrinae) using an integrative approach. Arthropod Systematics & Phylogeny

76(2): 349-376.

Zacca, T., M. M. Casagrande, O. H. H. Mielke, B. Huertas, M. Espeland, A. V. |. Freitas, K. R. Willmott, S.

Nakahara, and G. Lamas. 2020. Revalidation of Vareuptychia Forster, 1964, description of Vanima gen. nov.,

and notes on Euptychia cleophes Godman & Salvin, 1889 (Lepidoptera: Nymphalidae: Satyrinae). Zootaxa

4858(1): 1-34.

Zakharov, E. V., N. F. Lobo, C. Nowak, and J. J. Hellmann. 2009. Introgression as a likely cause of mtDNA

paraphyly in two allopatric skippers (Lepidoptera: Hesperiidae). Heredity (Edinb) 102(6): 590-599.

Zhan, S., W. Zhang, K. Niitepold, J. Hsu, J. F. Haeger, M. P. Zalucki, S. Altizer, J. C. de Roode, S. M. Reppert,

and M. R. Kronforst. 2014. The genetics of monarch butterfly migration and warning colouration. Nature

514(7522): 317-321.

Thang, J., Q. Cong, J. Shen, E. Brockmann, and N. V. Grishin. 2019a. Genomes reveal drastic and recurrent

phenotypic divergence in firetip skipper butterflies (Hesperiidae: Pyrrhopyginae). Proceedings of the Royal

Society B: Biological Sciences 286(1903): 20190609.

Thang, J., Q. Cong, J. Shen, E. Brockmann, and N. V. Grishin. 2019b. Three new subfamilies of skipper butterflies

(Lepidoptera, Hesperiidae). Zookeys 861: 91-105.

Thang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2019c. Changes to North American butterfly names. The

Taxonomic Report of the International Lepidoptera Survey 8(2): I-11.

Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2019d. Genomics of a complete butterfly continent.

bioRxiv BIORXIV/2019/829887.

Thang, J., J. Shen, Q. Cong, and N. V. Grishin. 2019e. Genomic analysis of the tribe Emesidini (Lepidoptera:

Riodinidae). Zootaxa 4668(4): 475-488.

Zuckerkandl, E., and L. Pauling. 1965. Molecules as documents of evolutionary history. J Theor Biol 8(2): 357-366.