Volume 9 Number 7 29 October 2021

The Taxonomic Report

OF THE INTERNATIONAL LEPIDOPTERA SURVEY

ISSN 2643-4776 (print) / ISSN 2643-4806 (online)

Two new Species of Hermeuptychia from North America and

three neotype designations (Nymphalidae: Satyrinae)

Qian Cong’, Eduardo P. Barbosa’, Mario A. Marin’, André V. L. Freitas’,

Gerardo Lamas’ and Nick V. Grishin'*”

'Howard Hughes Medical Institute, Departments of "Biophysics and “Biochemistry, and “Eugene McDermott Center for

Human Growth & Development, University of Texas Southwestern, 5323 Harry Hines Blvd., Dallas, TX 75390-9050;

Laboratorio de Ecologia e Sistematica de Borboletas, Departamento de Biologia Animal e Museu da Diversidade Biolégica,

Instituto de Biologia, Universidade Estadual de Campinas, Campinas, Sao Paulo, Brazil;

°Museo de Historia Natural, Universidad Nacional Mayor de San Marcos, Lima, Peru;

* Corresponding author: grishin@chop.swmed.edu

ABSTRACT. Two new species of Hermeuptychia Forster, 1964 are described. Hermeuptychia sinuosa Grishin, sp. n.

(type locality Guatemala: El Progreso, Morazan) is an isolated member of the genus that does not readily fit into known species

groups, as suggested by its distinct male and female genitalia and COI DNA barcode sequences. It is distinguished from its

congeners by prominently wavy submarginal lines, rounder wings and distinctive genitalia, and can typically be identified by a

white dot, instead of an eyespot, near the ventral hindwing apex. Hermeuptychia occidentalis Grishin, sp. n. (type locality

Mexico: Guerrero, Acapulco) belongs to the Hermeuptychia sosybius group as indicated by the presence of androconia on the

dorsal surface of the wings, genitalia and COI DNA barcodes, and in addition to DNA characters, differs from its relatives in

the shape of the uncus and female genitalia. Neotypes of Oreas strigata canthe Hubner, [1811] (type locality Suriname:

Gelderland, Suriname River), Megisto acmenis Hubner, 1823 (type locality Argentina: Buenos Aires), and Satyrus cantheus

Godart, [1824] (type locality USA: Florida, Pinellas Co., St. Petersburg) and lectotype of Euptychia celmis var. bonaérensis

[sic] Burmeister, 1878 (type locality Argentina: Buenos Aires) are designated. These designations establish Hermeuptychia

canthe as a valid species widely distributed in South America from Colombia to Bolivia and Southeast Brazil, Euptychia

celmis var. bonaérensis [sic] Burmeister, 1878 as a junior objective synonym of Yphthimoides acmenis, and S. cantheus as a

junior subjective synonym of Hermeuptychia sosybius (Fabricius, 1793). Papilio camerta Cramer, 1780 is treated as nomen

dubium requiring further studies to determine an identity that is consistent with the original description, as it may be

conspecific with Paryphthimoides poltys (Prittwitz, 1865) instead of being a Hermeuptychia species as currently assumed.

Key words: biodiversity, cryptic species, Neotropical, Mesoamerica, satyrines, female genitalia.

RESUMEN. Se describe dos nuevas especies de Hermeuptychia Forster, 1964. Hermeuptychia sinuosa Grishin, sp. n.

(localidad tipo Guatemala: El Progreso, Morazan), es un componente aislado del género que no encaja facilmente en los grupos

de especies conocidas, como lo indica su distintiva genitalia masculina y femenina y las secuencias de ADN del cédigo de

barras COI. Se distingue de sus congéneres por tener lineas submarginales prominentemente onduladas, alas mas redondas y

genitales diferentes, y se puede identificar tipicamente por un punto blanco, en lugar de una mancha ocular, cerca del apice

ventral del ala anterior. Hermeuptychia occidentalis Grishin, sp. n. (localidad tipo México: Guerrero, Acapulco) pertenece al

grupo de Hermeuptychia sosybius como lo indica la presencia de androconia en las alas anteriores, la estructura genital y

secuencias de ADN de la region del cédigo de barras COI, y ademas de caracteres del ADN, se diferencia de sus parientes en la

forma del uncus y la genitalia femenina. Se designa neotipos para Oreas strigata canthe Hubner, [1811] (localidad tipo

Surinam: Gelderland, Rio Surinam), Megisto acmenis Hubner, 1823 (localidad tipo Argentina: Buenos Aires), y Satyrus

cantheus Godart, [1824] (localidad tipo Estados Unidos: Florida, Pinellas Co., St. Petersburg), y el lectotipo de Euptychia

celmis var. bonaérensis [sic] Burmeister, 1878 (localidad tipo Argentina: Buenos Aires). Estas designaciones establecen a

Hermeuptychia canthe como una especie valida ampliamente distribuida en América del Sur desde Colombia hasta Bolivia y el

sureste de Brasil, a Euptychia celmis var. bonaérensis [sic] Burmeister, 1878 como sinénimo objetivo mas reciente de

Yphthimoides acmenis, y a S. cantheus como sinonimo subjetivo mas reciente de Hermeuptychia sosybius (Fabricius, 1793).

Papilio camerta Cramer, 1780 es tratado como un nomen dubium requiriendo mas estudios para determinar una identidad que

sea consistente con la descripcion original, ya que puede ser coespecifica con Paryphthimoides poltys (Prittwitz, 1865) en lugar

de ser una especie de Hermeuptychia como se asume actualmente.

Palabras clave: biodiversidad, especies cripticas, Neotroépico, Mesoameérica, satirinos, genitalia femenina.

ZooBank registration: http://zoobank.org/58D9373E-D0C5-4D7D-860B-63BFDCFE85E0

The Neotropical genus Hermeuptychia was erected by Forster (1964) on the basis of male genitalia

characters to unite a group of relatives hardly identifiable by highly variable wing patterns, but distinct in

male genitalia. Lamas (2004) recognized eight named species of Hermeuptychia and suggested the

existence of several unnamed species in Colombia and Peru. One of these species has been described

since (Nakahara et al. 2017). Subsequently, Euptychia undulata Butler, 1867 has been transferred to

Hermeuptychia (Zacca et al. 2021).

DNA-based studies rationalized from the perspective of morphology revealed extensive cryptic

species diversity in Hermeuptychia (Seraphim et al. 2014; Tan et al. 2021), with two new species named

from the United States (Cong and Grishin 2014). The major challenge is to associate biological species

delineated with a significant contribution from DNA sequences (Cong and Grishin 2014; Seraphim et al.

2014; Tan et al. 2021) with the names proposed on the basis of old type specimens (Cong et al. 2021) in

agreement with the literature (Viloria 2021), and in a manner consistent with the International Code of

Zoological Nomenclature (ICZN 1999). Furthermore, not all names placed in Hermeuptychia are

currently associated with their primary type specimens, causing further confusion (Viloria 2021) and thus

threatening the stability of nomenclature.

Here, to facilitate a future integrative revision of Hermeuptychia grounded in genome-based

sequencing of primary type specimens, some of these challenges are addressed. Methods employed in this

work are as those described previously (Cong and Grishin 2014). Collection acronyms are given in the

Acknowledgments section below. New COI barcode sequences reported here were deposited in GenBank

<https://www.ncbi.nlm.nih.gov/genbank/> with accession numbers OK641921—OK641923.

Hermeuptychia sinuosa Grishin, new species

http://zoobank. org/026F 9922-54 1B-466C-B25E-34739C18C1 BD

(Figs. 1-10, 33a-d, j, k, 36 part)

Description and diagnosis. On average smaller than its congeners (forewing length 14-16 mm), wings

rounder and of similar shape in both sexes, dorsally unspotted brown, ventrally with postmedian eyespots

typically very small, nearly equal to each other in size, five on forewing and six on hindwing (some may

be vestigial, especially on forewing), hindwing eyespots 2, 5 & 6 (counting from costa) developed best,

usually black, yellow-ringed and pupillated with pale metallic blue. Recognized by a well-expressed and

wavy (sinuous) submarginal line placed at some distance from the two thinner marginal lines, hindwing

6" eyespot on this line, 1° eyespot usually replaced by a white dot (sometimes a patch of cream-white

scales overlays a small eyespot), making such specimens identifiable by this character. These cream-white

scales forming the dot are different from iridescent scales that pupillate eyespots. Median lines are darker

at veins in some specimens, which is another character atypical for Hermeuptychia. Male genitalia

distinctive (Fig. 33a—d): uncus narrow, in dorsal view lanceolate, widest near the distal third, apex

truncated, nearly straight (not strongly bent ventrad) in lateral view, without carina; saccus long and

narrow, about as long as vinculum; valva nearly straight, only slightly concave ventrad in the middle,

without a deep notch, dorsally narrows gradually towards cucullus, then more abruptly past the base of

cucullus, which narrows further to a point, slightly upturned; aedeagus as long as valva, not expanded at

its base. Female genitalia (Fig. 33j, k) with antrum small comparatively to other species, weakly

sclerotized, obcordate in shape, widest near its distal third, in dorso-ventral dimension thin and appears

flattened, not cup-like as in most congeners.

GTH.ELProgresc..002

Mor aztan<..

DurdentdJ 70010807

DNA sample ID:

NVG-2307

c/o Nick V. Grishin

H. sinuosa

NVG140403-35

De om

PARATYPE oO

Hermeuptychia

sinuosa Grishin

62. 24.

Mexico, #,";6

_Swergere

Pres. by

Prof. M. Draudt.

Joicey oC

Bequest. 5

Brit.Mus. ¢

1934-120. 35

BMNH(E) #806416

PARATYPE &

Hermeuptychia

sinuosa_ Grishin

PARATYPE GO

Hermeuptychia

sinuosa Grishin

: PT Wy

O BMNnH BMNH

H. sinuosa

62. 24.

5 . . 1 mt BR Joicey |

Mexico, Joicey Coline Bequest

_ Sherrayae@ | Bequest. Pres by | Brit.Mus

Pres. by © Brit.Mus. Prof, M.Drandt. 934-120, |

Prof. N. Draundt, 1934-120.

RMuller &

Sierra de Collector! og

GuerreroMex!

PARATYPE

Hermeuptychia

sinuosa Grishin

DNA sample ID:

NVG-2981

c/o Nick V. Grishin

genitalia

NVG141101-12

Nick V. Grishin

H. sinuosa

be IM °

Figs. 1-10. Hermeuptychia sinuosa sp. n. type specimens. 1—2. holotype <4, Guatemala: El Progreso, Morazan, 10-Jan-1990, leg. C. J. Durden, DNA sample

NVG-2307, genitalia No. NVG140403-35 [TMMC] (genitalia Fig. 33a—d); 3-8. paratypes, Mexico, pres. by Prof. M. Draudt, 62. 24., Joicey Bequest. Brit.

Mus. 1934-120 [BMNH], © The Trustees of the Natural History Museum London, used with permission: 3-4. 4, Guerrero, Nov-1916, BMNH(E)#806416; 5—

6. 3, Morelos: Cuernavaca, BMNH(E) #834699; 7-8. 2, Colima, Mar-1922, BMNH(E)#834698; 9-10. paratype 2°, Mexico: Sierra de Guerrero, Dec-1912,

leg. R. Muller, #3670, DNA sample NVG-2981, genitalia NVG14101-12 [USNM] (genitalia Fig. 33), k). In Figs. 1-32 dorsal/ventral surfaces are in odd/even-

numbered figures, except 1 and 29, which are ventral; labels are shown for type specimens in-line with the specimen images and are reduced 2.5-fold

compared to specimens as indicated by a smaller scale bar. Larger scale refers to specimens. "F" specifies mirror image (left-right inverted).

Barcode sequence of the holotype: Sample NVG-2307, GenBank accession OK641921, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTT en he ait TAATTGGAACATCATTAAGTTTAATTATTCGAATGGAATTAGGTAATCCAGGATTTTTAATTGGGGATGATCAAATTTATAATACT

ATTGTAACAGCTCACGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAAT TGGAGGATTTGGTAATTGACTTATCCCCTTAATAT TAGGAGCTCCTGATATAGCCTTCCCACGTA

TAAATAATATAAGATTTTGATTATTACCCCCATCTTTAATTTTATTAATTTCTAGTAGTATTGTAGAAAATGGAAGTGGAACAGGAT GAACAGTTTATCCCCCTCTTTCATCTAATATTGC

TCATAGAGGATCATCGGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCT

TATGATCAAATACCTTTATTTATCTGAGCTGTAGGAAT CACAGCTCTTCTTTTACTTCTTTCCTTACCCGTTTTAGCGGGAGCTATTACTATACTTCTTACCGACCGTAATTTAAATACAT

CATTTTTTGACCCCGCAGGAGGAGGTGATCCTATTTTATACCAACATCTATTT

Type material. Holotype: <3, has four estan alan printed labels: three white [ GIM.E]Progreso.002 |

Morazan | DurdenCJ 90010A07 |, [ DNA sample ID: | NVG-2307 | c/o Nick V. Grishin |, [| NVG140403-

35 ] and one red [HOLOTYPE © | Hermeuptychia | sinuosa Grishin ]. The locality label stands for

Guatemala: El Progreso, Morazan, above k99, leg. C. J. Durden, 10-Jan-1990. NVG140403-35 is a

genitalia preparation number, genitalia vial placed on the same pin with the specimen. The holotype is

illustrated in Figs. 1-2 (genitalia Fig. 33a—d) and is currently in the University of Texas at Austin

collection, Austin, TX, USA [TMMC]. Paratypes: 4 44 and 3 9, all from Mexico: 2 Colima, Mar-

1922, BMNH(E) #834698, <4 Morelos, Cuernavaca, BMNH(E) #834699, 3 Guerrero, Nov-1916,

BMNH(E) #806416, 2 Guerrero, Sierra de Guerrero, "Dec. 12" [probably 12-Dec-?], DNA sample NVG-

2981, genitalia NVG141101-12 [USNM], 3 Oaxaca, Chiltepec, 2-Nov-1969, RLR, DNA sample NVG-

14112H06, 2 Veracruz, Catemaco, Dos Amates, 23-Sep-1972, RLR, DNA sample NVG-14112H07, 3

no data label [likely from one of the two "RLR" localities above], DNA sample NVG-14112H05.

Type locality. Guatemala: El Progreso, Morazan.

Etymology. The name refers to the sinuous submarginal dark line on wings beneath. The name is a

feminine adjective.

Distribution. In addition to the type locality in Guatemala, this species is widely distributed in Mexico

(Colima, Morelos, Guerrero, Oaxaca, Veracruz).

Comments. This species was at times identified as Hermeuptychia lupita (Reakirt, [1867]) (type locality

Mexico: Veracruz) (Warren et al. 2016), which is incorrect, as also pointed out by Viloria (2021). Facies

of Hermeuptychia sinuosa sp. n. do not agree with the original description of Neonympha lupita. In

particular, the former species is smaller (wingspan <1.15 vs. 1.25 inches in N. /upita), and the wing

pattern of the ventral side differs: the new species typically has more than 4 eyespots (1 forewing, 3

hindwing in N. /upita) and lacks additional (to the three median lines) "transverse lines" on the hindwing

"towards the base" (Reakirt [1867]).

Hermeuptychia occidentalis Grishin, new species

http://zoobank.org/7FB00257-D9A6-4C25-930B-78 L45BF3 AFAC

(Figs. 11-18, 33e—-1, 1, m, 36 part)

Description and diagnosis. Belongs to the same species group with Hermeuptychia sosybius (Fabricius,

1793) and Hermeuptychia hermybius Grishin, 2014 as judged by the presence of large areas on the dorsal

surface of the wings covered with androconia, morphology of the male genitalia and COI DNA barcodes

that place this species as sister to the two others (Fig. 36). Due to wing pattern variation, identification by

facies is challenging. Characterized by a postmedian area on the ventral hindwings distad of the distal

median line and to the eyespots (Sometimes beyond them) paler than the rest of the wing, and markedly

paler than the discal area forming a (somewhat) darker band bordered by the two median lines. The

forewings in most specimens show the same, but weaker, tendency of being paler towards the outer

margin from the distal median line. Veins not paler than the background, as they frequently are in H.

hermybius. Diagnosed by genitalia and COI barcodes. In male genitalia (Fig. 33e—1), which are otherwise

similar to H. hermybius, the uncus is narrower, lanceolate in dorsal view, being broadest near its basal

third, rather than near or past its middle, not constricted before the truncated apex, the apex narrower as

well. In the female genitalia (Fig. 331, m), the antrum is broader, nearly round, broadest near its middle,

nearly symmetrical. The following combination of characters in the COI DNA barcode is proposed as

diagnostic: T5C, T247C, T484C, T580C, T583C, and T646C, where the number refers to the sequence

HOLOTYPE GC

Hermeuptychia

occidentalis Grishin

genitalia

NVG141101-01

& iy Nick V. Grishin

96/8

NCO

H. occidentalis

DNA sample ID:

NVG-2970

c/o Nick V. Grishin

genitalia

NVG141101-10

Nick V. Grishin

H. occidentalis

DNA sample ID:

NVG-2979

c/o Nick V. Grishin

Near Prtilal

— ANZ co pMexico

oO on Gvepinor free

3-V— 8S

Collected by Glenn

Robert Scott

DNA sample ID:

NVG-2789

c/o Nick V. Grishin

H. occidentalis

DNA sample ID:

NVG-2971

c/o Nick V. Grishin

genitalia

NVG141101-02

Nick V. Grishin

H. occidentalis

Figs. 11-18. Hermeuptychia occidentalis sp. n. type series. 11-12. holotype 3’, Mexico: Guerrero, Acapulco, 7-Apr-1961, leg. J. Legge, DNA sample NVG-

2970, genitalia NVG14101-01 (Fig. 33e-h) [USNM]; paratypes: 13-14. <4, Mexico: Morelos, Cuernavaca, Sep-1897, E. A. Smyth collection, DNA sample

NVG-2979, genitalia NVG14101-10 (Fig. 331) [USNM]; 15-16. 4, Mexico: Jalisco, nr. Pitillal, 3-May-1985, leg. G. R. Scott, DNA sample NVG-2789; 17-

18. 2, Mexico: Guerrero, Acapulco, 7-Apr-1961, leg. J. Legge, DNA sample NVG-2971, genitalia NVG14101-02 (Fig. 331, m) [USNM].

Geldersland, , Collection

Surinam River. ee ; ane WmSchaus

NEOTYPE oh |

Oreas canthe

Hubner, [1811] _

designated by Grishin |

gen. Talio

H. canthe

S\ide X~2y-Yo

MADE #306

See

DNA sample ID:

NVG-14061C10

c/o Nick V. Grishin

H. canthe

Ernest Shoemaker

Collection 1956

H. solybius (=cantheus)

| 4 r y " - NEOTYPE co % i! DNA |

* ' ) a Satyrus cantheus i sample ID:

g Rte Xe | — Godart, [1824] _ 11-BOA-15609E04

designated by Grishin’ c/o Nick V. Grishin

Figs. 19-32. Hermeuptychia specimens. H. canthe: 19-20. neotype 3, designated herein, Suriname: Gelderland, Suriname River, genitalia slide W. D. F.

#306 (Fig. 34), DNA sample NVG-14061C10 [USNM]; 21-22. <, Peru: Madre de Dios, Amazonia Lodge, Atalaya, 491 m, 25-Sep-2011, leg. Steve Kinyon,

#1907, DNA sample NVG-2649, genitalia NVG140628-17 (Fig. 351) [USNM]; 23-24. 2°, Guyana: Region 9, Kanuku Mts., Nappi Creek, 03°20.7'N

59°34.2'W, 500'-1000', 21-Feb-10-Mar-1999, leg. S. Fratello, R. Hanner, S. Hendricks & R. Williams, USNM ENT 00232265, DNA sample NVG-2675,

genitalia NVG140628-43 (Fig. 35l14n) [USNM]; 25-26. 3’, Colombia: Caqueta, Florencia, 6-Aug-1976, fairly wet hillside forest, leg. J. A. Scott, DNA

voucher NVG-2798; 27-28. 2, Suriname: Commewijne, De Nieuwe Grond, secondary forest, 2-Jun-1982, leg. Olle Pellmyr, DNA sample NVG-2644,

genitalia NVG140628-12 (Fig. 35j}k) [USNM]; 29-30. illustrations of type specimens from the original description, not to scale (Hubner [1811]).

31-32. H. cantheus neotype <, designated herein, USA: Florida, St. Petersburg, 3-Nov-1938, leg. H. E. Wilford, DNA sample 11-BOA-15609E04 [USNM].

H. sinuosa

H. sinuosa-

H. occidentalis

H. occidentalis P-

H. sinuosa

eee 1mm

Fig. 33. Genitalia of Hermeuptychia type specimens. a—d. H. sinuosa holotype <, data in text and Figs. 1-2. e-h. H. occidentalis holotype @, data in text and

Figs. 11-12. i. H. occidentalis, paratype 4, Mexico: Morelos, Cuernavaca, Sep-1897, E. A. Smyth collection, DNA sample NVG-2979, genitalia NVG14101-

10 [USNM] (specimen Figs. 13-14). j, k. H. sinuosa paratype 2, Mexico: Sierra de Guerrero, Dec-1912, leg. R. Muller, #3670, DNA sample NVG-2981,

genitalia NVG14101-12 [USNM] (specimen Figs. 9-10). 1, m. H. occidentalis paratype 2, Mexico: Guerrero, Acapulco, 7-Apr-1961, leg. J. Legge, DNA

sample NVG-2971, genitalia NVG14101-02 [USNM] (specimen Figs. 17—18). Views: a, e. dorsal; b, f, j, 1. ventral; c, g, k, m. lateral; d, h, i. dorsolateral. All

images are to scale.

given below (from | to 658), the letter before the number is the expected ancestral base pair in this

position and the letter after the number is the base pair in this new species.

Barcode sequence of the holotype: Sample NVG-2970, GenBank accession OK641922, 658 base pairs:

AACTCTATATTTTATTTTTGGTATCTGAGCAGGAATAATTGG! TACATCATTAAGTTTAATTATCCGAATAGAATTAGGTAACCCAGGATTTTTAATTGGAGATGATCAAATTTATAATACT

ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTTATTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGTA

TAAACAATATAAGATTTTGATTATTACCCCCATCTTTAATTTTATTAATTTCTAGTAGTATTGTAGAAAATGGAAGTGGAACAGGATGAACAGTT TATCCCCCTCTTTCATCTAATATTGC

TCATAGAGGTTCTTCAGTAGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCAATTCTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCC

TATGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACAGCTCTTCTTTTACTTCTTTCATTACCTGTTT TAGCAGGAGCTATCACTATACTCCTCACTGATCGAAATTTAAATACAT

CATTTTTTGATCCTGCAGGAGGAGGAGACCCTATTTTATACCAACATTTATTT

Type material. Holotype: 3, has four rectangular labels: three white, one handwritten [ April 7, 1961 ¢ |

Grishin ], [ genitalia | NVG141101-01 | Nick V. Grishin ] and one red [ HOLOTYPE © | Hermeuptychia |

occidentalis Grishin |. The holotype is illustrated in Figs. 11-12 (genitalia Fig. 33e—h) and is in the

National Museum of Natural History, Smithsonian Institution, Washington, DC, USA [USNM].

Paratypes: 2 3 and | 9, from Mexico: 3 Jalisco, near Pitillal, 3-May-1985, leg. Glenn R. Scott, DNA

sample NVG-2789; 3 Morelos, Cuernavaca, Sep-1897, E. A. Smyth collection, DNA sample NVG-2979,

genitalia NVG14101-10 [USNM]; 2° Guerrero, Acapulco, 7-Apr-1961, leg. J. Legge, DNA sample NVG-

2971, genitalia NVG14101-02 [USNM].

Type locality. Mexico: Guerrero, Acapulco.

Etymology. The name refers to the western distribution of this species. The name is a feminine adjective.

Distribution. This species is known from southwestern Mexico (Jalisco, Morelos, Guerrero).

Neotype designation for Hermeuptychia canthe (Hiibner, [1811])

Meaningful integrative taxonomic revision of Hermeuptychia, a genus of many confusingly similar

cryptic species, requires clarity about its nomenclature. Such clarity can only be achieved when all

relevant names are objectively defined by their primary type specimens, and these specimens are

sequenced to provide DNA datasets necessary for a more definitive identification and comparisons. No

extant primary type specimens are known for Hermeuptychia canthe (Hiibner, [1811]). Although, as

documented in the literature, most of Hiibner types were likely lost (Hemming 1937; Calhoun 2018),

N.V.G. searched for possible H. canthe syntypes in the collections of the Muséum National d'Histoire

Naturelle, Paris, France (MNHP), the Natural History Museum, London, UK (BMNH) and the Museum

fir Naturkunde, Berlin, Germany (ZMHB). These searches were unsuccessful, leading us to believe that

the syntypes are no longer extant, and we proceed herein with a neotype designation. There is an

exceptional need to designate the neotype of H. canthe. Kept as a junior subjective synonym for decades,

H. canthe was resurrected by Viloria (2021) who used the name as valid. To unambiguously establish the

identity of this species necessary for further work on this very challenging genus, a neotype that facilitates

DNA-based studies is required. We believe that it is not possible to discern the cryptic diversity of

Hermeuptychia without DNA comparisons (Tan et al. 2021).

The original illustrations of Oreas strigata canthe Htibner, [1811] are identifiable as a

Hermeuptychia, probably from Suriname (Hemming 1937), largely brown unspotted dorsally, and

ventrally with 5 eyespots on the forewing (including the one near the apex) and 6 on the hindwing (Figs.

29, 30). All the eyespots on the illustrations are approximately the same size, e.g. those in hindwing cells

Rs-M, and CuA,-CuAg are not larger than others. The distance between the two brown lines on the ventral

forewing increases towards the costa. We found a male specimen from Suriname that agrees with these

distinctive features of the original illustrations and we hereby designate this specimen shown in Figs. 19,

20, genitalia Fig. 34, as the neotype of Oreas strigata canthe Hiibner, [1811]. This species belongs to

Hermeuptychia.

Our neotype of H. canthe satisfies all the requirements set forth by the ICZN Article 75.3.

Namely: 75.3.1. It is designated to clarify the taxonomic

identity of O. canthe, which remained hypothetical until

now, impeding research on Hermeuptychia; 75.3.2. The

characters that differentiate this taxon have been given

above, as a description of the original illustrations,

complemented here by the following features of male

genitalia (Fig. 34, 35): saccus long, only somewhat

shorter than tegumen with uncus; "truncated" at the end,

uncus with thin, membranous carina in basal half; valva

about 4 times longer than its height, ventrally with a

broad notch, cucullus long and narrow, terminally -- : 7

without teeth, aedeagus slightly longer than valvae. The | Fig. 34. Genitalia of Oreas strigata canthe Hubner, [1811] neotype,

mounted on slide #306 24-Oct-1940 by W. D. Field [USNM],

COI barcode sequence of the neotype (GenBank aedeagus is shown below, pasted in this image from aside.

accession OK641923) is:

AACTTTATATTTTATTTTTGGTATCTGAGCAGGAATAATTGGCACATCATTAAGTTTAATTATCCGAATAGAATTAGGTAATCCAGGATTTTTAATTGGAGATGACCAAATTTATAATACT

ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGTAATTGACTTATTCCCTTAATAT TAGGAGCTCCTGATATAGCTTTCCCACGTA

TAAATAATATAAGATTTTGATTATTACCTCCATCTTTAATTTTATTAATTTCTAGTAGCATTGTAGAAAATGGAAGTGGAACTGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC

TCATAGAGGTTCTTCTGTAGATTTGGCAATTTTTTCTCTTCACTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCT

TATGATCAAATACCCCTATTTATTTGAGCCGTAGGAATTACAGCTCTCCTCTTACTTCTTTCATTACCTGTTTTAGCAGGAGCTATTACTATACTTCTTACTGATCGAAATTTAAATACAT

CATTTTTTGACCCTGCAGGAGGAGGAGACCCCATTTTATATCAACATTTATTC

75.3.3. The neotype specimen is a male that bears the following five rectangular labels: [ Gelderland, |

Suriname River. |, [ Collection | Wm. Schaus ], [ genitalia | slide X-24-40 | W. D. F. #306 |, [| DNA

sample ID: | NVG-14061C10 | c/o Nick V. Grishin ], and [ NEOTYPE ¢ | Oreas canthe | Hubner, [1811]

| designated by Grishin ]; 75.3.4. Our search for the syntypes is described above, and it was unsuccessful,

leading us to believe that they are no longer extant; 75.3.5. The neotype is consistent with what is known

about this taxon, in particular with the original illustrations: e.g., on the ventral side, it has 5 eyespots on

H. canthe

Cc 2 : :

: : :

= 5 x

a O

Fig. 35. Genitalia of Hermeuptychia canthe. a—-d. 3, Bolivia: Beni, 40 km E San Borja, Estacion Biologica Beni, Palm Camp at Rio Curiraba, 9-15-Sep-

1987, malaise trap in inundation forest, leg. W. E. Steiner & M. G. Pogue, BIOLAT/LEPI 000002406, DNA sample NVG-2633, genitalia NVG140628-01; e—

h. 4, ibid, BIOLAT/LEPI 000002432, DNA sample NVG-2635, genitalia NVG140628-03 [USNM]; i. 3, Peru: Madre de Dios, Amazonia Lodge, Atalaya,

491 m, 25-Sep-2011, leg. Steve Kinyon, #1907, DNA sample NVG-2649, genitalia NVG140628-17 (specimen Figs. 21—22); j, k. 2, Suriname: Commewijne

De Nieuwe Grond, secondary forest, 2-Jun-1982, leg. Olle Pellmyr, DNA sample NVG-2644, genitalia NVG140628-12 (specimen Figs. 27-28); 1], m. 9,

Guyana: Region 9, Kanuku Mts., Nappi Creek, 03° 20.7'N 59° 34.2'W, 500'-1000', 21-Feb-10-Mar-1999, leg. S. Fratello, R. Hanner, S. Hendricks, R.

Williams, USNM ENT 00232265, DNA sample NVG-2675, genitalia NVG140628-43 (specimen Figs. 24-25). All specimens are in USNM. Views: a, e.

dorsal; b, f, j, 1. ventral; c, g, k, m. lateral; d, h, i. dorsolateral. All images are to scale.

the forewing and 6 eyespots on the hindwing, all approximately the same size; 75.3.6. The neotype is

from Suriname: Gelderland, Suriname River, and the syntypes were presumed to be from Suriname

(Hemming 1937); 75.3.7. The neotype is in the

collection of the National Museum of Natural

History, Smithsonian Institution, Washington, DC,

USA (USNM).

Distances between barcodes of species with

confidently assigned names and those from

morphogroups defined by Seraphim et al. (2014)

are illustrated here as a dendrogram (Fig. 36). The

neotype of S. canthe is a_ species from

Hermeuptychia Morphogroup 01|KF466098

Hermeuptychia Morphogroup 02|KF466052

Hermeuptychia Morphogroup 03|KF466023

Hermeuptychia Morphogroup 04|KF466059

Hermeuptychia sosybius|NT|KIO25561

Hermeuptychia hermybius|KJO25569

Hermeuptychia occidentalis|HT|OK641922

Hermeuptychia clara|KY¥Y236317

Hermeuptychia Morphogroup O5|KF466142

Hermeupty chia intricata|HT|KJ025595

Hermeuptychia Morphogroup 06|KF466022

Hermeuptychia Morphogroup OF |KF466148

Hermeuptychia Morphogroup 11|KF466010

Hermeuptychia Morphogroup O8|KF466069

Hermeuptychia Morphogroup 09|KF466031

Hermeuptychia sinuosalHT|OK641921

1% Hermeuptychia Morphogroup 10|KF466019

Hermeuptychia canthe|NT|OK641923

morphogroup 10 (Seraphim et al. 2014). In

agreement with Viloria (2021), we consider it to be

a valid species, Hermeuptychia canthe (Hubner,

[1811]). To facilitate recognition of this species,

additional sequenced specimens from across its

range are shown in Figs. 21—28, and their genitalia

are shown in Fig. 35. In addition to its type locality

in Suriname, this widely distributed species is

recorded from Colombia, Guyana, French Guiana,

Hermeuptychia undulata|KF466130

Fig. 36. COI barcode dendrogram constructed using BioNJ (Gascuel 1997)

from Jukes-Cantor distances (Jukes and Cantor 1969) computed on the

alignment after removal of all positions with gaps. Species names are given

(and colored) only when they are determined with confidence. Species

sequenced in Seraphim et al. (2014) are named by their morphogroup

employed in that work. GenBank accessions are specified. Branches and

species names for barcodes obtained in this work are shown in red. NT is

neotype and HT is holotype. The dendrogram is rooted with the barcode of

Megisto cymela\GU088434 (not shown). Due to insufficient phylogenetic

signal in barcodes, the dendrogram may not reflect phylogeny and is only

shown to illustrate divergence and similarity between barcodes.

Brazil (PA, MT, MG), Ecuador, Peru, and Bolivia, as evidenced by the specimens we studied (Fig. 19-28,

34, 35), the DNA sequence search of the BOLD database queried with the neotype barcode

(Ratnasingham and Hebert 2007) and reports in the literature (Seraphim et al. 2014; Tan et al. 2021).

Euptychia celmis var. bonaérensis |sic| Burmeister, 1878 is a junior objective

synonym of Yphthimoides acmenis (Hiibner, 1823)

A number of Satyrini Boisduval, [1833] species have a dry season form, in which patterns of eyespots and

stripes are much reduced to nearly absent, and the ventral side is paler, of mottled appearance (Freitas et

al. 2010; Freitas et al. 2021). Similar to that, the original illustration of Megisto acmenis Hiibner, 1823

(type locality "Baltimore") reveals "not the slightest trace of any eyespots" on the ventral side of its wings

(Hiibner 1823) (Fig. 37a). Type specimens of this species have not been located and its type locality is

likely erroneous (Scudder 1875; Weymer 1910-1912) leading to confusion about this taxon. For instance,

there 1s a Hermeuptychia specimen of unknown provenance in BMNH labeled "acmenis" and illustrated

in D’Abrera (1988). This Hermeuptychia specimen, representing a rather extreme example of the dry

season form or aberration, cannot be confidently identified to species without dissection or DNA

sequencing, because many Hermeuptychia species are similar to this form. The status of M. acmenis and

the Hermeuptychia "acmenis" specimen were discussed in detail by Viloria (2021), who concluded that

M. acmenis belongs to Hermeuptychia based on this specimen and wing shape similarity of the illustrated

M. acmenis type(s) and Hermeuptychia. However, the progression of ventral wing pattern deterioration in

Hermeuptychia is inconsistent with that of M. acmenis. Hermeuptychia possesses submarginal wavy lines

that are similar in intensity to the two median lines. These lines tend to deteriorate similarly. I.e., if the

median lines are expressed clearly (as in the M. acmenis illustration), then the submarginal lines are clear

as well. If the submarginal lines are obsolete, then the median lines are obsolete too (as in the

Hermeuptychia "acmenis" specimen).

A more detailed analysis of the Hermeuptychia "acmenis" specimen reveals that its wing patterns

on the ventral side and size do not agree with the original description and illustration of M. acmenis. In

particular, in this specimen: (1) both hindwings have clearly defined traces of eyespots: small brown spots

in cells CuA,-CuA: (larger) and RS-M;, (smaller), but the description states: "von Augenpuncten nicht die

geringste Spur", i.e., not the slightest trace of any eyespots (Hiibner 1823: 11); (2) the hindwings are

rather uniform in color and median lines are not visible: only a slightly paler diffuse postmedian band

stands out from the brown background, vs. two prominent median lines outlining a darker area between

them in the illustration of M. acmenis; (3) the forewing has a long dash along the distal end of discal cell,

but the illustration shows a very short mark in that area; (4) the ventral side of the wings is of less mottled

apperance than shown in the illustration; (5) the forewing length is <17 mm, but the illustration depicts a

larger specimen, as extrapolated from the comparison with Adelpha plesaure Hubner, 1823 illustrated on

the same plate (likely to scale): the forewing length is expected to be 18 mm or more. Moreover, the

original description of M. acmenis states: "Mit M. Euridice hat sie viel 4hnliches" (With M. Euridice has

much in common), and Lethe eurydice (Linnaeus, 1763) is larger than most Hermeuptychia. Therefore, at

the very least, this Hermeuptychia "acmenis" is not the specimen illustrated in the orginal description, not

a syntype, and probably not M. acmenis at all.

To prepare for a more detailed genomic study of Hermeuptychia, we investigated M. acmenis

further. If Baltimore was the correct locality, the only somewhat similar species that may reach this

latitude is Cyllopsis gemma (Hubner, 1818). The similarity is in the placement and shape of lines and, in

particular, in the degree of mottling and color gamut. However, if M. acmenis were C. gemma, it would

have been an unusual aberration that totally lost the ventral hindwing submarginal patch of "spider-eye"

spots. We have not seen such an aberration, although some of the more southern Cyl/opsis R. Felder, 1869

Species do experience deterioration of eyespots, e.g., Cyllopsis pyracmon (Butler, 1867).

y im - 7S a

2 DCS EA al PO CaN Md a a “tens : < we —— Dali

Fig. 37. Megisto acmenis. a. Original illustration of Megisto acmenis from Hubner (1823) and individuals of Yphthimoides

celmis that are similar to it: b. from Brazil: Parana, Tapejara photographed by Tiago Barbosa in June 2019 (CC _BY-NC,

Barbosa 2019); c, d. from Buenos Aires area in Argentina photographed by Holger Braun on 13 October 2019 (CC_BY,

Braun 2019); d. shows its enlarged hindwing submarginal area that is essentially unspotted: "von Augenpuncten nicht die

geringste Spur". The images are rotated, cropped, b. flipped, and c, d. color-corrected compared to the originals.

anc ae

Weymer (1910-1912) likened M. acmenis to Cissia phronius (Godart, [1824]), which in size is

more similar to L. eurydice, and larger than Hermeuptychia, in agreement with our M. acmenis size

estimates from the original illustrations (Hiibner 1823). As Weymer noted, darker dots in the median lines

of C. phronius are absent in M. acmenis, therefore the two are distinct species and should be kept as such.

Moreover, wingshape of C. phronius is different: the forewing is elongated and the hindwing has

crenulate margins. Dry season forms of Emeryus difficilis (Forster, 1964) are known to possess similar

hindwing pattern to that of M. acmenis and essentially lack the eyespots (Zacca et al. 2020). However, E.

difficilis is larger (forewing ~21 mm), has well-expressed submarginal lines on the dorsal surface of the

wings, and its hindwing outer margin is crenulate. These characters are not consistent with the original

illustration of M. acmenis.

Out of all Satyrini worldwide, the only species known to us that may have the following

combination of characters: mottled appearance of wings' ventral side, with two median lines, darker

between them and paler just outside this darker median band framed by the two lines, with a small dash at

the end of the forewing discal cell, and lacking essentially any spots in the postmedian areas of both

wings, iS Yphthimoides celmis (Godart, [1824]). Such dry season specimens look rather similar to the

original illustration of M. acmenis. For instance, a butterfly photographed in Brazil: Parana, Tapejara and

shown on the iNaturalist website (Barbosa 2019) (Fig. 37b) comes particularly close to M. acmenis.

Moreover, an individual from Argentina: Buenos Aires Province, Parque Pereyra (Braun 2019) (Fig. 37c,

d) is entirely missing "a trace of any eyespots".

The only notable discrepancy is that the hindwing darker discal band is more strongly curved

towards the anal margin in the M. acmenis illustrated by Htibner (1823) than in Y. ce/mis. However, the

same discrepancy is also present in the Hermeuptychia "acmenis" specimen in BMNH: traces of median

lines are not convex thus differing from the original illustration. This illustrated curvature, also mentioned

by Weymer (1910-1912), is reminiscent of some species of Erebia Dalman, 1816 and Oeneis Hiibner,

[1819], but none of these species fits other features of the MZ acmenis pattern. The closest might be

Erebia fasciata A. Butler, 1868, but it has at least some red-toned areas on the forewing, and the

submarginal dark area on both wings below is more clearly defined than the M. acmenis illustration

shows. Thus, we hypothesize that the strongly curved band may have been an atypical feature of the

illustrated specimen or an artistic interpretation, and agree with Lamas (2004) who placed M. acmenis in

Yphthimoides Forster, 1964. One of the most commonly encountered species, Yphthimoides celmis, 1s

found in southeastern South America. A number of species described in the same publication with M.

acmenis come from South Brazil, and at least one from Argentina, so it is possible that M. acmenis was

also collected in that region and mislabeled "Baltimore" at some point (Hiibner 1823).

Although as documented in the literature, most of Hiibner types were likely lost (Hemming 1937;

Calhoun 2018), N.V.G. searched for possible /. acmenis syntypes in the collections of the Muséum

National d'Histoire Naturelle, Paris, France (MNHP), the Natural History Museum, London, UK (BMNH)

and the Museum fiir Naturkunde, Berlin, Germany (ZMHB). These searches were unsuccessful, leading

us to believe that the syntypes are no longer extant, and we proceeded with the neotype designation. There

is an exceptional need to designate the neotype of MZ. acmenis, because the identity of this species and its

type locality have been unclear, and it was confused with Hermeuptychia in collections and publications

(D’Abrera 1988; Viloria 2021). To proceed with a meaningful integrative revision of Hermeuptychia, it is

essential to have M. acmenis defined objectively and in agreement with the original description and

original illustrations. Our investigations show that populations currently assigned to Y. celmis from

around Buenos Aires (Argentina) agree with what is known about M. acmenis (Fig. 37). Therefore, we

decided to select a specimen from these populations as the neotype of MM. acmenis. The specimens with

reduced or lacking eyespots from the region have been named Euptychia celmis var. bonaérensis |sic|

Burmeister, 1878, which is characterized in the original description as "a remarkable variation ... almost

without eyes" (Burmeister 1878). To simplify the synonymy, we hereby designate the specimen curated

as the lectotype of Euptychia celmis var. bonaérensis Burmeister, 1878, illustrated in Warren et al. (2016),

as the neotype of Megisto acmenis Hiibner, 1823. Its forewing length is about 18 mm, which is in

agreement with the size estimated from the original illustration of M. acmenis.

Our neotype of M. acmenis satisfies all the requirements set forth by the ICZN Article 75.3.

Namely: 75.3.1. It is designated to clarify the taxonomic identity of Megisto acmenis Hubner, 1823,

which remained undefined until now, impeding future research; 75.3.2. The characters that differentiate

this taxon have been given in its original description by Htibner (1823: 11): "It has much in common with

M. Euridice |sic!], but not the slightest trace of any eyespots" and can be further gleaned from the original

illustration: brown unspotted wings above, and below paler yellow-brown, mottled in appearance, with a

slightly darker broad discal band spanning both wings and outlined by even darker lines on both sides,

paler just outside the band and devoid of eyespots; 75.3.3. The neotype specimen is a male, which is also

a lectotype of Euptychia celmis var. bonaérensis |sic] Burmeister, 1878 hereby designated by Gerardo

Antigua ], and [ lectotype ¢ | Euptychia celmis var. | bonaerensis Burm. | 1878 | G. Lamas det. '92 ]. The

following red rectangular label will be mailed to the curators of the collection to add to this specimen:

[ NEOTYPE < | Megisto acmenis | Hiibner, 1823 | designated by Barbosa | Freitas and Grishin ]. This

Specimen was one of the two syntypes of E. celmis var. bonaérensis, both males with the same data in the

same collection (see below), and is designated as the lectotype of that taxon to enhance the stability of

nomenclature; 75.3.4. Our search for the syntypes is described above, and it was unsuccessful, leading us

to believe that they are no longer extant; 75.3.5. The neotype is consistent with what is known about this

taxon, in particular with the original illustration and description as detailed above; 75.3.6. The neotype is

from Buenos Aires (Argentina), and the type material was stated to be from "Baltimore", which is likely

erroneous, because no similar species have been found in eastern North America (Scudder 1875; Weymer

1910-1912), but both localities start with the letter B, suggesting a number of speculations. The

Specimen(s) on which Hiibner based his description and illustrations of VM. acmenis was/were given to

him by a certain “Herr Berg’, of whom nothing else appears to be known, except that other species

forwarded by him to Hiibner were supposedly obtained in Uruguay, Paraguay and Brazil, and only one

other species (a crambid moth) was labeled “Baltimore” though it appears to be widespread, found from

the USA south to at least Brazil; 75.3.7. The neotype is in the collection of the Museo Argentino de

Ciencias Naturales Bernardino Rivadavia, Buenos Aires, Argentina [MACN].

Lamas (2004) lists Yphthimoides acmenis (Hitibner, 1823) as a distinct species, and Euptychia

celmis var. bonaérensis [sic] Burmeister, 1878 as a synonym of Yphthimoides celmis (Godart, [1824]).

We have not investigated this synonymy, but if it holds, then due to objective synonymy established here

by the neotype designation of MZ. acmenis, Y. celmis would become a junior subjective synonym of Y.

acmenis. For now, we simply transfer E. celmis var. bonaérensis |sic| from Y. celmis to Y. acmenis,

keeping both Yphthimoides species as valid, to follow Lamas (2004). Furthermore, Euptychia celmis ab.

“inocellata” Kéhler, 1935 (an infrasubspecific name) and Epinephele euptychioides Kohler, 1939, both

from Argentina, may also belong to Y. acmenis and/or celmis, but this possibility has not been

investigated further.

Satyrus cantheus Godart, [1824] is a junior subjective synonym of

Hermeuptychia sosybius (Fabricius, 1793)

As detailed by Cardé et al. (1970) and further elaborated by Viloria (2021), Godart ({1824]) divided the

Fabrician concept of Papilio canthus Linnaeus, 1767 into three species. Two of them are known today as

Lethe eurydice (Linnaeus, 1763) (type locality USA: Pennsylvania) and Emeryus argulus (Godart,

[1824]) (type locality Brazil: Para, Santa Barbara do Para). The latter name was proposed in the same

work that also coined the name for the third species: Satyrus cantheus Godart, [1824], which is a nomen

dubium (Cardé et al. 1970). Viloria (2021) suggested that one of the two specimens in the Hunterian

Collection in Glasgow pinned below the header label "Pap. Canthus / Fabr. pag 64 N° 288" may have

been used as a basis for the description of S. cantheus. Viloria discussed only the second specimen

(GLAHM:127581, which is a female, not a male), without mentioning the first one (GLAHM: 127580, a

male). These two specimens are of different species that are presently placed in different subtribes. The

phenotype of this second specimen discussed by Viloria (GLAHM:127581) does not agree with the

original description of S. cantheus. First, each of its forewings has five obvious eyespots instead of "three

small eyespots not very pronounced" per the description. It is apparent, that Godart paid much attention to

the number of eyespots and their structure. E. g., he separated argulus from canthus with cantheus (all of

which Fabricius combined under P. canthus Linnaeus, 1767) by the number of ventral hindwing eyespots:

5 in the former versus 6 in the two latter species; and their structure: with two (not one) pupils in the

former species. Second, the su eyespot (next to the 6'", which is stated to be at the anal angle [=tornus]) is

not the largest: it is 1.2—1.3 times smaller than the 2" eyespot, measured in longitudinal dimension. Third,

the 6" eyespot (the one stated to be by the anal angle) is not the smallest: it is about 1.3 times larger than

the 4" one. Fourth, the Specimen is about 1.5 times smaller than a typical L. eurydice, but Godart's

description states that S. cantheus [Godart species number 56] "is about the same in size as the previous

one", which is the number 55 P. canthus Linnaeus, 1767 (a junior objective synonym of L. eurydice). For

all these reasons, this specimen is not a syntype. Furthermore, this specimen would not define the name S.

cantheus as intended in the original description to qualify as a neotype.

Fabricius did not propose a new name canthus homonymous with Papilio canthus Linnaeus, 1767

as suggested by Viloria (2021). This is because Fabricius gave the name canthus in the third line of his

description and attributed it to the Linnaeus citation, in a manner he did for many other species when

giving brief modified descriptions for previously proposed names (Fabricius 1775). Moreover, he

repeated this treatment and attribution in subsequent publications, only adding an additional name and

citation to it (Papilio argante Cramer, 1779) that he considered to refer to the same species (Fabricius

1781-[1782]; Fabricius 1793). No new name currently attributed to Fabricius that we know of referenced

an identically spelled name citing a previous author and publication. Therefore, Fabricius either

misidentified the Linnaean taxon completely, or expanded it to cover additional phenotypes, and Godart's

work points to the latter (Godart [1824]). Moreover, all new names proposed by Fabricius have been

thoroughly studied and catalogued in detail by a number of authors, and none mentions canthus as a new

name. For instance, there is no mention of canthus with Fabricius as the author in the comprehensive

catalogue by Zimsen (1964). There is no name canthus assigned to Fabricius in The Global Lepidoptera

Names Index (Beccaloni et al. 2003). Furthermore, Godart ([1824]: 493) did not credit canthus to

Fabricius, only to Linnaeus, mentioning that "Fabricius combined this butterfly [1.e. canthus] with the

next [called cantheus by Godart]; but it appears to us to be a different species, at least judging from the

description that follows" (interpretively translated and comments in brackets are added by us). Because

Fabricius did not propose a new name canthus, no name-bearing (i.e., type) specimens of the Fabrician

concept of canthus are possible by definition: there was no new name to bear.

We agree with Cardé et al. (1970) and Viloria (2021) that Godart's S. cantheus is not a misspelling

of P. canthus, but is an available name. Our reading of Godart ([1824]) excludes the possibility of a

misspelling, because Godart uses "S. canthus" for his species no. 55 and "S. cantheus" for his species no.

56: the two consecutively numbered species that are expected to have different names, as they do (not one

being a misspelling of the other). Miller and Brown (1981) made a mistake in stating that Godart

attributed the name cantheus to Linnaeus: only the name canthus [no. 55] was attributed to Linnaeus, not

the name number 56, which cited only Fabricius. Therefore, the conclusion of Miller and Brown about the

misspelling is erroneous. Furthermore, Godart used two sets of names throughout his work: French names

that were not italicized, employed French words and had accents over letters when appropriate; and Latin

names that were italicized, employed Latin or Latinized words and lacked accented letters. For instance,

he used "Satyre" as a French name, which would be "Satyr" in English, not the Latin Satyrus, and

therefore not a genus epithet. With this distinction, only Godart's Latin names would enter zoological

nomenclature. For instance, for the species known today as Neonympha areolatus (J. E. Smith, 1797)

(type locality USA: Georgia, Chatham Co.), Godart's species number 58, he used "Satyre aréolé" as a

French name, and "Satyrus areolatus" as a Latin name (Godart [1824]). Even more striking an example is

"Polyommate W-blanc" for "Polyommatus W-album" (Godart [1824]: 648). However, for the majority of

species, the second word in the French name matched the species epithet more closely than in these cases.

Because of that, the situation with two sets of names may be confusing to a casual reader, but Godart

meticulously followed this distinction. Only French names were used in the section of the work giving

brief diagnoses (e.g., pp. 460-476) (Godart [1824]). A French name was also used as the title for each

Species description (e.g., pp. 477-552), immediately following the species number. Latin names were

given in the second line of these expanded descriptions, after the French names. Given this distinction

between French and Latin names employed by Godart, a deviant spelling "cautheus" [3 letter "u", not

"n"| occurred only once and in the French name (Godart [1824]: 465), not in the Latin name, and

therefore is irrelevant to zoological nomenclature. The correct (and only) spelling of this species epithet in

Godart's work is "cantheus".

Furthermore, because there was no Fabrician name canthus, there could be no replacement name

for it. Therefore, Godart did not propose a "replacement name", he proposed a new name: Satyrus

cantheus, and this taxon must have had type specimen(s). Because Godart's description of S. cantheus

ends with "(Translation of Fabricius)", it is possible that Godart did not inspect any specimens at all, as

also suggested by Cardé et al. (1970): "type ... probably never existed", but based his new species entirely

on the Fabrician texts. This hypothesis may not be entirely true, because Godart elaborated on the

Fabrician description by mentioning the size of his S. cantheus (species number 56): "Its size is about the

same as the previous one", which was species number 55 P. canthus Linnaeus, 1767 (a junior objective

synonym of L. eurydice) (Godart [1824]). No reference to this size was given in any Fabrician works we

studied, and it should have come from some additional knowledge Godart had about the type specimen(s).

Whether Godart inspected the actual specimens or not, the name-bearing type currently encompasses a

series of all specimens used to constitute Godart's description of cantheus, either directly examined by

him, or described by Fabricius in those parts of his texts that were cited and translated by Godart as

falling under Godart's concept of cantheus. Among these specimens, there should be at least one specimen

possessing, as per its description, a combination of the following four characters: (1) size approximately

as L. eurydice; (2) 3 small indistinct ventral forewing eyespots; (3) the 5" ventral hindwing eyespot

(counting from the apex) being the largest of the six present, and (4) the 6" spot (by the anal angle) being

the smallest. To define the taxon S. cantheus, we hereby designate the syntype that has all 4 characters

stated above and was found first (with the earliest date and time) in the search for syntypes of Satyrus

cantheus as the lectotype of Satyrus cantheus Godart, [1824]. This designation satisfies the ICZN Code

(ICZN 1999). Our lectotype fulfills the definition of the term as a single specimen selected out of

Syntypes subsequently to the establishment of the name (ICZN Code Glossary). The designation is

individual: it is made for cantheus only (Art. 74.3.). We employ the term "lectotype" (Art. 74.7.1.). Our

designation contains information sufficient to recognize this single specimen by the characters given as

being the first syntype found in the search for syntypes that possesses all these characters (Art. 74.7.2.).

The reason for the lectotype designation is to objectively define this taxon by selecting the specimen that

actually agrees with the key characters given in the original description of S. cantheus, and thus represents

this species as intended by Godart, promoting stability of nomenclature.

Next, we searched for the lectotype in collections and databases where the types of Fabricius and

Godart could be. In particular, N.V.G. inspected the holdings of the Muséum National d'Histoire

Naturelle, Paris, France (MNHP), which are known to have a number of Godart types, some with a

characteristic "god." signature on their labels; and looked through the relevant parts of the collections of

the Natural History Museum, London, UK (BMNH) and the Museum fiir Naturkunde, Berlin, Germany

(ZMHB). We also extensively searched online databases, including the Natural History Museum of

Denmark, University of Copenhagen, Denmark (2021), the Hunterian collections, University of Glasgow,

Scotland, UK (2021) and the National Museums of Scotland, Edinburgh, UK (2021). Our searches failed

to find the lectotype that also has not been found by previous workers, and therefore we believe it became

lost. Hence, we proceed herein with a neotype designation. There is an exceptional need to designate the

neotype of S. cantheus. Although this name has not been used as valid for over a century and some

considered it a misspelling (Miller and Brown 1981), others a nomen dubium (Cardé et al. 1970), Viloria

(2021) resurrected it and applied it in a manner inconsistent with the original description. To proceed with

a meaningful integrative taxonomic revision of Hermeuptychia, it is essential to stabilize the identity of S.

cantheus by a neotype that while being in a reasonable agreement with the original description, minimally

disrupts currently used taxonomic arrangement and allows more detailed genomic studies of the neotype.

DNA work plays a highly significant role in Hermeuptychia studies (Cong and Grishin 2014; Seraphim et

al. 2014; Tan et al. 2021). Therefore, the neotype should facilitate DNA-based studies.

First, we agree with Viloria (2021) that S. cantheus is most likely a Hermeuptychia. Its description

is rather similar to the descriptions of other Hermeuptychia species by these authors. Second, in

agreement with the original type locality ("North America", which nevertheless could have been an error

and simply carried by default from P. canthus, which is L. eurydice), we aim to select a neotype from

North America. North American Hermeuptychia are typically decisively smaller than L. eurydice, and the

largest populations are known from the southeastern USA, which is also a general area that contributed

type specimens for many early butterfly names. Therefore, we looked for a southeastern USA

Hermeuptychia specimen that matches best the original description of S. cantheus. The specimen that we

hereby designate as the neotype of Satyrus cantheus Godart, [1824] is the male pictured in Figs. 31, 32.

It largely agrees with the original description: immaculate brown on dorsal side; ventral side paler, with 2

brownish lines on both wings, 3 not very large eyespots on the forewing, 6 on the hindwing, out of which

the 5"" is large and the 6" by the anal angle is smaller. The discrepancies with the original description are:

the 5" eyespot is the same size as the 2" eyespot (not larger); the 6" eyespot, while being small, is larger

than the 1° (not the smallest); and this being large for a USA Hermeuptychia specimen (FW length 17

mm) is still smaller than a typical L. eurydice. However, due to significant variation in Hermeuptychia

eyespots, we were satisfied with the reasonable match to the description, and did not invest additional

effort into looking for a perfect match. Additional advantage of this specimen is the availability of DNA

sequences.

Our neotype of S. cantheus satisfies all the requirements set forth by the ICZN Article 75.3.

Namely: 75.3.1. It 1s designated to clarify the taxonomic identity of Satyrus cantheus Godart, [1824],

which remained undefined until now, impeding research on Hermeuptychia; 75.3.2. The characters that

differentiate this taxon have been given in its original description by Godart ({1824]: 465, 493-494), 1.e.,

wings brown on dorsal side, ventral side paler, with two ferruginous lines spanning both wings, forewing

with three weakly defined eyespots and hindwing with six; 75.3.3. The neotype specimen is a male that

bears the following six rectangular labels: | St. Petersburg, Fla. | XI-3-1938 ], [ H. E. Wilford | collector ],

Grishin ], and [ NEOTYPE < | Satyrus cantheus | Godart, [1824] | designated by Grishin ] and its partial

COI barcode sequence has been deposited in GenBank with accession KJ025563 (Cong and Grishin

2014); 75.3.4. Our search for the lectotype is described above, but it was unsuccessful, leading us to

believe that the lectotype is no longer extant; 75.3.5. The neotype is consistent with what is known about

this taxon, in particular with the original description: e.g. ventrally, it has 3 less prominent eyespots on the

forewings and 6 eyespots on the hindwings, the 5" of which is large and the one by the anal angle is

small; 75.3.6. The neotype is from USA: Florida: Pinellas Co., St. Petersburg, and the lectotype was

stated to be from North America with no other details given about the locality; 75.3.7. The neotype is in

the collection of the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA

(USNM).

The neotype of S. cantheus is the species known today as Hermeuptychia sosybius (Fabricius,

1793) (Cong and Grishin 2014): it has patches of darker androconia on the dorsal surface of the wings and

its COI barcode sequence is identical to that of the H. sosybius neotype. Therefore, Satyrus cantheus

Godart, [1824] is a junior subjective synonym of Hermeuptychia sosybius (Fabricius, 1793).

Papilio camerta Cramer, 1780 is a nomen dubium

Only the ventral side is illustrated in the original description of Papilio camerta Cramer, 1780 (type

locality Suriname). The wings exhibit 2 median lines, 3 marginal lines, and small and similarly-sized

submarginal dark eyespots: 4 on the forewing (no eyespot in cell Rs-M; by the apex) and 6 on the

hindwing, each encircled with yellow and pupillated with silvery-blue. We also inspected and

photographed the original drawing of P. camerta by G. W. Lambertz in the Library of the Natural History

Museum, London, that served as a model for published engravings (Gilbert 2000). The Lambertz

drawings, which are usually more accurate than stylized engravings, could help identify the species

illustrated. Indeed, the Lambertz drawing of P. camerta reveals differences between the eyespots in this

specimen: all forewing eyespots and the qin eyespot on the hindwing (in cell M3-CuA,) are brown, others

are black.

The ventral wing pattern combined with small size (forewing length 17 mm on the drawing)

suggest that P. camerta may indeed be a Hermeuptychia species as currently placed (Lamas 2004).

However, there is no dark dash at the end of the ventral forewing discal cell, and the description clearly

mentions an eyespot (encircled yellow and pupillated with a silvery dot) on the dorsal forewing

"extremities" (Cramer 1780). We know of no species worldwide that match the P. camerta description

together with the Lambertz illustration. Similarly to Weymer (1910-1912), we cannot explain the dorsal

forewing eyespot mentioned in the original description, and for this reason place Papilio camerta

Cramer, 1780 as a nomen dubium until a meaningful explanation can be found.

Assuming a number of inaccuracies, we can offer a hypothesis about the identity of P. camerta.

Silver pupils in some eyespots on the Lambertz drawing are not round but irregular, and seemingly made

by more than one stroke of a brush (they are rounder on the engraving though) (Fig. 38). It is unclear

whether this is an imperfection of the drawing, or it meant to depict bipupillated eyespots. If the eyespots

were bipupillated, then this species could have been Paryphthimoides poltys (Prittwitz, 1865) or a

relative, and the dorsal eyespot might have been on the "extremities" of the hindwings (not forewings: a

possible mistake in the description), as in Paryphthimoides Forster, 1964. In some specimens of P. poltys,

the differences between eyespots agree with the Lambertz illustration: the forewing eyespots and the 4"

hindwing eyespot are more brown than black, and the dashes at the end of the discal cells are vestigial on

both wings. Thus, if "tippen" (Dutch) / "extremités "(French) meant anal angle, forewing was a /apsus

calami for hindwing, and with irregular silvery-blue dots in the eyespots Lambertz was depicting

bipupillation, then P. camerta may be conspecific with P. poltys. Alternatively, is it conceivable that the

dorsal eyespot mentioned in the description may have been on a specimen of a different species than the

one illustrated by Lambertz, making the type series polytypic. These issues remain to be investigated and

1cm

Image of the original description, pp.

- fig. F. Camerta. Is ook eene Suri-

naamfch Kapelletje, ’t welk de bovenzy-

de der vieugelen effen bruin heeft. Aan

de tippen der voorften is een klein oogs-

wys vlakje geplaatft in een geelen ring,

in ‘t midden van ’t zelve een zilverglan-

zig ftipje. Met diergelyke ftipjes zyn

mede de twintig zogenaamde oogjes op

de onderzyde gefiert. ;

Fig. G. H. Lifandra. Dit Kapelletje

is uit China afkomftig, en beruft nevens

alle op deze Plaat afgebeelde Kapellen

in de Verzameling van den Heer C. Szol/.

Interpretation of the original text

Fig. F. Camerta. Is ook eene Suri-

naamsch Kapelletje, ‘t welk de bovenzy-

de der vleugelen effen bruin heeft. Aan

de tippen der voorsten is een klein oogs-

wys vlakje geplaatst in een geelen ring,

in 't midden van 't zelve een zilverglan-

zig stipje. Met diergelyke stipjes zyn

mede de twintig zogenaamde oogjes op

de onderzyde gesiert.

Fig. G. H. Lisandra. Dit Kapelletje

is uit China afkomstig, en berust nevens

alle op deze Plaat afgebeelde Kapellen

in de Verzameling van den Heer C. Stoll.

p. 207

Weymer 1911

camerta, Lambertz drawing

268

bk ted -

™? ” —ypprctee —

Ge % Hes SS a. 2

»> of we aoe cblas sae,

Mevagiotta’

Satesare

10-11

Fig. F. Camerta. Cef? auffi un petit

Papillon de Suriname dont le deffes des

diles eft dun brun fimple. Vers les ex-

tremités des antérieures fe trouve une

petite tache oeillée dans un anneau jau-

ne; au milieu de cette tache fe voit un:

petit point Pun luftre argenté. Les vingt

petits yeux femblables, qui fe trouvent

fur la furface inféerieure , Ae ornés de

pareils points.

Fig. G. H. Lifandra. Ce petit - Papil:

lon eft de la Chine & fe trouve avec tous

les autres Papillons de cette Planche ,

dans la Collettion de Mr. C. Stoll.

Fig. F. Camerta. C’est aussi un petit

Papillon de Suriname dont le dessus des

ailes est d'un brun simple. Vers les ex-

tremités des antérieures se trouve une

petite tache oeillée dans un anneau jau-

ne; & au milieu de cette tache se voit un

petit point d'un lustre argenté. Les vingt

petits yeux semblables, qui se trouvent

sur la surface inférieure , sont ornés de

pareils points.

Fig. G. H. Lisandra. Ce petit Papil-

lon est de la Chine & se trouve avec tous

les autres Papillons de cette Planche ,

dans la Collection de Mr. C. Stoll.

pecies with hermes, sosybius and allax, but do

ence I regard camerta as a separate species.

camerta, published engraving in Cramer

Word-to-word translation from French

Fig. F. Camerta. This ’s also a small

Butterfly from Suriname whose the dorsal of

wings is ofa brown plain. To the ex-

tremities of forewings is located a

small spot eye-like in a ring yel-

low; & in the middle of this spot seen a

small dot of a sheen silver. The twenty

small eyes similar, which are located

on the surface ventral, are decorated with

such dots.

Fig. G. H. Lisandra. This small But-

terfly is from the China & is located with all

the other Butterflies from this Plate ,

in the Collection of Mr. C. Stoll.

Interpretive translation

Fig. F. Camerta. This is also a small

butterfly from Suriname, its dorsal

surface of wings is plain brown. At the

tips of forewings [sic!] there is a

small eyespot encircled with yel-

low, & in the middle of this spot there is

a small gleaming silvery pupil. Twenty

similar small eyespots, which are

on the ventral surface, are decorated with

such pupils.

Fig. G. H. Lisandra. This small but-

butterfly is from China & like all

the other butterflies on this plate, it is

in the collection of Mr. C. Stoll.

E. camerta Cr. Above brown. Forewing before the apex with a small eye-spot with yellow ring and camerta.

silvery pupil. Under surface of the forewing with 4, of the hindwing with 6 similar ocelli of the same size, all

with silver pupils, both wings with 2 brown, parallel median lines, curved on the hindwing, and with 3 marginal

lines. From Surinam. GopMan and Satvin indeed unite this s

not mention in their description the silv |

in the 4th volume of CRaMER’s work.

Fig. 38. Papilio camerta Cramer, 1780. The original drawing (Lambertz, insets show enlarged right hindwing eyespots, © The Trustees of the Natural History

Museum London, used with permission), published engraving and original description (Cramer 1780), its translation, and the text from Weymer (1911).

the best compromise reached. While we are not able to solve the problem of the P. camerta identity, to

facilitate its eventual resolution, we illustrate the Lambertz drawing, the published engraving, and provide

translations of the original description (Fig. 38).

ACKNOWLEDGMENTS

We are grateful to Blanca Huertas, David Lees and Geoff Martin (BMNH: Natural History Museum,

London, UK), Rodolphe Rougerie (MNHP: Muséum National d'Histoire Naturelle, Paris, France), Alex

Wild (TMMC: University of Texas Biodiversity Center, Austin, TX, USA), Robert K. Robbins, John M.

Burns, and Brian Harris (USNM: National Museum of Natural History, Smithsonian Institution,

Washington, DC, USA) and Wolfram Mey and Viola Richter (ZMHB: Museum fiir Naturkunde, Berlin,

Germany) for granting access to the collections under their care and help; James A. Scott for specimens;

Bernard Hermier, Noemy Seraphim, and Keith Willmott for stimulating discussions, advice and helpful

suggestions, Paul A. Opler and David M. Wright for insightful discussions and critical review of the

manuscript. We are indebted to the Texas Parks and Wildlife Department (Natural Resources Program

Director David H. Riskind) for research permit 08-02Rev to N.V.G. A.V.L.F. thanks the Brazilian

Research Council — CNPq (fellowship 304291/2020-0) and NSF (DEB-1256742); E.P.B. was supported

by Brazilian Research Council — CNPq - (162673/2020-5); M.A.M. was supported by Fapesp (2018/

11910—1) and CAPES (Finance code 001). This study has been supported in part by grants from the

National Institutes of Health GM127390 and the Welch Foundation I-1505 to N.V.G.

LITERATURE CITED

Barbosa, T. 2019. Photograph to be found on iNaturalist [Online database]. Available from: <https://www.

inaturalist.org/observations/97 192375> [Accessed: 20 October 2021].

Beccaloni, G., M. Scoble, I. Kitching, T. Simonsen, G. Robinson, B. Pitkin, A. Hine, and C. Lyall.

2003. The Global Lepidoptera Names Index (LepIndex). World Wide Web electronic publication

https://www.nhm.ac.uk/our-science/data/lepindex/lepindex/ [accessed 16 October 2021].

Braun, H. 2019. Photograph to be found on iNaturalist [Online database]. Available from: <https://www.

inaturalist.org/observations/34332923 [Accessed: 20 October 2021].

Burmeister, H. 1878. Description physique de la République Argentine d'aprés des observations

personnelles et étrangeres. 5. Lépidopteres. Premiere partie. Contenant les diurnes, crépusculaires

et bombycoides. Buenos Aires: P. E. Conti; Paris: F. Savy; Halle: E. Anton. vi + 526 pp.

Calhoun, J. V. 2018. John Abbot, Jacob Hiibner and Oreas helicta (Nymphalidae: Satyrinae). News of

the Lepidopterists’ Society 60(4): 159-163.

Cardé, R. T., A. M. Shapiro, and H. K. Clench. 1970. Sibling species in the eurydice group of Lethe

(Lepidoptera: Satyridae). Psyche: A Journal of Entomology 77(1): 70-103.

Cong, Q., and N. V. Grishin. 2014. A new Hermeuptychia (Lepidoptera, Nymphalidae, Satyrinae) is

sympatric and synchronic with H. sosybius in southeast US coastal plains, while another new

Hermeuptychia species - not hermes - inhabits south Texas and northeast Mexico. Zookeys (379):

43-91.

Cong, Q., J. Shen, J. Zhang, W. Li, L. N. Kinch, J. V. Calhoun, A. D. Warren, and N. V. Grishin.

2021. Genomics reveals the origins of historical specimens. Molecular Biology and Evolution

38(5): 2166-2176.

Cramer, P. 1780. De uitlandsche Kapellen voorkomende in de drie Waereld-Deelen Asia, Africa en

America. Papillons exotiques des trois parties du monde I'Asie, l'Afrique et l'Amérique.

Amsteldam: S.J. Baalde; Utrecht, Barthelemy Wild and J. Van Schoonhoven & Comp. 4(25/26):

1-28, pls. 289-304.

D’Abrera, B. 1988. Butterflies of the Neotropical Region. Part V. Nymphalidae (Conc.) & Satyridae.

Victoria, Black Rock: Hill House. [vii] + pp. 679-877.

Fabricius, J. C. 1775. Systema entomologiae, sistens insectorvm classes, ordines, genera, species,

adiectis synonymis, locis, descriptionibvs, observationibvs. Flensburgi et Lipsiae: Officina

Libraria Kortit. [iv] + [xu] + [xvi] + 832 pp.

Fabricius, J. C. 1781-[1782]. Species insectorvm exhibentes eorvm differentias specificas, synonyma

avctorvm, loca natalia, metamorphosin adiectis observationibvs, descriptionibvs. Hamburgii et

Kiloni: Carol. Ernest. Bohni. 2: 517 + [1] pp.

Fabricius, J. C. 1793. Entomologia systematica emendata et aucta. Secundum classes, ordines, genera,

Species adjectis synonimis, locis, observationibus, descriptionibus. Hafniae: C. G. Proft, Fil. et

Soc. 3(1): [vi] + 488 pp.

Forster, W. 1964. Beitraége zur Kenntnis der Insektenfauna Boliviens XIX. Lepidoptera III. Satyridae.

Veroffentlichungen der zoologischen Staatssammlung Miinchen 8: 51-188.

Freitas, A. V. L., E. P. Barbosa, and J. Y. O. Carreira. 2021. Immature stages and natural history of

Yphthimoides borasta (Nymphalidae: Euptychiina). Tropical Lepidoptera Research 31(1): 42-47.

Freitas, A. V. L., E. O. Emery, and O. H. H. Mielke. 2010. A new species of Moneuptychia Forster

(Lepidoptera: Satyrinae: Euptychiina) from Central Brazil. Neotropical Entomology 39(1): 83-90.

Gascuel, O. 1997. BIONJ: an improved version of the NJ algorithm based on a simple model of sequence

data. Molecular Biology and Evolution 14(7): 685-695.

Gilbert, P. 2000. Butterfly collectors and painters: four centuries of colour plates from the library

collections of The Natural History Museum, London. Singapore: Beaumont. 166 pp., 60 pl.

Godart, J. B. [1824]. [Papillons]. pp. 329-828. Jn: Latreille, P. A., and J. B. Godart (Eds.). Encyclopédie

Méthodique. Histoire naturelle. Entomologie, ou Histoire Naturelle des Crustacés, des Arachnides

et des Insectes. Paris: veuve Agasse. 9(2).

Hemming, A. F. 1937. Hiibner. A bibliographical and systematic account of the entomological works of

Jacob Hiibner and of the supplements thereto by Carl Geyer, Gottfried Franz von Fréhlich and

Gottlieb August Wilhelm Herrich-Schaffer. London, Royal Entomological Society. 1: xxxiv + 605

pp., frontisp.; 2: tx + [1] + 270 pp.

Hiibner, J. 1823. Zutrage zur Sammlung exotischer Schmettlinge, bestehend in Bekundigung einzelner

Fliegmuster neuer oder rarer nichteuropdéischer Gattungen. Augsburg: Jacob Hibner. 2: 1—40.

ICZN [International Commission on Zoological Nomenclature]. 1999. International Code of

Zoological Nomenclature. Fourth edition. London: The International Trust for Zoological

Nomenclature. xxx + 306 pp.

Jukes, T. H., and C. R. Cantor. 1969. Evolution of protein molecules. pp. 21-132 Jn: Munro, H. N.

(Ed.). Mammalian Protein Metabolism. New York: Academic Press.

Lamas, G. 2004. Nymphalidae. Satyrinae. Tribe Satyrini. Subtribe Euptychiina. pp. 217-223. Jn: Lamas,

G. (Ed.). Checklist: Part 4A. Hesperioidea - Papilionoidea. In: Heppner, J. B. (Ed.), Atlas of

Neotropical Lepidoptera. Volume 5A. Gainesville: Association for Tropical Lepidoptera /

Scientific Publishers.

Miller, L. D., and F. M. Brown. 1981. A catalogue / checklist of the butterflies of America north of

Mexico. Memoir. The Lepidopterists' Society. 2: vil + 280 pp.

Nakahara, S., D. Tan, G. Lamas, A. Parus, and K. R. Willmott. 2017. A distinctive new species of

Hermeuptychia Forster, 1964 from the eastern tropical Andes (Lepidoptera: Nymphalidae:

Satyrinae). Tropical Lepidoptera Research 26(2): 77-84.

National Museums of Scotland. 2021. The collections database <https://www.nms.ac.uk/explore-our-

collections/search-our-collections/> [accessed 27 October 2021].

Ratnasingham, S., and P. D. Hebert. 2007. BOLD: The Barcode of Life Data System (http://www.

barcodinglife.org). Molecular Ecology Notes 7(3): 355-364.

Reakirt, T. [1867]. Descriptions of some new species of diurnal Lepidoptera. Series II. Proceedings of

the Academy of Natural Sciences of Philadelphia 18(4): 33 1-336.

Scudder, S. H. 1875. Synonymic list of the butterflies of North America, North of Mexico. Part I.

Nymphales. Bulletin of the Buffalo Society of Natural Sciences: 2(4): 233-269.

Seraphim, N., M. A. Marin, A. V. L. Freitas, and K. L. Silva-Brand4o. 2014. Morphological and

molecular marker contributions to disentangling the cryptic Hermeuptychia hermes species

complex (Nymphalidae: Satyrinae: Euptychiina). Molecular Ecology Resources 14(1): 39-49.

Tan, D., A. Parus, M. Dunbar, M. Espeland, and K. R. Willmott. 2021. Cytochrome c oxidase subunit

I barcode species delineation methods imply critically underestimated diversity in ‘common’

Hermeuptychia butterflies (Lepidoptera: Nymphalidae: Satyrinae). Zoological Journal of the

Linnean Society zlab007.

University of Copenhagen. 2021. Fabricius’ collection <https://samlinger.snm.ku.dk/en/dry-and-wet-

collections/zoology/entomology/fabricius-collection/> [accessed on 17 October 2021].

University of Glasgow. 2021. The Hunterian Collections search <http://collections.gla.ac.uk/#/

advancedsearch> [accessed 17 October 2021].

Viloria, A. L. 2021. "The Hermeuptychia Papers". Anartia 32: 26—52.

Warren, A. D., K. J. Davis, E. M. Stangeland, J. P. Pelham, K. R. Willmott, and N. V. Grishin.

2016. Illustrated Lists of American Butterflies. [21-XI-2017].

Weymer, G. 1910-1912. 4. Familie: Satyridae. pp. 173-280. In: Seitz, A. (Ed.). Die Gross-

Schmetterlinge der Erde. Stuttgart: A. Kernen. 5.

Zacca, T., M. M. Casagrande, O. H. H. Mielke, B. Huertas, E. P. Barbosa, A. V. L. Freitas, and K.

R. Willmott. 2020. Description of Emeryus Zacca, Mielke & Casagrande gen. nov. (Lepidoptera:

Nymphalidae) to accommodate three species formerly placed in Paryphthimoides Forster, 1964.

Austral Entomology 59(3): 505-523.

Zacca, T., M. M. Casagrande, O. H. H. Mielke, B. Huertas, A. V. L. Freitas, M. A. Marin, M.

Espeland, and K. R. Willmott. 2021. A new euptychiine butterfly species from south Brazil and

taxonomic rearrangements for Taydebis Freitas, 2013 and Hermeuptychia Forster, 1964

(Lepidoptera: Nymphalidae: Satyrinae). Zootaxa 5023(4): 555—570.

Zimsen, E. 1964. The type material of I. C. Fabricius. Copenhagen: Munksgaard. 656 pp., 3 figs.

The Taxonomic Report

is a publication of

The International Lepidoptera Survey (TILS)

The International Lepidoptera Survey is registered as a non-profit Limited Liability Company (LLC) in

the state of Virginia, U.S.A. The Taxonomic Report (TTR) is published for the purpose of providing a

public and permanent scientific record. It appears in digital, open-access form, is regularly disseminated

in hardcopy form to select institutional repositories and is also available as printed copy upon request at

the discretion of authors and/or the editor. Printing and postage costs may apply. Contents are peer-

reviewed but not necessarily through the anonymous review and comment process preferred by some

publishers of serial literature. Copies of all TTR papers are available via the following digital

repositories: Internet Archive (https://archive.org/), | Biodiversity Heritage —_ Library

(https://www.biodiversitylibrary.org), Zobodat (https://www.zobodat.at/) and at the archival TTR website:

(http://lepsurvey.carolinanature.com/report.html).

TILS Purpose

TILS is devoted to the worldwide collection of Lepidoptera for the purpose of scientific discovery,

determination, and documentation, without which there can be no preservation.

TILS Motto

“As a world community, we cannot protect that which we do not know”

Articles for publication are sought

They may deal with any area of research on Lepidoptera, including faunal surveys, conservation topics,

methods, etc. Taxonomic papers are especially welcome. There are no page charges for authors. Before

sending a manuscript, simply write to TTR editor, Harry Pavulaan, 606 Hunton Place NE, Leesburg,

VA, 20176, USA to initiate discussion on how to best handle your material for publication, and to discuss

peer review options; or email to intlepsurvey@gmail.com.

Visit The International Lepidoptera Survey on the World Wide Web at:

http://lepsurvey.carolinanature.com

Join the discussion at our list servers on Groups.io at:

https://groups.io/g/TILS

or subscribe by sending an email to: TILS+subscribe@groups.io

Join The International Lepidoptera Survey on Facebook at:

https://www.facebook.com/groups/1072292259768446