Contents

Volume 64 2007

1 > A new pipefish, Stigmatopora narinosa (Syngnathidae) from South Australia

Robert K. Browne and Kevin Smith

7 > Description of Amischa paolettii sp. nov. and Thamiaraea tsitsilasi sp. nov. from the Australian

region (Coleoptera, Staphylinidae)

Roberto Pace

13 > New genera and new species of the subfamily Aleocharinae from Australia (Coleoptera,

Staphylinidae)

Roberto Pace

23 > New cucumariid species from southern Australia (Echinodermata: Holothuroidea:

Dendrochirotida: Cucumariidae)

P. Mark O’Loughlin

35 > New Holothuria species from Australia (Echinodermata: Holothuroidea: Holothuriidae), with

comments on the origin of deep and cool holothuriids

P. Mark O’Loughlin, Gustav Pau lay, Didier Vandenspiegel and Yves Samyn

53 > New apodid species from southern Australia (Echinodermata: Holothuroidea: Apodida)

P. Mark O’Loughlin and Didier Vandenspiegel

71 > A new fissiparous micro-asteriid from southern Australia (Echinodermata: Asteroidea: Asteriidae)

Milena Benavides-Serrato, P. Mark O’Loughlin and Chris Rowley

79 > A new species of Colossendeis (Pycnogonida: Colossendeidae) together with records from

Australian and New Zealand waters

David A. Staples

95 > Pycnogonids (Arthropoda: Pycnogonida) from the Great Australian Bight, southern Australia,

with description of two new species.

David A. Staples

103 > Notes on Candelabrum australe Briggs, 1928 (Hydrozoa, Anthoathecatae)

Jeanette E. Watson

107 > New apseudomorph tanaidaceans (Crustacea: Peracarida: Tanaidacea) from eastern

Australia: Apseudidae, Whiteleggiidae, Metapseudidae and Pagurapseudidae

Magdalena Blazewicz-Paszkowycz and Roger N. Bamber

Typeset by The printer's drawers

Printed by BPA Print Group

Museum Victoria, formerly the Museum of Victoria, was formed in 1983

by the merger of the National Museum of Victoria (established in 1854)

and the Science Museum of V ictoria (established in 1870). Museum

Victoria undertakes research in order to contribute to a deeper

understanding and appreciation of the origins, diversity and development

of Australia’s natural, cultural and scientific heritage, and applies this

knowledge for the benefit of society . Museum V ictoria publishes its

scientific journal Memoirs of Museum Victoria (until 1983 Memoirs of

the National Museum of Victoria) to further these objectives.

The Memoirs publishes papers on original research in the natural

sciences pertinent to Victoria and/or the Museum’s collections.

All contributions are assessed by independent referees before

publication.

From Volume 58 (2000) the Memoirs is available in electronic

format as well as in printed form from the Museum V ictoria website.

Electronic publication will enable inclusion of supplementary information

(such as extended data-sets) not available in the printed version.

The Memoirs is available in printed form by subscription or institutional

exchange. Enquiries should be directed to the Librarian, Museum

Victoria, GPO Box 666, Melbourne, V ic. 3001 , Australia (library©

museum.vic.gov.au). Access to the electronic version of the journal is

available free of charge and individual papers may be downloaded as

.pdf files from this website. Reprints are available at cost.

Editorial Committee

The Memoirs of Museum Victoria is published by order of the

Museums Board of Victoria. Acceptance of papers is handled by the

Editorial Committee which will seek the widest possible advice from

referees. Papers should be submitted in the first instance to the

Scientific Editor, Museum Victoria, GPO Box 666, Melbourne, Vic.

3001, Australia (memoirs@museum.vic.gov.au).

Scientific Editor

Richard Marchant

Editorial Board

Martin F. Gomon

David J. Holloway

Gary C. B. Poore

Kenneth Walker

Robin S. Wilson

Instructions to Authors

To obtain a copy of the Museum Memoirs style guide and

instructions for submitting manuscripts and images please contact

Richard Marchant, Scientific Editor on rmarch@museum.vic.gov.au

Memoirs of Museum Victoria 64: 1-6 (2007)

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/Memoirs/

A new pipefish, Stigmatopora narinosd3$ yngnathidae) froiS* outh Australia

Robert K. Browne 1 ’ 2 and Kevin Smith 2

'South Australian Museum, North Terrace, Adelaide, South Australia, Australia (robert.browne@gmail.com)

2 Inshore Fish Group, www.ifg.bioteck.org

Abstract Browne, R.K. and Smith, K. 2007. A new pipefish, Stigmatopora narinosa (Syngnathidae) from South Australia. Memoirs

of Museum Victoria 64: 1-6.

A new species of pipefish, Stigmatopora narinosa sp. nov. (Teleostei, Syngnathidae) is described from Gulf St.

Vincent and Spencer Gulf, South Australia. S. narinosa shares with the other three described Stigmatopora species a

similar fin placement, fully enclosed brood pouch, superior and inferior trunk and tail ridges continuous, a lateral trunk

ridge ending midlaterally. S. narinosa, S. nigra Kaup, 1853, and S. argus Richardson, 1840, have long prehensile tails

and all Stigmatopora lack caudal fins. S. narinosa is most similar in meristics to S. nigra in having the dorsal fin

initiating on about the fifth to seventh trunk ring and the lateral trunk ridge terminating across the second tail ring. In

other Stigmatopora species the dorsal fin originates on the ninth to thirteenth trunk ring, the lateral trunk ridge

terminates between the eighth to thirty-second tail ring, S. narinosa is distinguished from sympatric S. nigra in having

nine (range, 8. 2-9.8), rather than six sub-dorsal tail rings (range, 4.8-7.1), a greater number of sub-dorsal tail and total

rings, a greater number of dorsal-fin rays, a shorter laterally flattened and dorsally elevated snout, a distinct banded

pattern in both live and preserved specimens, a larger brood number and a double layer of eggs in the brood pouch. The

brood pouch is under the anterior portion of the tail and extends for 15-18 rings from the anal ring; pouch plates are

absent or vestigial, and the folds of the semi-pouch enclosure meet on the ventral midline. The eggs are deposited in up

to two layers, one lining the dorsum of the pouch and the other separated by a membranous partition, and the brood of

up to 98 eggs is larger than the maximum number of 41 found in S. nigra and S. argus. S. narinosa young at birth are

approximately 18 mm, S. nigra 13 mm, and S. argus 32 mm total length. S. narinosa has a very restricted known range

and habitat, inhabiting patchy open beds of sea-grasses with brown algae on sandy rubble substrate between 1 m and 5

m depth over less than 200 km of coastline.

Keywords New species, syngnathid, marine, Stigmatopora narinosa, taxonomy, Stigmatopora nigra.

Introduction

In 2003, we examined syngnathids in the South Australia

Museum collection to collect data on range, brood size, and

different brood morphologies. Among the specimens were

several examples of a Stigmatopora sp. with a unique sub-

dorsal tail ring count, snout shape, and coloration. The earliest

of these was collected in 1964. In the collection these were

identified as Stigmatopora sp. or unnamed, with several

specimens lacking accession numbers (Browne, 2003).

The Southern Australasian genus of pipefish the

Stigmatopora was first described by Kaup (1853). Stigmatopora

shares with the more tropical Syngnathoides Bleeker, 1851 and

Solegnathus ( Runcinatus ) Whitley, 1929 confluent inferior

ridges and superior ridges, dorsal-fin origin on the trunk,

absence of a caudal fin, presence of pectoral fins in adults and

a lateral trunk ridge ending without a ventral deflection. These

genera differ through the positioning of the male brood region

beneath the tail in Stigmatopora and Solegnathus ( Runcinatus )

rather than beneath the trunk in Syngnathoides (Dawson,

1982) and the development of a semi-pouch enclosure in

Stigmatopora compared with unprotected membranous

compartments in Syngnathoides and Solegnathus ( Runcinatus )

(Dawson, 1985). When preserved Stigamotopora lacks the

distal ly coiled prehensile tail found in representatives of both

Syngnathoides and Runcinatus (Dawson, 1982). Nevertheless,

we have observed S. narinosa sp. nov., S. nigra Kaup, 1853,

and S. argus Richardson, 1840 holding seaweed with their

prehensile tails (fig. 1).

Dawson (1982) reviewed Stigmatopora and found

considerable differences in meristic values between populations

within the three recognized species: the Australian and New

Zealand S. nigra, the Australian S. argus, and the New Zealand

S. macropterygia Dumeril, 1870. Despite the variation,

S. nigra was distinguished from the other two Stigmatopora

spp. by its dorsal-fin origin on the fifth to seventh trunk ring

Robert K. Browne and Kevin Smith

and the lateral trunk ridge ending median on the second tail

ring; S. argus and S. macropterygia have the dorsal-fin origin

on the ninth to thirteenth trunk ring, while the lateral trunk

ridge in S. argus terminates on the eighth to twentieth tail ring

and the twenty-fourth to thirty-fifth tail ring inS. macropterygia.

Dawson (1982) examined specimens of S. nigra from New

Zealand and from southern Queensland, New South Wales,

Victoria, Tasmania, and Western Australia but not South

Australia, He examined specimens of S. argus from these

states and also South Australia. Photos of S. narinosa sp. nov.

from Edithburg, South Australia, (Kuiter, 2000) were identified

as S. olivacea (Castelnau, 1872). Examinations of images of

the type of S. olivacea (Museum National d’Histoire Naturelle,

Paris, France, A.738) revealed a typical S. argus. Besides the

above, no other Stigmatopora spp. were recognized by Dawson

(1982).

Consequently, we conducted field surveys to obtain further

specimens of Stigmatopora narinosa sp. nov.. We sampled ten

specimens of S. nigra within the range of S. narinosa for

meristic and morphometric comparison. In addition, we

collated biological information through literature searches of

all species in the Stigmatopora and compared their biology

and ecology with that of S. narinosa.

Materials and methods

Specimens of S. narinosa sp. nov. that were examined are

lodged in the South Australian Museum (SAM), Adelaide,

South Australia, Australia; and in the Museum Victoria

(NMV), Melbourne, Victoria, Australia. Tail ring counts and

total length were recorded only for specimens with unbroken

tails. Meristic values of SAM F10190 and NMV A29231 were

used for brood pouch position and egg counts. The drawing in

fig. 2 was taken from the paratype SAM 10186 to reduce

damage through handling of the holotype.

Counts and measurements follow the methodology of

Dawson (1982). Lengths were measured to the nearest

0.1 mm. Data as ratios were Arcsine transformed before

testing for normality (Shapiro-Wilk W test) and homogeneity

of variance (O’Brian’s). Counts or transformed data were then

subject to t- tests. All statistical analyses were performed

using the JMP 5.1 software package (SAS Institute Inc., Cary,

NC, USA).

The morphological abbreviations used are: DO - dorsal

origin; D = dorsal ray count; P = pectoral ray count; A = anal-

fin ray count; TR = trunk rings; TAR = tail rings; SDTR =

sub-dorsal trunk rings; SDTAR = sub-dorsal tail rings; SDR =

total sub-dorsal rings; SD = snout depth, least vertical

dimension posteriad of mouth; SnL = snout length, from tip of

lower to posterior side of eye socket; SW - snout width, least

horizontal measurement between the tip of the snout and the

anterior eye socket; HL = head length, from tip of lower jaw to

rear margin of operculum; TrL = trunk length , length from

posterior of operculum to vent; TL = total length; STR =

superior trunk ridge; STAR = superior tail ridge; ITR = inferior

trunk ridge; ITAR = inferior tail ridge; LTR - lateral trunk

ridge; LTAR = lateral tail ridge.

Figure 1. S. narinosa sp. nov. from Port Victoria, Spencer Gulf, with

its prehensile tail coiled around macroalgae. The parasite is an isopod

which is also commonly found on the leafy seadragon ( Phycodurus

equis). Image Graham Short.

Stigmatopora narinosa sp. nov.

Figures 2-5. Tables 1, 2.

Figured as Stigmatopora olivacea Castelnau, 1872: Gulf Pipefish

in Kuiter (2000): 199: figs A-D. Note that female in fig. C is S. argus.

In contradiction to the captions these images were taken at Edithburgh,

South Australia (Kuiter, pers. com).

Holotype: male, SAM F10190, 150 mm TL, South Australia,

Edithburg Pool, 35°05'S, 137°45'E, 31 Dec 2003. Hand netted at 10.30

am while scuba diving 30 m offshore at 2-m depth MLWS, in an open

bed of mixed Posidonia sp. and Zostera sp. sea-grasses, with brown

algae, on a sandy rubble substrate.

Paratypes: South Australia: SAMF10186, 135 mm TL, Edithburgh

Pool, 35°05'S, 137°45'E, 29 Dec 2004. SAM F10194, 60 and 64 mm

TL, Magazine Bay, Pt. Turton, 34°55'S, 137°20'E, 18 Jan 2004. SAM

F10195, 72 mm TL, Port Victoria, 34°29'S, 137°28'E, 7 Jan 2004.

NMV A29230-001, 143, 130, 122, 131 mm TL, Edithburg Pool,

35°05'S, 137°45'E, 22 Oct 2005. NMV A29231-001, 141, 117, 141, 128,

130 mm TL, Port Hughes Jetty, 34°04'S, 137°32'E , 30 Oct 2005.

Other material examined. SAM F 7458, 122 and 94 mm TL, Edithburgh

Jetty, 35°05'S, 137° 45’E, 13 Apr 1992. SAM F 7550, 95 mm TL,

Edithburgh Jetty, 35°05'S, 137°45'E, 15 Mar 1994. SAM F 7551, 73 mm

TL, Edithburgh Jetty, 35°05'S, 137°45'E, 13 Apr 1992. SAM F10159,

90 mm TL, Seacliff, 35°02'S, 138°31'E, 5 Mar 2003. SAM F10160,

92 mm TL, Seacliff, 35°02'S, 138°31'E, 5 Mar 2003. SAM F10171,

114 mm TL, Port Hughes Jetty, 34°04'S, 137°32'E, 18Mar 1994.F10186,

135 mm TL, Edithburgh Pool, 35°05’S, 137°45'E, 29 Dec 2004. SAM

F10191, 74mm TL, Port Vincent, 34°46'S, 137°52'E, 1964. SAMF10192,

70 mm TL, Seacliff, 35°02'S, 138°31'E, 5 Mar 2003. SAM F10193, 65

mm TL, Edithburgh Jetty, 35°05'S, 137°45'E, 1981. F10194, 60 and 64

mm TL, Magazine Bay, Pt. Turton, 34°55’S, 137°20'E, 18 Jan 2004.

F10195, 72 mm TL, Port Victoria, 34°29’S, 137°28'E, 17 Jan 2004.

Specimens of S. narinosa sp. nov. (n = 7) for statistical meristic

and morphometric comparison were SAM F 7458, SAM F 7550, SAM

F 7551, SAM F10159, SAM F10160, SAM F10171. Comparative

material of S. nigra (SAM F10185, n = 10) used for statistical

comparison was collected at O’Sullivans Beach Marina (35°02’S,

138°31'E). Other comparisons were with Dawson (1982).

A New Pipefish, Stigmatopora narinosa (Teleostei, Syngnathidae)

Table 1. Meristic counts for S. narinosa, and S. nigra from South Australia.

Species / counts

Dorsal

Pectoral

SDTR

SDTAR

SDR

S. nigra

36.0 + 1.1 34—38

13.0 + 0.0 13-13

10.57 + 0.45 10.0-12.5

6.23 + 0.18 4.8-7. 1

16.8 + 0.6

16.00-18.00

S. narinosa

40.8 ± 2.3 37^4-5

12.4 + 0.5 12-13

11.75+ 1.00 9.0-12.5

9.08 + 0.17 8.2-9. 8

19.8 + 1.1

19.25-22.25

Probability

P<0.01

P<0.05

P for f-test. NS = not significant. Dorsal = dorsal ray count; Pectoral = pectoral ray count; SDTR = sub-dorsal trunk rings ngs; SDTAR =

sub-dorsal tail rings; SDR = total sub-dorsal rings. Values are expressed as means ± SD, range.

Table 2. Measurement ratios for S. narinosa and S. nigra from South Australia.

Species / ratios

SD/SnL

SW/SnL

HL/TrL

SnL/TrL

SnL/HL

S. nigra

0.09 + 0.01

0.08-0.10

0.06 + 0.01 0.05-0.06

0.68 + 0.13 0.59-0.76

0.43 + 0.03 0.39-0.48

0.64 + 0.02 0.60-0.67

S. narinosa

0.13 + 0.02

0.10-0.17

0.14 + 0.03 0.10-0.18

0.66 + 0.05 0.58-0.68

0.38 + 0.02 0.34—0.40

0.61 + 0.03 0.56-0.65

Probability

P<0.01

SD = snout depth, least vertical dimension posteriad of mouth; SnL = snout length; SW = snout width; HL = head length; TrL = trunk length,

length from posterior of operculum to vent. Values are expressed as means ± SD, range.

P for t-test, NS = not significant.

Figure 2. (a) Side view of the head, (b) dorsal view of the head, and (c) side view of the posterior trunk and anterior tail of a male Stigmatopora

narinosa sp. nov. (Paratype SAM 10186) preserved in alcohol. The sub-dorsal ring count is 12 + 8.2 = 20.2. The broad snout is particularly

elevated near the tip. The ridges on the snout and trunk are less prominent in fresh specimens. The lateral trunk ridge ends across the second tail

ring. Drawing by Lisa Waters.

Robert K. Browne and Kevin Smith

Figure 3. Side view of Stigmatopora narinosa sp. nov. (Paratype

SAM F10195). The tail tapers to a point without a caudal fin.

Figure 5. A side (a) and dorsal (b) view of Stigmatopora nigra (upper;

Kaup, 1853) and also of S. argus (lower, b,c; Richardson, 1840) from

South Australia. Both species have a relatively longer more tubular

snout than S. narinosa , with S. argus having a longer snout than

S. nigra.

Figure 4. (a) Side view of the head, trunk and anterior of the tail of a

male Stigmatopora narinosa sp. nov, (Holotype, SAM F10190)

showing the prominent brood-pouch posterior to the vent, (b) dorsal

view of the brood-pouch extending 14 tail rings from the vent, (c)

ventral view of the brood pouch showing the well-developed pouch

folds . This male gave birth when captured. S. narinosa is atypical

of the genus in having up to 98 eggs in two layers, instead of 20-40

eggs in one layer.

Diagnosis. In contrast to other described species of

Stigmatopora , trunk and tail ridges, and particularly lateral

trunk ridge, indistinct in fresh specimens. Lateral trunk ridge

terminates 1.5 body rings posterior to anal ring. Short, wide

and slightly elevated snout. 9 sub-dorsal tail rings. Distinct

banded pattern in both live and preserved specimens.

Description. STR and STAR continuous, ITR and ITAR

continuous. LTR not confluent with LTAR, LTR terminating

about 1.5 body rings posterior to anal ring (fig. 2). Meristic and

morphometric values given in Tables 1, 2. The opercular ridge

longitudinal and angled little dorsally, prominent in juveniles,

reduced in adults (fig. 5). Brood pouch (fig. 4) under the anterior

portion of tail, extends for 15 to 18 rings from anal ring; pouch

plates absent or vestigial, brood protected by well-developed

pouch folds which develop from the inferior tail ridges and

touch or overlap at ventral midline within length of 1 ring.

Holotype. < 5, DO 6.5, D 40, P 13, A 4, TR 18, TAR 68,

SDTR 11.5, SDTAR 7.5, SDR 19, SD/SnL 0.14, SW/SnL

0.15, HL/TrL 0.64, SnL/TrL 0.37, SnL/HL 0.62.

Colouration. Base color variably brown, red, yellow and grey-

green, tending to fade to cream, brown and red in preservative.

Adults mainly grey-green above with reddish-brown or dark

brown markings. Red dominates toward tip of tail with the tip

frequently only bright red. Pattern of dark transverse bands on

each ring with the pattern changing along length of body and

Figure 6. A side (a) and dorsal (b) view of S. nigra (upper; Kaup

1853) and also of S. argus (lower, b,c; Richardson 1840) from South

Australia. Both species have a relatively longer more tubular snout

than S. narinosa, with S. argus having a longer snout than S. nigra.

varying between individuals and possibly also with age.

Anterior and dorsal margins of each ring dark brown or reddish

brown, distinct or smudged, form a transverse band at each

joint. Bands broaden ventrally, with only thin pale line

remaining in middle of rings, resulting in appearance of a

series of inverted saddles. Central part of bands sometimes

pale resulting in double bands. Elongated spots sometimes

present in these double dark bands or bands broken, further

disrupting banded pattern and giving spotted or scribbled

appearance. Banding often obscured, especially on the anterior

half of trunk (figs 2, 4). Similar spotting sometimes under head.

Juveniles often brown or golden yellow.

Reproduction. When compared to the other Stigmatopora spp.

the most distinguishing characteristics of the reproduction of S.

narinosa are a lack of dorso-ventral compression in females, a

specialized reproductive morphology, the number and size of

A New Pipefish, Stigmatopora narinosa (Teleostei, Syngnathidae)

the young. Sexual dimorphism characteristic of S. nigra,

S. argus, and S. macropterygia is the dorso-ventral compression

of the trunk which is exaggerated in the females during

courtship. Female S. nigra also display bright red banding on

the ventral surface during courtship.

S. narinosa has a distinctive brood pouch and potentially

a greater number of brooded eggs than its congeners S. nigra

or S. argus. The brood pouch is under the anterior portion of

the tail and extends for 15-18 rings from the anal ring; pouch

plates are absent or vestigal, and well-developed pouch folds

meet on the ventral midline. The eggs of S. narinosa are

deposited in two layers, a basal layer and then an external

layer. In the specimen with the greatest recorded number of

eggs there were 3 staggered rows of 64 basal membranous egg

compartments on the tail, with this basal layer of eggs covered

by a membrane with matching rows of egg pouches; a 2nd

layer with 34 eggs within the brood pouch folds resulted in a

total of 98 eggs. The total lengths of S. narinosa larvae at

hatching are 18 mm, those of S. nigra 13 mm, and those of

S. argus 32 mm. Male S. narinosa have extended brood

patches from December to March, and juveniles < 90 mm

seen from December to March. Males of S. narinosa can

mature at 113 mm. The maximum recorded brood of

S. narinosa of 98 eggs was far greater than that recorded by

Dawson (1982) of approximately 25 for S. nigra and 41 for

S. argus (IFG 2007).

Comparisons. The dorsal fin origin of S. narinosa is similar to

that of S. nigra at the 5th to 7th trunk ring but contrasts with

other Stigmatopora which have the dorsal fin origin at the

9th to 13th trunk ring. However, S. narinosa sp. nov. is easily

distinguished from S. nigra in having 9, rather than 6

sub-dorsal tail rings. Other distinguishing characteristics of

S. narinosa when compared to S. nigra are a greater number of

dorsal rays, total sub-dorsal rings; and ratios of snout depth and

snout width to snout length, lower ratios of snout length to

trunk length and head length (Tables 1, 2).

S. narinosa has a distinct banded pattern in both live and

dead specimens. S. nigra and S. argus also both have banding.

The banding on S. nigra on the dorsal surface consists of dark

bars between the ventral rings on the trunk and extending to

the tail. Dark bands on the ventral surface of the trunk are

wider than on the dorsal surface. There may be no banding on

the dorsal surface of the trunk of S. argus or the bands may

appear as narrow dark or pale bars on the trunk and anterior

3rd of the tail. S. narinosa has inverted saddle-like dark

transverse bands on each ring, broadening ventrally, with only

thin pale line remaining in middle of rings. The anterior and

tip of tail of S. narinosa is frequently colored red to yellow

with those of S. nigra and S. argus green. A further

distinguishing feature of S. argus are dark spots or ocelli on

the dorsal trunk.

S. nigra and S. argus have elongated narrow and shallow

snouts (fig. 6). However, the snout of S. narinosa is short, wide

and slightly elevated. The brood pouch of S. narinosa extends

15-18 rings from the anal ring (fig. 3). In S. argus the brood

pouch extends 14-24 tail rings, in S. nigra 12-16 tail rings,

and in S. macropterygia 21-24 tail rings.

Etymology. S. narinosa “naris, Latin nostril; narinosus, broad-

nosed” (Brown, 1954) is named after the wide and distinctive

spatulate shape of its snout (fig. 2). Kuiter (2000) gives this

species as S. olivacea, and the common name ‘Gulf Pipefish’.

Because this common name is used for the North American

Syngnathus scovelli (Evermann and Kendall, 1896), for S.

narinosa we adopt the common name ‘Southern Gulf Pipefish’.

Distribution. S. narinosa is currently known only from South

Australia along 200 km of inshore habitat from Seaciff (35°02'S,

138 0 31'E) on the southeastern coast of the Gulf St. Vincent,

along the south-western shore of the Gulf St. Vincent from Pt.

Vincent (34°46'S, 137°52'E) south to the Edithburgh Jetty

(35°05'S, 137°45'E), and along the south-eastern shore of

Spencer Gulf from Pt. Hughes Jetty (34°04'S, 137°32'E), at Pt.

Victoria (34°29'S, 137°28'E), and south to Magazine Bay, Pt.

Turton (34°55'S, 137°20'E) (fig. 7). Photographs appearing to

be S. narinosa were taken at Pt. Hughes (2003) and Edithburgh

Jetty (35°05'S, 137°45'E) and by Kuiter (2000) at Edithburg (in

Kuiter, 2000, image title from Cape Jarvis, Kuiter pers. com.)

and Pt. Victoria (34°29'S, 137°28'E). All specimens of

S. narinosa have been collected or photographed in sheltered

shallow open water of 1-5 m depth over a substrate of a mosaic

of patches of brown algae, with Posidonia, or Zostera. The

only hand-netted specimen of S. narinosa was sampled at

Stansbury (34°53'S, 137°49'E) at low tide. Deeper water trawl

surveys offshore from locations inhabited by S. narinosa have

yielded no specimens. Deeper SCUBA surveys have not found

S. narinosa. Therefore, S. narinosa appears to have a very

limited inshore distribution along patches of moderate energy

coastlines with low turbidity and a broken vegetation pattern of

sea-grass and brown algae.

The northern sections of both the Gulf St. Vincent and

Spencer Gulf are low energy coastlines with typically dense

Posidonia sea-grass beds extending from low tide mark to

considerable depths. They lack an open patchy mosaic of

brown algae, Posidonia, and Zostera on sand and probably do

not offer suitable habitat for S. narinosa . Both S. argus and

S. nigra generally inhabit sea-grass beds, with the larger

S. argus (TL 254 mm; Dawson, 1982) preferring the long

(~ 60 cm) and wide (~ 1 cm) Posidonia sp. beds, and the

smaller S. nigra (TL 162 mm, Dawson, 1982) inhabiting the

short G 5-14 cm) and narrow (~ 2-4 mm) Zostera sp. sea-grass.

Both S. argus and S. nigra are colored green to grey-green.

The generally reddish/brown colour of S. narinosa would

provide better camouflage among its apparently preferred

habitat of mixed sea-grass and brown algae. Seasonal water

temperatures at one site inhabited by S. narinosa (Edithburgh

Pool; 35°05'S, 137°45'E) ranged from 12-20°C.

This restricted inshore habitat of S. narinosa may be

particularly vulnerable to pollutants or exotic marine species. On

the other hand, the readily accessible inshore distribution of

S. narinosa could facilitate the monitoring and investigation of

its populations and contribute to conservation measures. The

finding of a new Stigmatopora species in shallow inshore sites

adjacent to populated areas indicates the potential for other novel

species of pipefish to be discovered across southern Australia.

Robert K. Browne and Kevin Smith

Figure 7. Known locations (•) of the Southern Gulf Pipefish Stigmatopora narinosa sp. nov. in South Australia . The range of S. narinosa extends

from south-eastern Spencer Gulf, along the lower half of western Gulf St. Vincent with a localised population in eastern Gulf St Vincent.

Acknowledgements

I thank Peter Cullen for his advice and encouragement in

studying syngnathids and Lisa Waters for her preparation of

Figure 2. David Muirhead and Graham Short provided

information about the locations and habitats. Endorsement of

this project was given by the Marine Life Society of South

Australia Inc., the Scuba Divers Federation of South Australia

Inc., and the Inshore Fish Group. Special thanks to Dr Martin

Gomon, Museum Victoria; Dr Robert Morris for facilities

and access to the South Australian Museum collections; Dr

Steve Donellan, University of Adelaide, for advice about

molecular phylogeny and Dr Michael Dawson, University of

California at Davis, for the molecular phylogeny of the

Stigmatopora. Michael Hammer showed me many fine points

of sampling fish and some interesting gobies. Ralph Foster

and Terri Bertozzi helped with the museum collection.

Literature cited

Browne, R.K. 2003. Pipefish, museums, marine naturalists and fish

conservation. Annual Journal of the Marine Life Society of South

Australia. No 13. December 2003. www.mlssa.asn.au/journals/

2003Journal.htm#4.

Brown, R.W. 1954. Composition of Scientific Words: A Manual of

Methods and a Lexicon of Materials for the Practice of

Logotechnics. Smithsonian Institution Press: Washington, DC.

Castelnau, F.L. 1872. Contribution to the Ichthyology of Australia. No.

1. The Melbourne Fish Market (pp. 29-242) and No. II. Note on

some South Australian Fishes (pp. 243-247). Proceedings of the

Zoological Acclimatio. Society of Victoria 1: 29-247.

Dawson, C.E. 1985. Indo-Pacific Pipefishes: Red Sea to the Americas.

The Gulf Coast Research Laboratory: Ocean Springs, Mississippi,

USA.

Dawson, C.E. 1982. Review of the Indo-Pacific pipefish genus

Stigmatopora (Syngnathidae). Records of the Australian Musuem

34(13): 575-605.

Dumeril, A. 1870. Histoire naturelle des poisons, ou ichthyologie

generale. II. Ganoides, Dipnes, lophobranchs, Librairie

Encyclopedique de Roret, Paris. 624 pp.

GDA. 2007. Geocentric Datum of Australia 1994. Geoscience

Australia, Australian Government, http://www.ga.gov.au/geodesy/

datums/gda.jsp.

Kaup, J.J. 1853. Uebersicht der Lophobranchier. Archiv fur.

Naturgeschichte 19: 226-234.

Kuiter, R.H. 2000. Seahorses, Pipefishes and their Relatives.

A Comprehensive Guide to Syngnathiformes. TMC Publishing:

240 pp.

Inshore Fish Group. 2007. Inshore Fish Group website, http://www.ifg.

bioteck.org/Fish%20species/Species%20Table.htm. OZCAM.

2003. Online Zoological Collections of Australian Museums.

Richardson, J. 1840. On some new species of fishes from Australia.

Proceedings of the Zoological Society of London 8: 25-30.

Memoirs of Museum Victoria 64: 7-11 (2007)

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/Memoirs/

Description of Amischa paolettii sp. nov. and Thamiaraea tsitsilasi sp. nov. from

the Australian region (Coleoptera, Staphylinidae)

Roberto Pace

Via Vittorio Veneto, 13 -37032 Monteforte d’Alpone (Verona), Italy (pace.ent@tiscali.it)

Abstract Pace, R. 2007. Description of Amischa paolettii sp. nov. and Thamiaraea tsitsilasi sp. nov. from the Australian region.

Memoirs of Museum Victoria 64: 7-11

Two new species of Aleocharinae from Australia are described and illustrated: Amischa paolettii sp. nov. of the

tribe Athetini and Thamiaraea tsitsilasi sp. nov. of the tribe Thamiaraeini. The genus Amischa Thomson is new for the

Australian region.

Keywords Coleoptera, Staphylinidae, Aleocharinae, taxonomy, Australia.

Introduction

The subfamily Aleocharinae, with over 13,000 species, is

present in all zoogeographic regions of the world and most

species occur in forest areas. Some species are terricolous

during the day, living in soil, and in the evening become

arboreal or floricolous being found on trees or on flowers.

Some groups are myrmecophilous or termitophilous (Kistner,

1982) and a certain number of them live in the intertidal zones

(Moore and Legner, 1976). The majority of the species in the

Aleocharini are parasitoid in the larval stage of pupiparous

flies (Fuldner, 1960), whereas the tribe Gyrophaenini are

micophagous on fresh mushrooms (Ashe, 1984). Several

species of the Hypocyphtini prey on mites (Cameron, 1939).

Species of Oligota Mannerhein, 1831, from the Australian

region include O. asperiventris Fauvel, 1878 and O. zealandica

Bernhauer, 1941; however, more research is needed on the

Australian Hypocyphtini fauna to investigate their important

role in biological control of mites in various countries including

the Mediterranean region (Paoletti et ah, 1989).

Aleocharinae has attracted little attention from collectors

and researchers. The first Aleocharinae described from

Australia were Falagria fauveli Solsky, 1867 and Oxypoda

bisulcata Redtenbacher, 1868 (now Aleochara bisulcata).

McLeay (1873) described 10 more Australian species. Detailed

descriptions in Latin of Aleocharinae, new and described,

were given by Fauvel (1877 and 1878). Olliff (1886) published

a revision of the Aleocharinae species, proposing the English

translation of Fauvel’s descriptions and the description of new

genera and species. In 1880 and in 1895 Blackburn described

three species in the genus Aleochara, the new genus Barronica,

(synonym of Leucocraspedum Kraatz, 1859) and a new species

of this genus. In 1908 Bernhauer described six new species of

Australian Aleocharinae. In 1910 Lea published new

Aleocharinae species found in termite nests, ant nests and

beehives, and provided a key to the species of the genus

Polylobus, (now known as Pseudoplandria ), ignoring Fauvel’s

species. In the same year he published another paper containing

the description of eight new species of the genus Calodera. In

1920, Bernhauer described Leptusa mjoebergr, however,

according to my examination of the types it belongs to

Paralinoglossa mjoebergi (Bernhauer, 1920) comb. nov. In

1933, Oke described five new termitophilous and

myrmecophilous species and genera. In 1943, Cameron

described 14 new species and five more in 1950. None of these

authors, except Fauvel and only in part, examined the types of

the species previously described. Additionally, they did not

check for the possible presence of Palaearctic genera in

Australia. Recently, a taxonomic study on the species of

Aleocharinae collected by the Zoological Mission of the

Regional Museum of Natural Sciences in Turin financed by

the National Academy of the Lincei in Rome has been

published (Pace, 2003). The aim of this paper is to describe

two new Australian species of this subfamily.

Methods

Species determinations were based on examination of the

characters of the male copulatory organ and of the female

spermatheca. Terminology follows the work of Pace (2003)

and Pasnik (2001).

The genital structures were dissected and placed in Canada

balsam on small transparent rectangles of plastic material,

pierced on some samples. The genital structures were studied

using a compound microscope and drawn with the help of a

gridded eyepiece. The habitus figures were drawn with the use

of a micrometre eyepiece of a binocular microscope.

Roberto Pace

The positive recognition of the genera and species is best

done using illustrations of the aedeagus and/or of the

spermatheca. For this reason the descriptions are brief, and

limited, in order to describe traits that are graphically not

reproducible, such as the colour, the reticulation and the

granularity. However, for species of the subfamily

Aleocharinae, a very accurate and long description does not

always give an exact identification of the various species. It is

the observation of the illustration of the aedeagus and/or of the

spermatheca, together with that of the habitus, which helps

resolve interpretative problems given by the description alone.

The holotypes of the new species are deposited in Museum

Victoria (MV), Melbourne, and Victoria, Australia.

Systematics

Athetini

Amischa paolettii sp. nov.

Figures 1-2

Holotype: ?, Australia, Victoria, Gerangamete near Colac,

remnant forest, 12.VIII.2004, by sweep net in pasture at forest margin,

50 m, leg. M. G. Paoletti and A. Tsitsilas (MV T-18706).

Description. Length 1.7 mm. Body shiny and brown with head

and 4 basal free urites with base of the 5th urite black-brown;

antennae black with 2 basal antennomeres yellow; legs yellow;

4th antennomere as long as wide; remaining antennomeres to the

Figures 1-2. Habitus and spermatheca of Amischa paolettii sp. nov.

Two new Australian Aleocharinae

10th transverse. Pronotum weakly transverse and with a weak Note. The genus Amischa Thomson, 1858, occurs in the

posterior median fovea. Head and elytra reticulate; reticulate Palaearctic, Ethiopian and Oriental regions and this new

sculpture evident on pronotum, that of the abdomen superficial species is the first record of the genus for the Australian region,

except evident on the 5th segment; punctuation of head not The new species has habitus similar to that of Amischa

distinguishable; granularity of pronotum and of abdomen fine and kashmirica Cameron, 1939, from Kashmir. The female of the

superficial, on elytra also fine, but evident. Spermatheca, fig. 2. new species does not have the 6th free urotergum broadly

Figures 3-5. Habitus and aedeagus in lateral and ventral view of Thamiaraea tsitsilasi sp. nov.

Roberto Pace

arched as that of kashmirica, the spermatheca has the distal

bulb reduced, despite the body being more developed in length

(distal bulb very long in kashmirica).

Etymology. The new species is dedicated to one of its collectors,

the Dr. Maurizio G. Paoletti of the University of Padua.

Thamiaraeini

Thamiaraea tsitsilasi sp. nov.

Figures 3-5

Holotype S , Australia, Victoria, Gerangamete near Colac,

remnant forest, 12.VIII.2004, by sweep net in pasture at forest margin,

50 m, leg. M.G. Paoletti and A. Tsitsilas (MV T-18707).

Description. Length 2.3 mm. Body shiny and black-brown;

antennae black, legs yellow with yellow-brown femurs, 3rd, 4th

and 5th antennomeres longer than wide, 6th weakly longer than

wide, 9th and 10th as long as wide, 2 superficial posterior

points and an evanescent posterior median fovea on the

pronotum. Abdomen scarcely narrow behind. Reticulation of

the head and the pronotum evident, that of the elytra very

evident and that of the abdomen superficial. Granularity of

head and pronotum superficial, that of the abdomen fine, fewer

closes on the posterior free urotergites. Punctuation of the

elytra strong and close. Aedeagus, figs. 4-5.

Note. The genus Thamiaraea Thomson, 1858, occurs in

the Nearctic, Palaearctic, Oriental and Australian regions. The

species T. scapularis (Fairmaire, 1849) occurs in Sri Lanka,

Hong Kong, Sulawesi, Singapore, New Guinea, Philippines,

Sabah, New Caledonia, New Hebrides and Tahiti. The new

species is clearly distinguished from this species by the 9th

and 10th antennomeres of the new species being as long as

wide but transverse in scapularis; the abdomen of the male of

the new species is deprived of evident secondary sexual

characters as is the abdomen of scapularis; the aedeagus of

the new species is bent at the apex, in lateral view, and

rectilinear in scapularis.

Etymology. The new species is dedicated to one of its collectors,

PhD student Mr. A. Tsitsilas from the Centre of Environmental

Stress and Adaptation Research (CESAR), The University of

Melbourne, Melbourne, Victoria, Australia.

Acknowledgements

The specimens in the present paper were collected in Australia

by Dr. Maurizio Paoletti of the University of Padua, Italy,

during his sabbatical at La Trobe University in Bundoora,

together with Dr. Angelos Tsitsilas, a PhD student from the

Centre for Environmental Stress and Adaptation Research, the

University of Melbourne, Melbourne, Victoria, Australia.

I cordially thank Maurizio G. Paoletti. For the loan of types of

Australian Aleocharinae I very sincerely thank Dr. Didier

Drugmand of the Institut Royal des Sciences Naturelles de

Belgique of Bruxelles and Dr. PM. Hammond and

Dr. M. Brendell of the Museum of Natural History in London.

References

Ashe, J.S. 1984. Generic revision of the subtribe Gyrophaenina

(Coleoptera:Staphylinidae: Aleocharinae), with review of the

described subgenera and major features of evolution. Quaestiones

Entomologicae 20: 129-349.

Bernhauer, M. 1920. Results of Dr. E. Mjoberg’s Swedish scientific

expeditions to Australia 1910-1913. Staphylinidae. Arkiv for

Zoology 13: 1-27.

Bernhauer, M. 1941. Neue Staphyliniden aus Neuseeland (New

Zealand). Folia Zoologica et Hydrobiologica 11: 26-38.

Blackburn, T. 1880. Notes on Australian Coleoptera, with descriptions

of new genera and species. Transactions and Proceedings and

Report of the Royal Society of South Australia 10: 45-47.

Blackburn, T. 1895. Further notes on Australian Coleoptera, with

descriptions of new genera and species. Transactions and

Proceedings and Report of the Royal Society of South Australia

19: 201-258.

Cameron, M. 1939. Fauna of British India, including Ceylon and

Burma. Coleoptera, Staphylinidae, Vol. IV. Parts I & II London:

Taylor & Francis: 691 pp.

Cameron, M. 1943. New species of Staphylinidae (Col.) from Australia

and New Guinea. The Annals and Magazine of Natural History

10: 336-354.

Cameron, M. 1950. New species of New Zealand Staphylinidae.

Entomologist's Monthly Magazine 86: 23-26.

Fairmaire, L. 1849. Essai sur les Coleopteres de la Polynesie. Revue et

Magasin de Zoologie 1: 277-291.

Fauvel A. 1878. Les Staphylinides de PAustralie et de la Polynesie.

Annali del Museo civico di storia naturale di Genova

13: 465-598.

Fauvel, A. 1877. Les Staphylinides de PAustralie et de la Polynesie.

Annali del Museo civico di storia naturale di Genova

10: 168-298.

Fauvel, A. 1878. Les Staphylinides de PAustralie et de la Polynesie.

Annali del Museo civico di storia naturale di Genova

13: 465-598.

Fuldner, D. 1960. Beitrage zur Morphologie und Biologie von

Aleochara bilineata Gyll. und bipustulata L: (Coleoptera:

Staphylinidae). Zeitschrift fiir Morphologie und Okologie der

Tiere 49: 312-386.

Kistner, D.H. 1982. The social insect’s bestiary. In: Hermann, H.R.

(ed.). Social Insects, Vol. 3. New York: Academic Press:. 244 pp.

Kraatz, G. 1859. Die Staphyliniden-Fauna von Ostindien, insbesondere

der Insel Ceylan. Archivfiir Naturgeschichte, 25: 1-45.

Lea, A.M. 1910. On Australian and Tasmanian Coleoptera with

descriptions of new species. Part I. Proceedings of the Royal

Society of Victoria 22: 115-152.

Lea, A.M. 1910a. Australian and Tasmanian Coleoptera inhabiting or

resorting to the nests of ants, bees, and termites. Proceedings of

the Royal Society of Victoria 23: 116-230.

Lea, A.M. 1912. Australian and Tasmanian Coleoptera inhabiting or

resorting to the nests of ants, bees, and termites. Supplement.

Proceedings of the Royal Society of Victoria 25: 31-78.

Macleay, W. 1873. Notes on a collection of insects from Gayndah. The

Transactions of the Entomological Society of New South Wales

2: 134-136.

Mannerheim, C.G. 1831. Precis d’un nouvel arrangement de la Famille

des Brachelytres de l’Ordre des Insectes Coleopteres. Memoires

de TAcademie des Sciences de St. Petersbourg, 1: 415-501.

Moore, I., and Legner, E.F. 1976. Interdital rove beetles (Coleoptera,

Staphylinidae). Pp. 521-551 in: Cheng, L. (ed.). Marine Insects.

North-Holland Publishing Co.: Amsterdam.

Two new Australian Aleocharinae

Olliff, A.S. 1886. A revision of the Staphylinidae of Australia, Part 1.

The Proceeding of the Linnean Society of New South Wales

1: 403-473.

Oke, C. 1933. Australian Staphylinidae. Proceedings of the Royal

Society of Victoria 45: 101-136.

Pace, R. 1982. Le Leptusa Kr. paleotropiche, neotropiche, australiane

e neozelandesi descritte da Bernhauer (Coleoptera Staphylinidae)

(XXIII Contributo alia conoscenza delle Aleocharinae).

Fragmenta Entomologica 16: 161-180.

Pace, R. 2003. New or little known Aleocharinae from the Australian

Region (Coleoptera, Staphylinidae). Monografie del Museo

regionale di Scienze naturali di Torino 35: 111-186.

Pace, R. 2004. Nuovo contributo alia conoscenza delle Aleocharinae

di Sulawesi (Coleoptera, Staphylinidae). Belgian Journal of

Entomology 6: 315-336.

Paoletti, M.G., and Lorenzoni, G.G. 1989. Agroecology patterns in

northeastren Italy. Agriculture, Ecosystems and Environment

27: 139-154.

Pasnik, G. 2001. Six new species of Aleocharinae from Australia

(Coleoptera: Staphylinidae). Polish Journal of Entomology

70: 173-184.

Redtenbacher, L. 1868. Familie Staphylinidae, In: Reise der

Osterreichischen Fregatte Novara um die Erde in den Jahren 1857,

1858, 1859. Zoologischer Theil. Zweiter Band A, Wien: Karl

Ger old’s Sohn : 27-30.

Solsky, S. 1867. Staphylinides nouveaux. Horae Societatis

Entomologicae Rossicae 5: 113-115.

Thomson, C.G. 1858. Skandinaviens Coleoptera, synoptiskt

bearbetade. I., 290 pp. Lund: Berlingsska Boktryckeriet .

Memoirs of Museum Victoria 64: 13-21 (2007)

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/Memoirs/

New genera and new species of the subfamily Aleocharinae from Australia

(Coleopter^ taphylinidae)

Roberto Pace

Abstract

Keywords

Via Vittorio Veneto, 13 - 37032 Monteforte d’Alpone (Verona), Italy (pace.ent@tiscali.it)

Pace, R. 2007. New genera and new species of the subfamily Aleocharinae from Australia (Coleoptera, Staphylinidae).

Memoirs of Museum Victoria 64: 13-21

Two new genera and four new species of the tribe Athetini are described and illustrated: Leptostiba paolettii sp.

nov., Aloconota maculiventris sp. nov., Ischyrodyodoys thomsonae gen. nov. and sp. nov., and Notioantilogiusa rara gen.

nov. and sp. nov. The genus Aloconota Thomson is new for the Australian region. Oligota pusillima (Gravenhorst) (a

possible biological control for pest mites) is reported for the first time from vineyards and shelterbelts in Victoria and

Southern Australia.

Coleoptera, Staphylinidae, Aleocharinae, taxonomy, Australia.

Introduction

The Australian fauna of the subfamily Aleocharinae is still

little known. Recent scientific expeditions have led to the

description of many new taxa (Pace, 1982, 1985, 2003, 2005).

The wealth of species of the subfamily Aleocharinae is not

only a result of the great ecological differences across

Australia, but also because species of Aleocharinae tend to

occupy different ecological niches with consequent

evolutionary differentiation of the structures of the mouth.

Material and methods

I have examined 11 determined specimens of Oligota

asperiventris Fauvel, 1878, in the South Australian Museum of

Adelaide and specimens collected from pitfall traps at Sadliers

vineyard, Glen View Road, Yarra Glen, Victoria (37°39’33”S,

145°22’21”E) by Linda J. Thomson, Zoology Department,

University of Melbourne, Victoria, Australia. This method of

capture of Staphylinidae in Australia explains the high

percentage of new species and new genera here described.

The generic diagnoses for the Aleocharinae from Australia

is essentially based on the mouthparts, particularly the ligula,

and partially on the tarsal formula and the spermatheca.

The specific diagnoses are essentially based on the form of

the aedeagus in lateral and ventral view and on that of the

internal copulatory pieces. The spermatheca also provides

reliable and stable diagnostic characters.

Given the small body size of Aleocharinae species from

Australia, it is essential to mount the aedeagus, spermatheca,

mouthparts and tarses in Canada balsam for microscopic

examination. Body parts prepared in Canada balsam are included

on fillets of plastic laminate pierced with the same pin as the

sample to which they belong. Species determinations have been

made through the comparison of the aedeagus, spermatheca and

other anatomical parts, against specimens and types I have

examined from the Oriental and Australians faunas.

The descriptions are limited to the main characters such as

the microsculpture and the granularity that are not visible

photographically.The author’s conviction is that a photo or

sketch, even if defective, is worth a lot more than a minute and

long description for future recognition of the species.

In the present paper the median lobe of the aedeagus (deprived

of the two lateral parameres that obscure the median lobe), is

called, for reasons of brevity and clarity, the “aedeagus”.

The holotypes of the new species are preserved in the

Museum of Victoria (MV), Melbourne, Victoria, Australia.

3 ystematics

Hypocyphtini

Oligota pusillima (Gravenhorst, 1806)

Figures 1-3

Aleochara pusillima Gravenhorst, 1806: 175

Oligota pusillima: Thomson, 1860: 262

Material examined. 3 ^ and 3 Midwa, October 2004, Cra farms

A1910, David Sharley; 1 & and 2 Berri, S. Australia 20296, Oligota

asperiventris ? Fvl. South Australian Museum; 2 && and 1 Kempton,

Tas.: Lea 9508, asperiventris ? Tas., South Australian Museum; 1 +,

Adelaide, Blackburn, 6994 Ad., asperiventris Fvl., South Australian

Museum; 1 Swan R., Lea, 1738, South Australian Museum.

Note. It is very probable that O. asperiventris Fauvel, 1878 is a

junior synonym of O. pusillima.

Roberto Pace

Figures 1-9. Habitus, aedeagus in lateral and ventral view, spermatheca, maxilla with maxillary palpus and labium with labial palpus.

1-3: Oligota pusillima (Gravenhorst, 1806), specimens from Australia; 4-9: Leptostiba paolettii n. sp. Scale bars habitus: fig. 1 = 1.2 mm,

fig. 4 = 2.1 mm. Other scale bars = 0.1 mm.

New genera and species Aleocharinae Australia

Figures 10-15. Habitus, aedeagus in lateral and ventral view, spermatheca, labium with labial palpus and maxilla with maxillary palpus.

10-15: Aloconota maculiventris n. sp. Scale bar habitus: fig. 10 = 2.8 mm. Other scale bars = 0.1 mm.

Roberto Pace

Distribution. Cosmopolitan species with a possible role in

biological control of pest mites (M.G. Paoletti in litt.).

Athetini

Key to the Australian species of the genus Leptostiba Pace,

1985 in the L. projundior Pace, 2005 species-group

1. Body black-brown, antennae brown unicoloured,

micropterous species, flightless, apical introflection of the

distal bulb of the spermatheca does not exceed the level of

the basal angle of the distal bulb of the same spermatheca.

Length 2.03 mm. Australia: Benlomon N.P

L. pratensis Pace. 2005

- Bicoloured or tricolour body, antennae bicoloured, species

able to fly, apical introflection of the distal bulb of the

spermatheca catch the level of the basal angle of the distal

bulb of the same spermatheca 2

2. Eyes as long as the temples, elytrae dirty yellow, apex of

the aedeagus narrow, ventrally viewed, proximal portion

of the spermatheca clearly shorter than intermediary

portion of the same spermatheca. Length 1.7 mm.

Australia: Kosciusko L. bidens Pace, 2003

- Eyes shorter than temples, elytrae brown or yellow-brown,

apex of the aedeagus wide ogival, proximal portion of the

spermatheca as long as the intermediary portion of the

same spermatheca 3

3. Head black-brown, 4th and 5th antennomeres longer than

wide, 11th antennomere brown with apex reddish, median

furrow of the pronotum, principal inside genital armour

of the aedeagus long. Length 2.02 mm. Australia:

Tasmania L. profundior Pace, 2005

- Head black, 4th and 5th antennomeres transverse, 11th

antennomere unicoloured brown, median furrow of the

pronotum absent, principal inside genital armour of the

aedeagus short. Length 2.1 mm. Australia: Saldiers

L. paolettii sp. nov.

Leptostiba paolettii sp. nov.

Figures 4-9

Holotype: 3 , Australia, Sadliers 33.18, pitfall trap, 17-24.11.2005,

leg. L.J. Thomson (MV T-20007).

Paratype: 1 9 , same origin but 34.19.

Description. Length 2. 1-2.2 mm. Body shiny, yellow-brown,

head black, 3rd free urotergite brown, 4th and 5th black with

yellow-brown posterior border, antennae brown with yellow-

brown basal antennomere. 2nd antennomere longer than 1st,

3rd longer than 2nd, 4th feebly transverse, 5th to 10th transverse,

11th as long as the 2 preceding antennomeres together. Eyes

shorter than temples that have posteriorly widened. Reticulation

of head and pronotum superficial, but evident on concave

forehead. Clearly visible reticulation of the elytrae, that of the

abdomen transverse and superficial. Granularity of the head

close and very superficial, that of the pronotum and elytrae

evident, that of the 4 free basal urotergite close and superficial

and that of the 5th free urotergite very sparse. Posterior median

of the pronotum flattening. 6th free urotergite of the male

plurilobate to the posterior border among 2 short lateral thorns.

Aedeagus figs 5-6, spermatheca fig. 8, maxilla with maxillary

palpus fig. 7, labium with labial palpus fig. 9.

Comparative notes. The deep apical introflection of the distal

bulb of the spermatheca places the new species into the

Australia L. profundior species-group.

Etymology. The new species is dedicated to Dr. Maurizio

G. Paoletti, Padua University.

Aloconota maculiventris sp. nov.

Figures 10-15

Holotype: 3 , Australia, Sadliers 185, pitfall trap, 17-24.11.2005,

leg. L.J. Thomson (MV T-20008).

Paratypes: 4$?, Australia, Sadliers 186, pitfall trap, 17-24.11.2005,

leg. L.J. Thomson; 1 9 , Australia, Sadliers + 13, pitfall trap,

17-24.11.2005, leg. L.J. Thomson; 1 9 , Australia, Sadliers 7.7, pitfall

trap, 17-24.11.2005, leg. L.J. Thomson; 1 9 , Australia, Sadliers n 1,

pitfall trap, 17-24.11.2005, leg. L.J. Thomson; 1 6 and 1 9 , Australia,

Sadliers 9.6, Pitfall trap, 17-24.11.2005, leg. L.J. Thomson; 1 3 ,

Australia, Sadliers: x 13, technique: pitfall trap, 17-24.11.2005,

collector L.J. Thomson; 4 33 and 3 99 , Australia, Sadliers: 10.6,

technique: pitfall trap, 17-24.11.2005, collector L.J. Thomson.

Description. Length 2. 8-2.9 mm. Body very shiny and brown,

pronotum brown-reddish, basal free urotergites 1st and

2 yellow-reddish with brown-reddish median stain, pygidium

yellow-brown, antennae brown with 8th to 10th antennomeres

brown-reddish and 11th reddish, legs yellow. Eyes shorter than

temples. 2nd antennomere shorter than 1st, 3rd a little longer

than 2nd, 4th antennomeres to 7th longer than wide, the

3 following antennomeres as wide as long, 11th as long as the

preceding 2 antennomeres together. Reticulation of the body

absent. Punctuation of the head very superficial and missing on

the longitudinal median band. Granularity of the pronotum

evident and close, those of the elytrae protruding, also close.

Granularity of the 2 basal free urotergites sparse and absent on

the basal half, urotergites free 3rd and 4th with granules only to

the posterior border, 5th free urotergite of the male with

5 salient carinae near the posterior border, the median carinae

more salient than lateral ones. Aedeagus figs 11-12, spermatheca

fig. 13, labium with labial palpus fig. 14, maxilla with maxillary

palpus fig. 15.

Comparative notes. This new species is the 2nd of the genus

Aloconota Thomson for Australia after the cosmopolitan

Aloconota sulcifrons (Stephens, 1832). The aedeagus and habitus

is similar to A. inaequalis Cameron, 1944, from India, of which I

have examined the male holotype thus labeled: Ghum Distr.,

Rongdong Valley, V-VI.1931, Aloconota inaequalis Cam., Type.

The new species differs as follows: the yellow-reddish base of

the abdomen is stained brown-reddish (abdomen entirely brown

in inaequalis)-, the elytrae, measured from the humerus to the

external posterior angle, are as long as the pronotum (much

longer than the pronotum in inaequalis ); the apex of the aedeagus

is largely oval, ventrally viewed, (apex of the aedeagus blunt

narrow in inaequalis ). The female inaequalis is not known.

New genera and species Aleocharinae Australia

Figures 16-21. Habitus, aedeagus in lateral and ventral view, spermatheca, labium with labial palpus and mentum. 16-21: Ischyrodyodoys

thomsonae n. sp. Scale bars habitus: fig. 16 = 1.8 mm. Other scale bars = 0.1 mm.

Roberto Pace

Figures 22-26. Maxilla with maxillary palpus, apex of the maxilla, habitus, spermatheca and labium with labial palpus. 22-23: Ischyrodyodoys

thomsonae n. sp.; 24-26: Notioantilogiusa rara n. sp. Scale bar habitus: fig. 24 = 3.3 mm. Other scale bars = 0.1 mm.

New genera and species Aleocharinae Australia

Figures 27- 28. Mentum and maxilla with maxillary palpus. Notioantilogiusa rara n. sp. Scale bars = 0.1 mm.

Roberto Pace

Etymology. The name of the new species means “stained

abdomen”.

Ischyrodyodoys gen. nov.

Figures 16-23

Type species: Ischyrodyodoys thomsonae sp. nov.

Diagnosis. The tarsal formula 4-5-5 and the form of the mouth

parts indicate that this genus belongs to the tribe Athetini. With

the ligula separated in 2 lobes wide at the base, the new genus is

taxonomically close to Aloconota Thomson, 1858, but in the

new genus the lobes are much broader, fig. 20, than those of

Aloconota , fig. 14, and have an apical bristle, absent in Aloconota.

The lacinia of the maxilles finishes in 2 strong canine teeth, fig.

23, not as in Aloconota, fig. 7. The anterior border of the mentum,

fig. 21, is deeply arched in the new genus. In addition, the tapered

form of the body in the new genus, is clearly different from that

of the species of Aloconota.

Description. 11 antennomeres, pronotum more narrow in front

than posteriorly, abdomen very narrow posteriorly. Labial

palpus 3 -jointed, ligula separated in 2 lobes with wide base and

with a apical bristle, fig. 20, maxillary palpi 4-jointed, maxillae

with 2 strong canine apical teeth of the lacinia, galea as long as

the lacinia, with pubescent apical membrane, fig. 23. Trapezoidal

mentum, with smaller base deeply arched posteriorly, fig. 21.

Mesosternal process insinuated between the mesocoxae, which

are slightly separated. Tarsal formula 4-5-5, 1st meso-

metatarsomere as long as the 2 following tarsomeres together.

Aedeagus figs 17-18, spermatheca fig. 19.

Etymology. The name of the neutral grammatical genus of the

new genus means “Two strong teeth” from the ancient Greek

fa%UQOg - strong, 6bo = two and obobg = tooth.

Ischyrodyodoys thomsonae sp. nov.

Figures 16-23

Holotype: 3 , Australia, Sadliers 185, technique: pitfall trap, date

17-24.11.2005, collector L.J. Thomson (MV T-20013).

Paratypes: 1 9 , same origin; 3 33 and 1 9 , Australia, Sadliers 24.2,

Pitfall trap, 17-24.11.2005, leg. L.J. Thomson; 3 99 , Australia, Sadliers

34.19, Pitfall trap, 17-24.11.2005, leg. L.J. Thomson; 1 3 and 2 99 ,

Australia, Sadliers 23.1, Pitfall trap, 17-24.11.2005, leg. L.J. Thomson.

Description. Length 1. 8-2.0 mm. Body shiny and black-brown,

antennae black with basal antennomere brown, legs yellow-

brown with brown femurs and tarses yellow. Eyes longer than

temples. 1st basal antennomere longer than 2nd, 3rd as long as

2nd, 4th antennomeres to 10th transverse, 11th antennomere as

long as the 2 preceding antennomeres and a half together.

Reticulation of the head and the pronotum absent, that of the

elytrae very superficial. Punctuation of the head thin, dense

and very superficial. Granularity of the pronotum dense and

salient. Naked abdomen, without granularity or reticulation,

with a basal sulcus, on the 5th urotergite 2 punctures and some

on each lateral side. Aedeagus figs 17-18, spermatheca fig 19.

Etymology. The new species is dedicated to Dr Linda J.

Thomson, researcher of the Zoology Department, University of

Melbourne. She collected this new species together with other

new species here described.

Notioantilogiusa gen. nov.

Figures 24-28

Type species: Notioantilogiusa rara sp. nov.

Diagnosis. Similar to Aloconota, but with spermatheca more

similar to that of the species of the tribe Bolitocharini than to

the genus Aloconota and the ligula is separated in 2 very

divergent lobes, fig. 26, and not in 2 parallel lobes as in

Aloconota, fig. 14.

Description. 11 antennomeres, temples divergent posteriorly,

pronotum narrower in front than posteriorly, with pubescence

direct to the posterior on straight line, 2 basal furrows of the

abdomen; wingless genus; labial palpi 3 -jointed, ligula

separated in 2 very divergent lobes, fig. 26, a little leaning

paraglosse in front, maxillary palpi 4-jointed, galea a little

longer than lacinia, fig. 28, trapezoidal mentum with smaller

base a little deeply arched posteriorly, fig. 27; mesosternal

process acute, extending two-thirds of the length of the

mesocoxae, tarsal formula 4-5-5, first metatarsomere as long as

the 2 preceding together. Spermatheca, fig. 25.

Etymology. The female name of the new genus means “What is

southern contradiction” from the ancient Greek voxiog =

southern, aviikoyfa = contradiction and oboa = what it is.

The contradiction consists of the form of the spermatheca

typical of the tribe Bolitocharini in a body with characters of

the tribe Athetini.

Notioantilogiusa rara n. sp.

Figures 24-28

Holotype: 9 , Australia, Sadliers 32. 1 , pitfall trap, date 17-24. 1 1 .2005,

leg. L.J. Thomson (MV T-20012).

Paratype: 1 9 , same origin.

Description. Length 3.3 mm. Body shiny and brown, pronotum

and elytrae brown-reddish, antennae black with the 2 basal

antennomeres and the apex of 11th brown-reddish, legs yellow-

brown with brown femurs and yellow tarses. 2nd antennomere

shorter than 1st, 3rd as long as 2nd, 4th to 10th strongly transverse,

11th as long as the 2 preceding antennomeres and a half. Eyes as

long as the temples that are densely pubescent. Reticulation of

the head and the pronotum absent, that of the elytrae superficial.

Punctuation of the head and the pronotum dense, superficial and

missing on the longitudinal median band of the head, that of the

abdomen close and missing on the basal half of every free

urotergites. Granularity of the elytrae close and evanescent. 2

basal furrows of the abdomen. Spermatheca, fig. 25.

Acknowledgements

I give my most grateful and cordial thanks to Dr. Maurizio G.

Paoletti, Padua University, for having submitted to me for

examination, the Aleocharinae collected in Australia by Dr.

Linda J. Thomson and David Sharley of the Zoology

New genera and species Aleocharinae Australia

Department, University of Melbourne and Eric Matthews of

the South Australian Museum of Adelaide. For the loan of

material typical of Australian Aleocharinae I very sincerely

thank the Dr. Didier Drugmand of the Institut Royal des

Sciences Naturelles de Belgique of Bruxelles, Dr. RM.

Hammond and the Dr. M. Brendell of the Museum of Natural

History in London.

References

Cameron, M. 1944. Descriptions of new Staphylinidae (Coleoptera).

The Proceedings of the Royal Entomological Society of London

13: 49-52.

Fauvel, A. 1878. Les Staphylinides de FAustralie et de la Polynesie.

Annali del Museo civico di storia naturale di Genova

13: 465-598.

Gravenhorst, J. I. C. 1806. Monographia Coleopterorum

Micropterorum. 236 pp., Gottingae: Henricus Dieterich .

Pace, R. 1982. Le Leptusa Kr. paleotropiche, neotropiche, australiane

e neozelandesi descritte da Bernhauer (Coleoptera Staphylinidae)

(XXIII Contributo alia conoscenza delle Aleocharinae).

Fragmenta Entomologica 16: 161-180, 59 figs.

Pace, R. 1985. Aleocharinae attere della regione australiana e

neozelandese raccolte dal Prof. Franz (Coleoptera Staphylinidae)

(LXIV Contributo alia conoscenza delle Aleocharinae).

Fragmenta Entomologica 18: 105-114,37 figs.

Pace, R. 2003. New or little known Aleocharinae from the Australian

region (Coleoptera, Staphylinidae). Pp. 111-186, in: Giachino, P. M.,

and Daccordi, M. (eds.). Results of the Zoological Mission to

Australia of the Regional Museum of Natural Sciences of Turin,

Italy. I. Monografie del Museo regionale di Scienze naturali di

Torino 35. 169 figs.

Pace, R. 2005. Aleocharinae of the Australian Region collected by

Dr. PM. Giachino and Dr. M. Daccordi (Coleoptera, Staphylinidae).

Pp. 371-434, in: M. Daccordi M., and Giachino, P. M., (eds.).

Results of the Zoological Missions to Australia of the Regional

Museum of Natural Sciences of Turin, Italy. II. Monografie del

Museo regionale di Scienze naturali di Torino 42.

Stephens, J.F. 1832. Illustrations of British Entomology. Mandibulata.

Vol. V. 448 pp. + 4 pis. London: Baldwin and Cradock.

Thomson, C.G., 1858. Forsoktill uppstallning af Sveriges Staphyliner.

Of\’ersigt afK. Vetenskaps-Akademiens Fdrhandlingar, Stokholm

15: 27-40.

Thomson, C.G. 1860. Skandinaviens Coleoptera synoptisktbearbetade.

II. Tom. 304pp. Lund: Berlingsska Boktryckeriet.

Memoirs of Museum Victoria 64: 23-34 (2007)

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/Memoirs/

New cucumariid species from southern Australia (Echinodermata: Holothuroidea:

Dendrochirotida: Cucumariidae)

P. Mark O’Loughlin

Marine Biology Section, Museum Victoria, GPO Box 666, Melbourne, Victoria 3001, Australia (pmo@bigpond.net.au)

Abstract O’LoughlinP. M. 2007. NewcucumariidspeciesfromsouthernAustralia(Echinodermata: Holothuroidea: Dendrochirotida:

Cucumariidae). Memoirs of Museum Victoria 64: 23-34

Four cucumariid species, new to science, are described for the rocky shallows and off-shore sediments of southern

Australia: Apsolidium falconerae, Neoamphicyclus altoffi, Neoamphicyclus materiae, Neocucumella turnerae.

Neocucumella turnerae sp. nov. is unique within the genus in not having table ossicles. The five syntypes of Cucumaria

mutans Joshua are reviewed, restricted to three, and a lectotype and two paralectotypes are designated. The genus

Neoamphicyclus Hickman is reviewed. Cucumaria mutans is referred to Neoamphicyclus Hickman. One former syntype

of Cucumaria mutans is assigned to Neoamphicyclus materiae sp. nov. One former syntype of Cucumaria mutans has lost

all ossicles and is assigned to Neoamphicyclus sp. A key is provided for the species of Neoamphicyclus Hickman.

Keywords Echinodermata, Holothuroidea, Dendrochirotida, Cucumariidae, taxonomy, new species, key

Introduction

This paper describes new cucumariid species from the rocky

shallows and off-shore sediments in the temperate waters off

southern Australia. Rowe (1995) summarized our knowledge

of cucumariid species occurring in Australia. A small group

of species was described from tropical waters with distributions

extending to the temperate southern waters of Australia:

Plesiocolochirus spinosus (Quoy and Gaimard, 1833);

Colochirus quadrangularis Troschel, 1846; Cercodemas

anceps (Selenka, 1867); Mensamaria intercedens (Lampert,

1885); and Plesiocolochirus dispar (Lampert, 1889). Most of

the southern Australian cucumariid species occur in temperate

waters only. Plesiocolochirus ignavus (Ludwig, 1875) was

described from South Australia, Staurothyone inconspicua

(Bell, 1887) and Cucumella mutans (Joshua, 1914) from

Victoria, Staurothyone vercoi (Joshua and Creed, 1915) from

South Australia, and Amphicyclus mortenseni Heding and

Panning, 1954 and Neoamphicyclus lividus Hickman, 1962

from Tasmania.O’Loughlin and O’Hara (1992) added 12 new

cucumariid species for southern Australia: Apsolidium alvei ;

A. densum\ A. handreckv, Cucuvitrum rowei; Neocnus

bimarsupiis\ Neocucumella fracta\ Neocucumis cauda\

Pentocnus bursatus; Ocnus occiduus ; Squamocnus

aureoruber, Trachythyone Candida ; Trachythyone glebosa.

O’Loughlin and Alcock (2000) re-assigned Ocnus occiduus to

their new genus Australocnus. O’Loughlin (2000) added the

new species Psolidiella hickmani from south-eastern Australia

and Psolidiella maculosa from south-western Australia, and

reported the New Zealand species Psolidiella nigra Mortensen,

1925 from the eastern coast of southern Australia. Two new

species have been distinguished here from the closely related

ones Cucumella mutans (Joshua) and Neoamphicyclus lividus

Hickman, and an associated generic revision has been

undertaken. Two other new species are added from recently

examined material.

Materials and methods

The material examined here is principally in the collections of

Museum Victoria. Some specimens were borrowed from the

Tasmanian and Western Australian Museums. Photography of

live specimens and the preserved types was done by Leon

Altoff and Audrey Falconer. Photos of ossicles and body wall

mounts were taken by Mark O’Loughlin and Chris Rowley

using an Olympus BX50 compound microscope and Nikon

D70 digital camera, and a Leica DM5000 B compound

microscope and Leica DC500 camera with montage software.

Abbreviations: NMV, Museum Victoria, registration

number prefix F; TM, Tasmania Museum and Art Gallery,

prefix H; WAM, Western Australian Museum, prefix Z.

Throughout this paper Rowe (in Rowe and Gates, 1995) is

referred to as Rowe (1995), Dr. Frank W.E. Rowe being the

systematic authority in that work.

Dendrochirotida Grube, 1840 (restricted by Pawson and Fell,

1965)

Cucumariidae Ludwig, 1894 (emended Pawson and Fell,

1965)

P. Mark O’Loughlin

Subfamily Colochirinae Panning, 1949

Apsolidium O’Loughlin and O’Hara 1992

Type species. Apsolidium handrecki O’Loughlin and O’Hara,

1992 (original designation).

Other species. Apsolidium alvei O’Loughlin and O’Hara, 1992;

A. densum O’Loughlin and O’Hara, 1992; A. falconerae sp. nov.

Diagnosis. See O’Loughlin and O’Hara (1992).

Distribution. Southern Australia: from Victoria (Western Port)

to SW Western Australia (Trigg I.); not reported from Tasmania;

0-10 m.

Apsolidium falconerae sp. nov.

Figures la, 2a, 3a-d, 4a

Material examined. Holotype: Australia, Victoria, Western Port,

Phillip I., Cat Bay, shallow sublittoral, covered with detrital material

(held by tube feet), attached to undersurface of rock, C. Handreck,

7 Mar 1995, NMV FI 09375.

Description. Body length 34 mm, maximum width 15 mm

(preserved; tentacles excluded, partly withdrawn); body

rounded dorsally, flat ventral sole, tapering from wide high

oral end to lower narrow anal end; wide dorso-anterior oral

end; short dorso-posterior rounded blunt anal cone; dorsal

and lateral body wall thin, densely calcareous, rough, small

irregularly distributed scales evident, not overlapping; ventral

body wall distinctly thin semi-trunslucent sole with ossicles

evident, irregularly oval, tapering posteriorly, rounded not

acute junction with ventro -lateral body wall, peripheral series

of tube feet; 9 dendritic tentacles, 8 large, 1 small ventral;

radial and interradial calcareous ring plates wide posteriorly

with central deep notch, radially tapering anteriorly to blunt

columnar projection, interadially to thick point, heights of

plates subequal; small tube feet scattered closely over dorsal

and lateral surfaces; large tube feet ventrally, continuous

peripheral irregular series 5-wide, mid-ventral radial series

2-4 wide; single dorsal madreporite near vascular ring,

irregular short-branched form, less than 1 mm long; single

ventral polian vesicle; gonad tubules unbranched; longer

respiratory tree branch extends half coelom length;

longitudinal muscles thin, flat, retractor muscles branch off in

mid-body.

Ossicles. Dorsal and lateral body wall and tube feet with

multilayered ossicles (small scales), buttons, cups, tube foot

endplates, tube foot perforated support plates: multilayered

ossicles up to 896 pm long; buttons irregular, thick, knobbed,

perforated, 104-192 pm long, most small, some with secondary

layer developments, some intergrading with multilayered

ossicles; complex bluntly spinous cups, basal cross, branching

from rim to close over cup to varying extents, 112-144 pm

long; small endplates, up to 184 pm diameter, smallest

perforations centrally; tube foot support plates irregularly

oval, perforated, denticulate on 1 margin, sometimes curved,

typically 160 pm long. Ventral tube feet with endplates,

support plates, narrow plates: endplates up to 280 pm diameter,

small perforations centrally, large peripherally; support plates

elongate, bent or curved, perforated, denticulate on 1 margin,

typically 256 pm long. Sole with plates and cups: plates

perforated, thick, knobbed, single-layered, variably oval to

narrowly elongate, up to 400 pm long; cups rare, 80 pm long,

thin-walled, shallow, denticulate margin, denticulations

slightly globose. Tentacles with rods, narrow plates, small

plates, lacking rosettes: rods thick, straight or curved, large

lateral perforations, small terminal perforations, up to 296 pm

long (intergrade with narrow plates); narrow plates bent or

curved, thick, few central and distal perforations, margin

thickly denticulate, up to 200 pm long; small plates tentacle

dendritic branch endplates, thin-walled, perforated, irregularly

oval, cupped or curved, marginally finely denticulate, typically

56 pm long.

Colour. Live: body white dorsally and ventrally; tentacle

dendritic branches yellow (pers. comm. Clarrie Handreck).

Preserved: body and tentacle dendritic branches white; tentacle

trunks and oral disc with dark brown flecking.

Distribution. Victoria, Western Port, Phillip I., Cat Bay; 0-1 m.

Etymology. Named for Audrey Falconer (Marine Research

Group of Victoria), in appreciation of her dedication to marine

invertebrate studies on the coast of Victoria, and especially for

her contribution to photography in this work.

Remarks. The genus Apsolidium O’Loughlin and O’Hara,

1992 was described for 3 southern Australian species: A.

alvei, A. densum, A. handrecki. Apsolidium falconerae sp.

nov. shares the distinctive diagnostic characters of the genus.

The body form and cup ossicle form distinguish A. falconerae

from the other 3 species. None of the other 3 species has a

body form that tapers distinctly from anterior to posterior, or

has dorsal and lateral body wall cups with an extensively

developed rim that creates variably closed cups. A. falconerae

also lacks the tentacle rosette ossicles of each of the other 3

species. It is assumed here that the single small ventral

tentacle of A. falconerae is exceptional and would normally

be a pair.

Subfamily Thyonidiinae Heding and Panning, 1954

Neoamphicyclus Hickman, 1962

Neoamphicyclus Hickman, 1962: 58.— Rowe, 1995: 275.

Diagnosis (emended). Dendrochirotid holothuroid genus, up

to 60 mm long with maximum diameter 25 mm (preserved;

tentacles excluded); sub-cylindrical form, elongate, narrowing

anteriorly, tapering posteriorly to a narrowly rounded anal

cone; 25 dendritic tentacles, irregularly grouped outer ring of

15 large, 5 irregularly grouped inner pairs small, total number

and sizes variable, groups not aligned with radii; lacking collar

of papillae around tentacle ring; tube feet on radii only, in 5

paired single series, paired zig-zag to double series in mid-

body; radial tube feet present or absent across true introvert;

calcareous ring not composite, lacks posterior prolongations;

radial plates sub-rectangular, variable form in same specimen,

commonly asymmetrical anteriorly, deep notch above muscle

New cucumariid species

attachment, lateral shallow indentation, deep posterior notch,

posterior projections not upturned; interradial plates almost as

tall as radial plates, posteriorly wide with shallow indentation,

tapering to point anteriorly; single dorsal stone canal and

madreporite near vascular ring, rarely 2 or 3, small, madreporite

with “split pea” form, less than 1 mm diameter; 1-3 ventral

tubular polian vesicles; longitudinal muscles flat, undivided,

retractor muscles branch from mid-body; tufts of gonad tubules

on both sides of dorsal mesentery; respiratory trees extend

coelom length.

Ossicles. Body wall and introvert with table disc ossicles

only, with or without spires, sparse to numerous, predominantly

irregular in form, pillars 2-5, predominantly 3. Tube feet with

endplates, each with narrow rim of elongate perforated support

plates, typically 2 large central perforations. Tentacles with

irregular rods; variably with or lacking rosettes and tables.

Posterior anal body wall with 5 rudimentary scale ossicles.

Type species. Neoamphicyclus lividus Hickman, 1962 (original

designation).

Other species. N. altoffi sp. nov.; N. materiae sp. nov.; N. mutans

(Joshua, 1914).

Distribution. Southern Australia: New South Wales (south of

Bateman’s Bay), Tasmania, Victoria, South Australia, Western

Australia (south of Abrolhos Is.); 0-165 m.

Remarks. In describing his species and diagnosing his

monotypic genus Hickman (1962) accurately observed that the

table discs always lacked spires. This has been confirmed here

by extensive sampling of specimens of Neoamphicyclus lividus

from SE Tasmania. Specimens of a superficially similar species

from N Tasmania, Victoria, South Australia and Western

Australia have been determined in the past as N. lividus.

However, in all of the many specimens sampled in this work

most of the otherwise similar table discs have spires. Rowe

(1982) and Marsh (1991) noted these spires. This has led to the

recognition of a second allopatric Neoamphicyclus species

(N. materiae sp. nov. below). Cucumaria mutans Joshua, 1914

was reassigned to Cucumella Ludwig and Heding, 1935 by

Heding and Panning, 1954, partly on the basis of having 20

tentacles. The syntypes and many specimens of C. mutans

available for this study have 25 tentacles. C. mutans has all of

the emended diagnostic characters of Neoamphicyclus

Hickman, 1962 to which it is reassigned below. In fact one of

the syntypes of C. mutans is Neoamphicyclus materiae sp. nov.

(discussed below). Some specimens from across southern

Australia, previously identified as Cucumella mutans, are

recognized in this work as a 4th Neoamphicyclus species

(N. altoffi sp. nov., below). In the 4 species of Neoamphicyclus

both the “true” introvert and part of the anterior body (“pseudo”

introvert) may be withdrawn by the retractor muscles. This

distinction between true and pseudo introvert is made in the

descriptions. Radial tube feet are present on the pseudo introvert

in all Neoamphicyclus species, but may be present or absent on

the true introvert in the various species. The 165 m depth in the

distribution range is taken from H.L. Clark (1946), but the

specimen is not confirmed here as N. mutans (Joshua, 1914) or

N. altoffi sp. nov. (below) or N. materiae sp. nov. (below).

Key to the species of Neoamphicyclus Hickman, 1962

1. Body wall ossicles table discs, with or lacking spires,

sparsely present in body wall, small, rarely up to 64 pm

wide in specimens more than 15 mm long; tentacles

lacking rosette ossicles 2

— Body wall ossicles table discs with spires, numerous in body

wall, large, most more than 64 pm wide in specimens more

than 15 mm long; tentacles with rosette ossicles 3

2. All table discs lacking spires

Neoamphicyclus lividus Hickman, 1962

— Most table discs with spires

Neoamphicyclus materiae sp. nov.

3. Middle and upper tentacle trunks with white lumps,

rosette ossicles numerous; lacking white band across the

inner (oral) tentacle base; table discs mostly irregular;

table discs frequently up to 96 pm wide

Neoamphicyclus mutans (Joshua, 1914)

— Middle and upper tentacle trunks lacking white lumps,

ossicles irregular rods only; white band across the inner

(oral) tentacle base, rosette ossicles numerous; table discs

frequently regular with 3 large, 3 small perforations, 3

pillars; table discs frequently 80 pm wide '.V.; ....

Neoamphicyclus altoffi sp. nov.

Figures lc, Id, 2c, 4b, 4c

Cucumella mutans Hickman, 1962: 55-56, text figs 38-45, pi. 1

fig. 4 (non Cucumella mutans (Joshua, 1914).

Material examined. Holotype: Western Australia, Fremantle, Hall Bank,

C. Bryce, L. Marsh, S. Slack-Smith, 25 Jan 1980, WAM Z279-92.

Paratypes: Cockburn Sound, Woodman’s Point, Posidonia bed,

I m, N. Sammy, 25 Aug 1971, WAM Z722-71 (2); B.R. Wilson,

II Feb 1968, WAM Z721-71 (1); Cockburn Sound, south flats,

A. Jones, 24 Nov 1966, WAM Z453-78 (1); Garden I., Careening Bay,

Skippy Rock, 3-7 m, R. Slack-Smith, 6 Jan 1965, WAM Z729-71 (1).

Other material. Victoria, East Gippsland Scallop Survey,

38°12.3’S, 147°33’E, 26 m, 27 Feb 1971, NMV F76470 (1); Bass Strait

Survey, VIMS 81-T-l, BSS stn 178, 38°43.4’S, 146°56.9’E, 26 m,

18 Nov 1981, F76623 (1); BSS stn 188, 38°38.2’S, 142°35’E, 59 m,

20 Nov 1981, F76622 (1). Tasmania, Derwent Estuary, dredged off

Sandy Bay, 9-12 m, 23 Sep 1955, TM H2139 (2); Waterhouse Passage,

Blizzards Landing, 26 Feb 1991, F132717 (2); Tamar R., Green’s Beach,

3 May 1986, F58459 (1). South Australia, Kangaroo I., Emu Bay, rocky

shallows, algal epifauna, 17 Jan 1990, F132699 (1); Investigator Group,

Topgallant I., 25 m, 21 Apr 1985, F132713 (1). Western Australia,

Albany, Princess Royal Harbour, 4-13 m, 22 Jan 1988, F132704 (1);

4 m, 22 Jan 1988, F132724 (1); Geographe Bay, Forrest Beach, seagrass

bed, 1 Jan 1972, WAM Z201-73 (2); Dunsborough, under stones, 0.2 m,

31 Jan 1972, WAM Z209-73 (1); SW of Bunbury, FRV Lancelin, 20 m,

13 Apr 1963, WAM Z764-71 (2).

Description. Neoamphicyclus species up to 46 mm long with

maximum diameter 10 mm (preserved; tentacles excluded);

perioral thin conical pointed papillae, about 0.2 mm long;

radial tube feet do not cross true introvert, a few sometimes

encroach onto true introvert; gonad tubules branched.

P. Mark O’Loughlin

Ossicles. Body wall, introvert, with abundant table ossicles

only: table discs regular and irregular in form, frequently

80 pm wide and regular with 3 large, 3 smaller perforations,

3 pillars; discs size range 40-88 /mi wide, perforations 3-12,

spires typically with 3 pillars, infrequently 2-5, spires 32-40 /mi

long; in small 6 and 13 mm-long specimens maximum table

disc width was 56 /mi, indicating an increase in table disc size

with increase in specimen size. Tube feet with endplates up to

320 /m i diameter; few elongate -perforated support plates,

about 184 /mi long, frequently 2 large perforations centrally.

Tentacle trunks above base with irregular rods only, 64-328 /mi

long, small perforations distally, some short-branching, rare

blunt spines. Tentacle trunk base with rosettes and tables,

some intergrading: anastomosing rosettes, frequently closed

peripherally, largest with central perforations with small

tripod, rosettes up to 104 /mi long; tables irregular, up to 80 /mi

long, 2-3 pillars, some with up to 15 small perforations. Oral

disc and papillae with rosettes and thin rods, some intergrading:

anastomosing rosettes, frequently closed peripherally,

irregularly oval, up to 64 /mi long; rods thin, rare lateral

branching, distally few to many small perforations, up to 224 /mi

long. Posterior anal body wall with 5 rudimentary scales

(anastomosing calcareous bodies), irregular form, up to

280 /m i long.

Colour (preserved). Body and tube feet dark blue-grey to dark

grey-brown to brown to pale brown to off-white; introvert

brown to off-white; tentacle dendritic branches dark brown,

upper trunks pale grey/translucent, lacking white patches, inner

base of tentacle trunks with transverse white band; oral disc

dark brown, with white patches.

Distribution. Victoria (East Gippsland), Bass Strait, SE and

N Tasmania, South Australia, SW Western Australia (Perth);

0-59 m.

Etymology. Named for Leon Altoff (Marine Research Group

of Victoria), in appreciation of his dedication to marine

invertebrate studies on the coast of Victoria, and especially for

his contribution to photography in this work.

Remarks. Most of the specimens ref erredheretoNeoamphicyclus

altoffi sp. nov. have been previously determined as Cucumella

mutans (Joshua, 1914). Hickman (1962) reported Cucumella

mutans from SE Tasmania (Derwent estuary; TM H2139). Two

specimens were re-examined here and determined as N. altoffi

sp. nov. Marsh and Pawson (1993) determined “with some

doubt” as Cucumella mutans (Joshua, 1914) a small specimen

(7 mm long), lacking tentacles, from 30 m at Rottnest I. (SW

Australia). The form of the body wall tables is illustrated, and

closely resembles those of N. altoffi, as does the average disc

diameter for a small specimen (49 pm). But tables with curved

discs from tube feet are illustrated, and these have not been

found here in N. altoffi or C. mutans. N. altoffi has not been

found in the shallows of the coast of Victoria. It has been found

in the shallows from NE Tasmania to near Perth in Western

Australia. N. altoffi is distinguished from the other 3 species of

Neoamphicyclus in the key.

Neoamphicyclus lividus Hickman, 1962

Figure 2f

Neoamphicyclus lividus Hickman, 1962: 58, text figs 53-63, pi. 1

fig. 5.— Hickman, 1978: 29-31, figs 1-14.— Dartnall, 1980: 54, map

16.— Rowe, 1982: 460, 468-469, fig. 10.34b (part).-Rowe and Vail,

1982: 222.— Materia et al., 1991: 301, 306-307 (part; SE Tasmania

specimens).— O’Loughlin, 1991: 226, table 1 (part; SE Tasmania

specimens).— O’Loughlin and O’Hara, 1992: 227-28, Table L—

O’Loughlin, 1994: Table 1 (part; SE Tasmania specimens).— Rowe,

1995: 275 (part; SE Tasmania and King I. specimens), (part

Neoamphicyclus materiae sp. nov. below; non N. lividus Hickman,

1962).

Type locality. SE Tasmania, Pirates Bay, Eaglehawk Neck,

rocky shallows.

Material examined. SE Tasmania, Bruny I., Adventure Bay, rocky

shallows, 11 Jan 1989, NMV F58700 (30); Opossum Bay, rocky

shallows, 15 Nov 1982, F58698 (18+7 juveniles); F58707 (1, 5 brood

juveniles); Frederick Henry Bay, Carlton Point, Red Ochre Beach,

23 Nov 1968, F132714 (3); Eaglehawk Neck, rocky shallows,

15 Feb 1991, F132711 (33); N Tasmania, King I., Gulchway, S of

Surprise Bay, rocky shallows, 10 Mar 1980, F58697 (2); F58699 (5).

Description. Neoamphicyclus species up to 35 mm long with

maximum diameter 14 mm (preserved; tentacles excluded);

perioral papillae digitiform to distally sub-globular, about

0.2 mm long; radial tube feet cross true introvert; gonad tubules

with single branch, extend coelom length.

Ossicles. Body wall, introvert, with table disc ossicles

only: discs never with spires, irregular in form, table discs

decrease in number and size with increase in specimen size; in

6-mm long specimen discs abundant, 40-104 pm wide, 3-13

perforations; in 10 mm-long specimen discs 32-72 pm wide,

3-20 perforations; in 30 mm-long specimen discs sparse,

36-48 pm wide 2-6 perforations. Tube feet with endplates up

to 200 pm diameter; few elongate perforated support plates,

up to 112 pm long. Tentacles with irregular rods only,

perforations distally, lacking rosettes, rods up to 112 pm long.

Oral disc with rods only, lacking rosettes. Posterior anal body

wall with 5 rudimentary scales (anastomosing calcareous

bodies), irregular form, up to 320 pm long.

Reproduction. Sexes separate; coelomic brood protection by

females (Hickman, 1978; Materia et al., 1991).

Colour (preserved). Body blue-grey, slate-grey, grey-black,

dark grey-brown, dark brown, brown, frequently dark anteriorly

and posteriorly; tentacles darker in colour, lacking white

patches.

Distribution. SE Tasmania; N Tasmania, King I.; rocky

shallows.

Remarks. There are ossicle changes with change in specimen

size. In a 10-mm long specimen of N. lividus (F132711), the

disc plates have 2 forms: typical discs 32-72 pm wide 3-20

perforations; atypical thick perforted plates 96-112 pm wide

9-23 perforations. These perforated plates are not evident in

larger specimens. Hickman (1978) illustrated significantly

larger table discs with more perforations in coelomic juveniles

than larger specimens.

New cucumariid species

Hickman (1978) and Materia et al. (1991) reported coelomic

brood-protection by N. lividus. Only N. lividus specimens

collected in summer months between 15 November and

19 March were reported, with few, large brood juveniles. For

Neoamphicyclus materiae sp. nov. (below) brood release is

principally in October, with a few larger brood juveniles found

in females in December. A pattern of seasonal brood protection

with most brood juveniles released in spring appears to be the

same for N. lividus and N. materiae. Materia et. al. (1991)

noted the relatively larger full size of N. lividus specimens

from SE Tasmania compared with specimens from SE

mainland Australia (now N. materiae sp. nov. below).

N. lividus is distinguished from the other 3 species of

Neoamphicyclus in the key.

Neoamphicyclus materiae sp. nov.

Figures le, 2e, 4d

Cucumaria mutans Joshua, 1914: 4, pi. 1 figs la-d (part).— Joshua

and Creed, 1915: 18 (part).-H.L. Clark, 1938: 444-445 (part) (part

non Cucumaria mutans Joshua, 1914).

Mensamaria thomsoni — H.L. Clark, 1946: 406 (part, juvenile

forms, non Mensamaria thomsoni (Hutton, 1879)).

Neoamphicyclus lividus. —Hickman, 1962: 58 (East Devonport).—

Rowe, 1982: 460, 468-469, fig. 10.34b (part).-0’Loughlin, 1984:

151.— Materia et al., 1991: 301, 305-307, tables 4, 5, figs 4, 5 (part;

Victoria specimens). — O’Loughlin, 1991: 226, table 1 (part; Victoria

specimens).— O’Loughlin and O’Hara, 1992: 227-228, table 1

(part).— O’Loughlin, 1994: table 1 (part; Victoria specimens).— Rowe,

1995: 275 (N Tasmania, except King I., and southern Australia) (non

Neoamphicyclus lividus Hickman, 1962).

cf. Neoamphicyclus lividus Hickman.— Marsh, 1991: 472-473

(non Neoamphicyclus lividus Hickman, 1962).

Material examined. Holotype: Victoria, Flinders ocean platforms,

E of Mushroom Reef, shallow sub-littoral, under rocks and on algae,

T. Megens, M. O’Loughlin, 10 Mar 1980, NMV F132722.

Paratypes: Type locality and date, F76372 (4); SE comer of

Mushroom Reef, M. O’Loughlin, 12 Dec 1985, F76360 (11); E of

Mushroom Reef, C. Materia, M. O’Loughlin, 9 Oct 1987, F76364 (14).

Other material. New South Wales, 12 km S of Bateman’s Bay,

Pretty Point Bay, 11 Aug 1991, F132707 (2). Victoria, syntype of

Cucumaria mutans Joshua, 1914, F132702 (1; ex F45139, non C.

mutans)-, Mallacoota, 21 Jan 1981, F76422 (4); Shack Bay, VNPMS stn

27, rocky subtidal, 4-6 m, 14 Feb 1996, F146573 (1); Cape Paterson,

VNPMS stn 2, rocky subtidal, 2 May 1995, F146572 (1); Phillip I.,

Kitty Miller Bay, 25 Oct 1987, F58590 (17); S of Apollo Bay, Marengo,

Hayley Point, 11 Jan 1980, F58720 (7); Killarney, 20 Apr 1983, F76461

(1). N Tasmania, Waterhouse Passage, 26 Feb 1991, F132712 (1);

F132718 (1); Lulworth, Black Rock Point, 22 Nov 1982, F132709 (3);

Point Sorell, 19 Jan 1989, F58612 (12); E Devonport, 1-14 Jan 1940,

TM H2141 (15); Stanley, Godfrey Beach, 30 Nov 1968, F132715 (1);

Port Latta, Cowrie Beach, 1 Dec 1968, F132716 (1). South Australia,

Cape Northumberland, 4 Jan 2001, F132706 (1); 6 km E of Port

MacDonnell, Stoney Point, 19 Mar 1976, F132721 (2); Cape Jervis,

7 m, 21 Feb 1974, F132708 (1); Kangaroo I., Eastern Cove,

16 Jan 1990, F132705 (5); Streaky Bay, Point Westall, 15 Jan 1991,

F132720 (4); Ceduna, Cape Vivonne, 14 Jan 1991, F132710 (15);

NW of Thevenard, 14 Dec 1991, F66233 (20).

Description. Neoamphicyclus species up to 45 mm long with

maximum diameter 7 mm (preserved; tentacles excluded);

perioral thick conical papillae; radial tube feet do not cross true

introvert; gonad tubules unbranched.

Ossicles. Body wall, introvert, with sparse table ossicles

only: table discs mostly irregular in form, rounded to angular,

commonly 32-48 pm wide, rarely up to 64 pm wide,

perforations commonly 3-7, rarely up to 11; spires typically

with 3 pillars, sometimes 2, rarely 4, frequently absent, spires

typically 24 pm long; in small 10-mm long specimens tables

numerous, discs up to 88 pm wide, up to 24 perforations,

indicating decrease in table disc size, number of disc

perforations, and density in body wall with increase in

specimen size. Tube feet with endplates up to 224 pm diameter;

narrow rim of perforated support plates, elongate, frequently 2

large central perforations, about 112 pm long. Tentacles with

rods only, irregular, branched or unbranched, distally with or

lacking perforations, some H-shaped, rods 48-136 pm long.

Oral disc and papillae with rods only, with perforated ends,

lacking rosettes. Posterior anal body wall with 5 rudimentary

scales (anastomosing calcareous bodies), irregular form with

single-layered perforated stem, up to 400 pm long.

Reproduction. Sexes separate; seasonal reproduction; coelomic

brood protection by females; up to 528 coelomic juveniles per

female; brood release principally in October and November

(Materia et al., 1991, as N. lividus from Victoria).

Colour (preserved). Body pale to dark blue-grey to grey-brown

with fine speckle, dark blue-grey to grey-black anteriorly and

posteriorly; introvert pale to dark grey-brown to brown; tentacle

dendritic ends pale grey, trunks dark brown; oral disc dark

brown.

Distribution. S New South Wales (Bateman’s Bay), Victoria,

N Tasmania (excluding King I.), South Australia, S Western

Australia (Princess Royal Harbour, Quaranup (Marsh, 1991));

0-7 m.

Etymology. Named for Christine Materia in appreciation of her

great contribution to echinoderm research through dedicated

fieldwork and museum curation, and in particular for her

contribution to our knowledge about this species.

Remarks. H. L. Clark (1938, 1946) accepted Joshua (1914) and

Joshua and Creed (1915) who mistakenly thought that the

common small deep blue -black holothurians on the Victorian

coast, with sparse tables usually devoid of a spire, were young

of Cucumaria mutans. These holothuroids are in fact the

Neoamphicyclus materiae sp. nov. described here, and

distinguished from the other 3 Neoamphicyclus species in the

key. Joshua’s thinking is confirmed by the fact that one of his

syntypes of Cucumaria mutans is the new species N. materiae.

Hickman (1962) reported Neoamphicyclus lividus from

Devonport. This material was examined and most discs have

the characteristic spires of N. materiae. Marsh (1991) noted the

smaller body size and presence of table spires in specimens

from Princess Royal Harbour in SW Australia, and reported

the material as “cf. Neoamphicyclus lividus Hickman”. These

specimens are presumed here to be conspecific with A. materiae

sp. nov.

P. Mark O’Loughlin

Neoamphicyclus mutans (Joshua, 1914) comb. nov.

Figures lb, 2d, 4e

Cucumaria mutans Joshua, 1914: 4, pi. 1 figs la-d (part).— Joshua

and Creed, 1915: 18 (part).-H. L. Clark, 1938: 444-445 (part).

Mensamaria thorns oni— H.L. Clark, 1946: 406 (adult forms; non

Mensamaria thomsoni (Hutton, 1879).

Cucumella mutans— Heding and Panning, 1954: 67-68.— A. M.

Clark, 1966: 348-349.-Dartnall, 1980: 54, pi. 5, fig. 31, map 16.-

Rowe, 1982: 460, 468, fig. 10.34a.-O’Loughlin, 1984: 151.—

O’Loughlin and O’Hara, 1992: 227-29.-Rowe, 1995: 273.

Type locality. Victoria, Western Port.

Material examined. Cucmaria mutans Joshua, 1914. Lectotype

(nominated here). Western Port, Jan 1912, NMV F45138.

Paralectotypes (nominated here): Type locality and lot, F132723

(1); Victoria, F45139 (1).

Remaining syntypes: Specimen removed from F45139

redetermined as Neoamphicyclus materiae sp. nov. (F132702); second

specimen removed from F45139 determined as Neoamphicyclus sp.

(F132719; ossicles completely eroded); Western Port, F45140

(microscope slide).

Other material. Victoria, Walkerville, 6 Mar 1982, F76209 (2);

Shack Bay, VNPMS stn 27, 4-6 m, 14 Feb 1996, F146578 (1); Western

Port, Joshua, Jan 1912, F76477 (1); Crib Point Benthic Survey, 2 m,

13 Apr 1965, F76640 (1); Shoreham, 30 Mar 1902, F76083 (1);

McHaffies, 7 Feb 1970, F45246 (1); Flinders, ocean platforms,

22 Jan 1982, F76076 (2); 17 Feb 1990, F76609 (6); Port Phillip Bay,

southern, 38°17’ S, 144°38’ E, 3-6 m, 30 Mar 1986, F136913 (3);

Cheltenam beach, 20 Jul 1891, F76085 (6). N Tasmania, Waterhouse

Passage, 26 Feb 1991, F146576 (9); Tamar R., Greens Beach,

3 May 1986, F146577 (8); Point Sorell, 19 Jan 1989, F146579 (2); King

I., 9 Mar 1980, F146575 (2). South Australia, Victor Harbor,

9 Nov 1988, F 146574 (1); Glenelg, Jul 1979, F76089 (1); Kangaroo I.,

NE Eastern Cove, rocky shallows, 16 Jan 1990, F136915 (1); Emu Bay,

17 Jan 1990, F136916 (1); Port Lincoln, North Shore, 14 Feb 1970,

F136912 (1); dredged, Jan 1968, F136914 (1); Streaky Bay, Point

Westall, Smooth Pool, 15 Jan 1991, F109315 (3). Western Australia,

Perth, Cottesloe, Sargassum beds, 6 Feb 2007, WAM Z37473 (1).

Description. Neoamphicyclus species up to 60 mm long with

maximum diameter 25 mm (preserved; tentacles excluded);

perioral blunt to thick conical papillae; paired single radial

series of tube feet usually cross true introvert, sometimes only

a few present; gonad tubules not branched.

Ossicles. Body wall, introvert, with abundant table ossicles

only: table discs sometimes regular (sub-triangular with 3

large 3 small perforations), mostly irregular in form, disc size

range 72-136 pm wide, frequently about 112 pm wide;

perforations 6-23; pillars 3-5, predominantly 3, typically

48 pm long. Tube feet with endplates up to 320 pm diameter;

few elongate, irregular, perforated support plates, about

168 pm long. Tentacles with rods, rosettes both basally and

distally, tables, and intergrading forms up to 184 pm long:

rods plate -like, perforated, irregular in form; rosettes plate-

like with small close perforations, largest with large central

perforations, some with secondary layer developments, rosettes

up to 136 pm long; table discs 44-88 pm wide, 4-20

perforations, 2-4 pillars. Posterior anal body wall with 5

rudimentary scales (anastomosing calcareous bodies), irregular

form, up to 520 pm long.

Colour. Live: body violet-grey to blue-grey, frequently with

some purple colouration, darker anteriorly and posteriorly.

Preserved: body pale to dark brown, to brown-grey, to blue-

grey, to violet-black, darker anteriorly and posteriorly; introvert

brown to off-white; tentacle trunks pale grey, brown flecks,

white lumps, lacking basal white band; tentacle dendritic

branches dark brown; disc with brown markings.

Distribution (this work). Victoria, W of Wilsons Promontory

(Walkerville), N Tasmania, to SW Western Australia (Perth);

0-6 m.

Remarks. H. L. Clark (1938) judged material from Bunkers

Bay (Margaret River) and Cottesloe (Perth) in SW Australia to

be Cucumaria mutans Joshua, 1914. This material was not

examined here and confirmed as N. altoffi sp. nov. or N. mutans

(Joshua). Subsequently H. L. Clark (1946) synonymised

Cucumaria mutans Joshua, 1914 with Mensamaria thomsoni

(Hutton, 1879), and referred material from the western side of

the Great Australian Bight (165 m), Bunkers Bay and Perth to

this species. The specimen from the Great Australian Bight

was not examined here and confirmed as N. altoffi or N. mutans.

H. L. Clark (1946) commented that “further study of this

holothurian in New Zealand, Victoria and Western Australia

may show that at least 2 and possibly 3 species are at present

confused under one name”. Later Heding and Panning (1954)

raised Cucumaria mutans Joshua, 1914 out of synonymy, and

reassigned the species to Cucumella Ludwig and Heding, 1935.

This decision was based on an erroneous assessment of tentacle

number, as discussed under Neoamphicyclus Hickman (above),

and C. mutans is re-assigned here to Neoamphicyclus.

As indicated in the material examined a lectotype and

paralectotypes are nominated here. One syntype specimen is

determined as Neoamphicyclus materiae sp. nov., and one

syntype specimen with completely eroded ossicles can no

longer be determined to species and remains Neoamphicyclus

sp. Hickman (1962) reported Cucumella mutans from SE

Tasmania (Derwent Estuary; TM H2139). The specimens were

re-examined here and determined as N. altoffi sp. nov. (above).

No specimens of N. mutans from southern Tasmania have

been seen in this work. Marsh and Pawson (1993) determined

“with some doubt” as Cucumella mutans (Joshua, 1914,) a

small specimen (7 mm long), lacking tentacles, from 30 m at

Rottnest I. (SW Australia). The form of the body wall tables is

illustrated, and has some resemblance to those of N. mutans,

but the average disc diameter (49 pm) is significantly smaller.

Tables with curved discs from tube feet are illustrated, and

these have not been found in N. mutans. Many specimens from

across southern Australia, previously identified as Cucumella

mutans , are recognized in this work as a new Neoamphicyclus

species ( N . altoffi sp. nov., above). N. mutans is distinguished

from the other 3 species of Neoamphicyclus in the key.

Neocucumella Pawson, 1962

Neocucumella Pawson, 1962: 65.— Pawson, 1963: 22.— Pawson,

1970: 31.— O’Loughlin and O’Hara, 1992: 250 -Rowe, 1995: 276.

Type species. Pseudocucumis bicolumnatus Dendy and Hindle,

1907 (originally monotypic).

New cucumariid species

Other species. Neocucumella fracta O’Loughlin and O’Hara,

1992; N. turnerae O’Loughlin, sp. nov.

Diagnosis. See emended diagnosis in O’Loughlin and O’Hara

(1992).

Distribution. New Zealand (7-239 m; Pawson, 1970); SE

Australia (SE Tasmania; Derwent Estuary; Bass Strait; Spencer

Gulf; 10-110 m).

Neocucumella turnerae sp. nov.

Figures If, 2b, 4f

Material examined. Holotype: SE Tasmania, Derwent Estuary,

Blackmans Bay, on beach after storm, E. Turner, 12 Jun 1988, TM

H3295.

Paratypes: Type locality and date, TM H3296 (10).

Other material. Type locality and date, TM H1983 (33); SS02/2007

stn 2, 146.98°E, 43.69°S, 100-110 m, 29 Mar 2007, F136939 (1).

Description. Up to 60 mm long (preserved, tentacles partly

extended), maximum diameter 8 mm; body form subcylindrical,

long, thin, tapering orally and anally; ring of 20 dendritic

tentacles, 5 pairs of large interradial, 5 pairs of small radial;

lacking collar of papillae around tentacle ring; tube feet in

5 paired radial series, continuous across true introvert; dense

collar of about 100 conspicuous pointed perioral papillae;

5 radial pairs of minute perianal papillae; ring not composite,

lacks posterior prolongations; radial plates subrectangular,

anterior notch, posterior notch with short projections upturned;

interradial plates small, inverted V shape; dorsal twisting stone

canal (1 mm long), with bean-like madreporite (1 mm long);

3 ventral long thin tubular polian vesicles up to 20 mm long;

longitudinal muscles broad, flat, undivided; tufts of long, thin

unbranched gonad tubules on each side of dorsal mesentery;

respiratory tree weakly dendritic, extending coelom length to

vascular ring.

Ossicles. Mid-body wall, introvert, lacking ossicles (except

tube feet). Tube feet: endplates up to 240 pm diameter, slightly

smaller perforations centrally; few perforated support plates,

typically 96 pm long, 2 large perforations centrally, smaller

perforations distally, denticulate on one side, form narrow rim

around endplate; fine rods, thin, straight, perforated distally,

typically 80 pm long; rosettes in tube feet of introvert.

Tentacles: smooth rods, distally perforated or bifurcate, up to

120 pm long. Oral disc: densely branched rosettes, up to

64 pm long, irregularly oval. Oral papillae: rosettesintergrading

with unbranched and distally branched and intertwined

irregular rods, variably perforated. Posterior anal body wall:

5 rudimentary scales (anastomosing calcareous bodies),

irregularly oval to elongate, up to 240 pm long; smooth distally

perforated rods, up to 64 pm long; irregular oval table-like

discs, up to 48 pm long, lacking spires.

Colour. Colour in life “pale pink” (E. Turner pers. comm.).

Preserved colour of body and tube feet off-white; tentacles dark

to pale brown to off-white; dark brown flecking on oral disc.

Distribution. SE Tasmania, Derwent Estuary, sediment;

sublittoral to 110 m.

Etymology. Named for Mrs Elizabeth Turner, of the Tasmania

Museum and Art Gallery, for her gracious assistance with loans

and data over many years, and for collecting most of the

specimens of this new species.

Remarks. Pawson (1962) erected the monotypic genus

Neocucumella for the New Zealand species Pseudocucumis

bicolumnatus Dendy and Hindle, 1907. O’Loughlin and O’Hara

(1992) added Neocucumella fracta for SE Australia, and

discussed the generic diagnosis. Neocucumella turnerae sp. nov.

has the tentacle number and form, tube feet arrangement, tube

f eet os side f orms , and di stincti ve calcareous ring of Neocucumella,

but is unique and exceptional in completely lacking table ossicles.

Such a significant diagnostic difference suggests the desirability

of erecting yet another cucumariid genus, but I judge that this

should not be done until appropriate molecular data is available

for a revision of Neocucumella Pawson and related genera.

Acknowledgments

I am grateful to Leon Altoff and Audrey Falconer (Marine

Research Group; photography); Ben Boonen (preparation of

images); Loisette Marsh and Mark Salotti (WAM; loan of

specimens); Chris Rowley (NMV; photography); Liz Turner

and Genefor Walker-Smith (TM; loan of specimens). I am

appreciative of the manuscript reviews provided by Dr T. D.

O’Hara and Dr F. W. E. Rowe.

References

Bell, F. J. 1887. Studies in the Holothuroidea. — VI. Descriptions of

new species. Proceedings of the Zoological Society of London

35: 531-534, pi. 45.

Clark, A. M. 1966. Port Phillip Survey, 1957-1963. Echinodermata.

Memoirs of the National Museum of Victoria 27: 289-384,

10 figs, 4 pis, 3 tabs.

Clark, H. L. 1 938. Echinoderms from Australia. An account of collections

made in 1929 and 1932. Memoirs of the Museum of Comparative

Zoology at Harvard College 55: 1-596, 28 pis, 63 figs.

Clark, H. L. 1946. The echinoderm fauna of Australia. Its composition

and its origin. Carnegie Institution of Washington Publication

566: 1-567.

Dartnall, A. 1980. Fauna of Tasmania Handbook 3. Tasmanian

echinoderms. University of Tasmania: Hobart. 82 pp., 36 figs,

5 pis, 18 maps.

Dendy, A., and Hindle, E. 1907. Some additions to our knowledge of

the New Zealand holothurians. Journal of the Linnean Society

(Zoology) 30: 95-125, pis 11-14.

Grube, A. E. 1840. Aktinien, Echinodermen und Wiirmer des

Adriatischen und Mittelmeeres. pp. 33-43, 1 pi. Konigsberg.

Heding, S. G., and Panning, A. 1954. Phyllophoridae. Eine bearbeitung

der polytentaculaten dendrochiroten holothurien des zoologischen

museums in Kopenhagen. Spolia Zoologica Musei Hauniensis

13: 209 pp.

Hickman, V. V. 1962. Tasmanian sea-cucumbers (Holothuroidea).

Papers and Proceedings of the Royal Society of Tasmania

96: 49-72, 2 pis, 186 figs.

Hickman, V. V. 1978. Notes on three species of Tasmanian sea

cucumbers including one species that broods its young in the

coelome. (Holothurioidea: Phyllophoridae, Caudinidae). Papers

and Proceedings of the Royal Society of Tasmania 112: 29-37,

pi. 1, 44 figs.

P. Mark O’Loughlin

Hutton, F. W. 1879. Notes on some New Zealand Echinodermata, with

descriptions of new species. Transactions and Proceedings of the

New Zealand Institute 11(31): 305-308.

Joshua, E. C. 1914. Victorian Holothuroidea, with descriptions of new

species. Proceedings of the Royal Society of Victoria 27(1): 1-11,

figs 1-4.

Joshua, E. C., and Creed, E. 1915. South Australian Holothuroidea,

with descriptions of new species. Transactions and Proceedings

of the Royal Society of South Australia 39: 16-24, pis 2-4.

Lampert, K. 1885. Die Seewalzen. Holothurioidea. Eine Systematische

Monographic, in: Semper, C. (ed.) Reisen im Archipel der

Philippinen (2)4(3): 1-310, 1 pi.

Lampert, K. 1889. Die wahrend der Expedition S.M.S. Gazelle 1874-

1876 von Prof. Dr. Th. Studer gesammelten Holothurien.

Zoologische Yahrbiicher. Abtheilung fur Systematik, Geographie

und Biologie der Thiere 4: 806-858, pi. 24.

Ludwig, H. 1875. Beitrage zur Kenntnis der Holothurien. Arbeiten aus

dem Zoologisch-Zootomischen Institut in Wurzburg 2: 77-118,

pis 6, 7.

Ludwig, H. 1894. Reports on an exploration off the west coasts of

Mexico, Central and South America, and off the Galapagos

Islands, in charge of Alexander Agassiz, by the U.S. Fish

Commission steamer Albatross, during 1891. XII. The

Holothurioidea. Memoirs of the Museum of Comparative Zoology,

Harvard University 17(3): 1-183, pis 1-19.

Ludwig, H., and Heding, S.G. 1935. Die holothurien der Deutschen

Tiefsee-Expedition. 1. Fusslose und dendrochirote formen.

Wissenschaftliche Ergebnisse der Deutschen Tiefsee-Expedition

aufdem dampfer Valdivia 1898-1899 24: 123-214.

Marsh, L. M. 1991. Shallow water echinoderms of the Albany region,

south-western Australia. Pp. 439-482 in: Wells, F. E., Walker, D.

I., Kirkman, H., and Lethbridge, R. (eds). Proceedings of the

Third International Marine Biological Workshop: The Marine

Flora and Fauna of Albany, Western Australia Vol. 2. Western

Australian Museum: Perth.

Marsh, L. M., and Pawson, D.L. 1993. Echinoderms of Rottnest Island.

Pp. 279-304 in: Wells, F. E„ Walker, D. I., Kirkman, H„ and

Lethbridge, R. (eds). Proceedings of the Fifth International Marine

Biological Workshop: The Marine Flora and Fauna of Rottnest

Island, Western Australia. Western Australian Museum: Perth.

Materia, C. J., Monagle, J. F. and O’Loughlin, P. M. 1991. Seasonal

coelomic brooding in southern Australian cucumariids

(Echinodermata, Holothurioidea). Pp. 301-307, 5 figs, 5 tbls in:

Yanagisawa, T., Yasumasu, I., Oguro, C., Suzuki, N., and

Motokawa, T. (eds). Biology of Echinodermata. Proceedings of

the Seventh International Echinoderm Conference, Atami, 9-14

September, 1990. Balkema: Rotterdam.

Mortensen, Th. 1925. Echinoderms of New Zealand and the Auckland-

Campbell Islands. III-V. Asteroidea, Holothurioidea, Crinoidea.

Videnskabelige Meddelelser fra Dansk naturhistorisk Forening i

Kobenhavn 79(29): 261-420, text figs 1-70, pis 12-14.

O’Loughlin, P. M. 1984. Class Holothurioidea. Pp. 149-155 in:

Phillips, D. A. B., Handreck, C. P., Bock, P. E., Burn, R., Smith,

B. J., and Staples, D. A. (eds). Coastal Invertebrates of Victoria.

An Atlas of Selected Species. Marine Research Group of Victoria

in association with the Museum of Victoria: Melbourne.

O’Loughlin, P. M. 1991. Brooding and fission in shallow water

echinoderms of southern Australia. Pp. 223-228, 5 figs, 1 tbl. In:

Yanagisawa, T., Yasumasu, I., Oguro, C., Suzuki, N., and

Motokawa, T. (eds). Biology of Echinodermata. Proceedings of

the Seventh International Echinoderm Conference, Atami, 9-14

September, 1990. Balkema: Rotterdam.

O’Loughlin, P. M. 1994. Brood-protecting and fissiparous cucumariids

(Echinodermata, Holothurioidea). Pp. 539-547, 1 tbl., 6 figs in:

David, B., Guille, A., Feral, J-P., and Roux, M. (eds). Echinoderms

through Time. Proceedings of the Eighth International

Echinoderm Conference, Dijon, France, 6-10 September, 1993.

Balkema: Rotterdam.

O’Loughlin, P. M. 2000. A review of the cucumariid genus Psolidiella

Mortensen (Echinodermata, Holothuroidea). Memoirs of Museum

Victoria 58(1): 25-37.

O’Loughlin, P. M., and Alcock, N. 2000. The New Zealand

Cucumariidae (Echinodermata, Holothuroidea). Memoirs of

Museum Victoria 58(1): 1-24.

O’Loughlin, P. M,. and O’Hara, T. D. 1992. New cucumariid

holothurians (Echinodermata) from southern Australia, including

two brooding and one fissiparous species. Memoirs of the Museum

of Victoria 53(2): 227-266, 1 tbl., 8 text figs, 10 pis.

Panning, A. 1949. VersucheinerNeuordnung der Familie Cucumariidae

(Holothurioidea, Dendrochirota). Zoologische Jahrbiicher

Abtheilung fur Systematik, Geographie und Biologie der Thiere

78: 404-470.

Pawson, D. L. 1962. A new phyllophorid genus in the Holothuroidea.

Transactions of the Royal Society of New Zealand, Zoology

2(11): 65-67, figs 1-2.

Pawson, D. L. 1970. The marine fauna of New Zealand: Sea cucumbers

(Echinodermata: Holothuroidea). Bulletin of the New Zealand

Department of Scientific and Industrial Research 201: 7-65,

10 figs, 2 pis.

Pawson, D. L., and Fell, H. B. 1965. A revised classification of the

dendrochirote holothurians. Breviora 214: 1-7.

Quoy, J. R. C., and Gaimard, J. P. 1833. Holothuries. Pp. 108-133 in:

Voyage de la corvette de l’Astrolabe 1826-1829. Zoologie:

Zoophytes. 390 pp., 26 pis. J. Tastu: Paris.

Rowe, F. W. E. 1982. Sea-cucumbers (class Holothurioidea). Pp.

454-476, figs 10:26-10:37, pis 29-32 in: Shepherd, S.A., and

Thomas, I. M. (eds). Marine Invertebrates of Southern Australia.

Part 1. South Australian Government Printer: Adelaide.

Rowe, F. W. E., and Gates, J. 1995. Echinodermata. In Wells, A. (ed.).

Zoological Catalogue of Australia 33: i-xiii, 1-510. CSIRO:

Melbourne. (Referred to throughout this paper as Rowe, 1995.)

Rowe, F. W. E., and Vail, L. L. 1982. The distributions of Tasmanian

echinoderms in relation to southern Australian biogeographic

provinces. Pp. 219-225, 1 fig. In: Lawrence J. M. (ed.).

Echinoderms: Proceedings of the International Conference,

Tampa Bay. Balkema: Rotterdam.

Selenka, E. 1867. Beitrage zur Anatomie und Systematik der

Holothurien. Zeitschrift Wissenschaftliche Zoologie 17: 291-374

pis 17-20.

Troschel, F.H. 1846. Neue Holothurien - Gattungen. Archiv

Naturgeschischte 12 (2): 60-66.

New cucumariid species

Figure 1. a, Apsolidium falconerae sp. nov., holotype, from Phillip I., NMV F109375, preserved, 34 mm long, lateral view showing thick

calcareous dorsal and lateral body, thin-walled sole, mid-ventral radial tube feet; insert with radial (left) and interradial (right) plates of calcareous

ring, b, Neoamphicyclus mutans (Joshua, 1914), live colour, collected by Mark O’Loughlin from Flinders ocean platforms on 13 February 2007,

60 mm long, lateral view, NMV FI 23862. c, Neoamphicyclus altoffi sp. nov., holotype, from Fremantle, WAM Z279-92, preserved, 33 mm long,

dorso-lateral view; insert with radial (left) and interradial (right) plates of calcareous ring, d, Neoamphicyclus altoffi sp. nov., tentacles showing

white calcareous band of ossicles at base, NMV F132704. e, Neoamphicyclus materiae sp. nov., holotype, from Flinders, NMV F132722,

preserved, 35 mm long, ventral view; insert with radial (left) and interradial (right) plates of calcareous ring, f, Neocucumella turnerae sp. nov.,

holotype, from Derwent estuary, TM H3295, preserved, 46 mm long; insert with radial (left) and interradial (right) plates of calcareous ring.

P. Mark O’Loughlin

Figure 2. Body wall mounts, a, Apsolidiumfalconerae sp. nov., holotype, NMV F109375, knobbed plates in ventral body wall, b, Neocucumella

turnerae sp. nov., paratype, TM H3296, endplate in ventral body wall; absence of other ossicles, c, Neoamphicyclus altoffi sp. nov., holotype,

WAM Z279-92, table discs in body wall; insert with lateral view of table showing spire, NMV F132704. d, Neoamphicyclus mutans

(Joshua, 1914), NMV F109315, table discs in body wall; insert showing table spire, e, Neoamphicyclus materiae sp. nov., paratype NMV F76360,

table discs in body wall; inserts with lateral view of tables showing spires, paratype, NMV F76364. f, Neoamphicyclus lividus Hickman, 1962,

table discs in body wall, NMV F58698.

New cucumariid species

Figure 3. Apsolidiumfalconerae sp. nov., ossicles, holotype, NMV F109375. a, scale (multilayered ossicle) from dorsal body wall, b, dorsal body

wall; knobbed button and cup (top right); 4 perforated tube foot support plates, c, partially “closed” cups from dorsal body wall; 2 views of cross

at base of cups (left); view of partially closed top of cup (upper right); lateral view of cup (lower right), d, ventral body wall (sole); elongate

knobbed plate (upper); 4 tube foot support plates (lower).

P. Mark O’Loughlin

Figure 4. Tentacle ossicles, a , Apsolidiumfalconerae sp. nov., holotype, NMV F109375, perforated plates and rods, b, Neoamphicyclus altoffi sp.

nov., rosettes from lower tentacle (base), NMV F132704. c, Neoamphicyclus altoffi sp. nov., rods from upper tentacle, NMV F132704. d,

Neoamphicyclus materiae sp. nov., paratype, NMV F76364, rods, e, Neoamphicyclus mutans (Joshua, 1914), NMV F109315, rosettes from upper

tentacle, f, Neocucumella turnerae sp. nov., paratype, TM H3296; rosettes from disc and oral papillae (left); rods from tentacles (right).

Memoirs of Museum Victoria 64: 35-52 (2007)

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/Memoirs/

New Holothuria species from Australia (Echinodermata: Holothuroidea:

Holothuriidae), with comments on the origin of deep and cool holothuriids

P. Mark O’loughlin 1 , Gustav Paulay 2 , Didier Vandenspiegel 3 and Yves Samyn 4

Marine Biology Section, Museum Victoria, GPO Box 666, Melbourne, Victoria 3001, Australia (pmo@bigpond.net.au)

^Florida Museum of Natural History, University of Florida, Gainesville FL 32611-7800, USA (paulay@flmnh.ufl.edu)

3 Musee royal de l’Afrique centrale. Section invertebrates non-insects, B-3080, Tervuren, Belgium (dvdspiegel@africamuseum.be)

4 Royal Belgian Institute of Natural Sciences, Global Taxonomy Initiative, B-1000, Brussels, Belgium (yves.samyn@naturalsciences.be)

Abstract O’Loughlin, P. M., Paulay, G., VandenSpiegel D., and Samyn, Y. 2007. New Holothuria species from Australia

(Echinodermata: Holothuroidea: Holothuriidae), with comments on the origin of deep and cool holothuriids. Memoirs of

Museum Victoria 64: 35-52.

Two aspidochirotid species, new to science, from the continental slope of southern Australia are described:

Holothuria ( Panning othuria) austrinabassa O’Loughlin sp. nov. and Holothuria (Halodeima) nigralutea O’Loughlin sp.

nov. The first represents the southernmost documented holothuriid, and is the sister species of the northernmost holothuriid

species Holothuria (Panningothuria) forskali Delle Chiaje. The second is a very recent offshoot of the wide-ranging Indo-

west Pacific Holothuria ( Halodeima ) edulis Lesson. Morphological and molecular genetic differences between these

species pairs are detailed. Holothuria ( Halodeima ) signata Ludwig is raised out of synonymy with H. edulis.A lectotype

for Holothuria ( Halodeima ) signata Ludwig is designated. The status of the subgenera Panningothuria Rowe and

Halodeima Pearson is discussed. The occurrence of multiple madreporites in Halodeima is discussed.

Keywords Echinodermata, Holothuroidea, Holothuriidae, Holothuria , taxonomy, new species, new lectotypes.

Introduction

The Holothuriidae is one of the most diverse families of sea

cucumbers, with the bulk of this diversity in shallow, tropical

waters. Of the more than 185 species (Samyn et ah, 2005)

currently recognized, all but a handful thrive in the tropics,

predominantly on coral reefs, at less than 50 m depths. It is

therefore noteworthy that recent surveys in Australia revealed

two new deepwater species from subtropical to warm temperate

latitudes. Specimens of the two new Holothuria species were

collected from the continental slope off western and south-western

Australia during the survey SS 10/2005 by Australia’s national

science agency, the Commonwealth Scientific and Industrial

Research Organization (CSIRO), that is aiming “to characterize

benthic ecosystems off Western Australia”. This was commenced

through the Marine National Facility by the RV Southern Surveyor

in the last months of 2005. Additional specimens were discovered

in the collections of Museum Victoria. To ascertain the subgenera

to which the two new species belong, comparative morphological

and molecular studies were undertaken.

Methods

Genetic characterization was pursued by sequencing portions

of the mitochondrial 16S (large subunit) RNA and cytochrome

oxidase I (COI) genes. Ethanol-fixed tissues of the new taxa,

related species, and outgroup taxa (see Table 1 for voucher

information) were macerated, digested in DNAzol® and

proteinase K overnight, and genomic DNA isolated using

standard procedures (Meyer, 2003). Genomic DNA of most

samples was cleaned using the Qiagen polymerase chain

reaction (PCR) cleanup kit, following manufacturer’s protocols,

except that cleaned DNA was resuspended in TE buffer. Qiagen

cleanup helped eliminate problems with inhibition prevalent in

holothurian samples.

An approximately 1120 bp long (1119 bp in H. nigralutea

G255) section of the large subunit of the mitochondrial ribosome

RNA gene ( 16S) was amplified with a pair of overlapping primers.

16Scl (TACCTT[T/G]TGTAT[T/A]ATGG[T/A]TTAAC ) and

16Sc2 (TGATTATGCTACCTTNGCAC) (designed new)

amplified 678 bp, and 16SAR (CGCCTGTTTATCAAAAACAT)

and 16SBR (GCCGGTCTGAACTCAGATCACGT) (Palumbi,

1996), amplified 510 bp in H. nigralutea (G255). A 651 bp length

of the mitochondrial cytochrome oxidase subunit 1 gene was

amplified with primers COIeF (ATAATGATAGGAGGRTTTGG)

COIeR (GCTCGTGTRTCTACRTCCAT) (Arndt et al„ 1996).

PCR products were sequenced at the University of Florida’s ICBR

center. Electropherograms were edited in Sequencher, aligned

with Clustal X, and adjusted by eye. Sequences are deposited in

GenBank (see Table 1 for GenBank and voucher information).

Sequence data from the two gene regions were analyzed as a

P. Mark O’Loughlin, Gustav Paulay, Didier VandenSpiegel and Yves Samyn

single concatenated dataset. Parsimony trees were generated by

PAUP (version 4, Swofford, 2003), with 100 bootstrap replicates.

Bayesian analyses were run using Mr. Bayes (version 3.1.2,

Ronquist and Huelsenbeck, 2003), with MC 3 , GTR-I-Gamma, an

uninformative prior, for 10 million generations. GTR-I-Gamma

was chosen as the simplest model of evolution that fitted the data,

using the Akaike Information Criterion as implemented by the

program Modeltest 3.6 (Posada and Crandall, 1998), for each

gene region as well as for the combined sequences. Indels were

included in the analysis. There was no evidence for pseudogene

sequences in any of several hundred specimens of Holothuria

sequenced to date; all reads were clean and unambiguous.

For scanning electron microscopy (SEM), ossicles were

cleared of associated soft tissues in commercial bleach. They

were then air-dried, mounted on aluminium stubs, coated

with gold, and observed with a JEOL JSM-6480LV scanning

electron microscope.

Abbreviations for institutions are: MNHN— Musee national

d’Histoire naturelle, Paris; NMV —Museum Victoria, Australia;

RB INS— Royal Belgian Institute of Natural Sciences; UF—

Florida Museum of Natural History; UH— Zoologisches

Museum, Universitat Hamburg; UM— University of Murcia,

Spain; USNM— United States National Museum of Natural

History, Smithsonian Institution, Washington.

Specimen registration number prefixes are: MNHN EcHh;

NMV F; RBINS IG; UF E; UH E; UM HO; USNM E.

Table 1. Specimens sequenced. GenBank accession numbers given for gene regions.

Voucher

Extraction

Species

Locality

16Sc

16SAR

COIe

NMV F94742

N10

Stichopus ocellatus

Papua New Guinea

EU220793

EU220814

UF E4834

G188

Actinopyga obesa

Hawaii

EU220794

EU220815

UFE4901

N82

Bohadschia sp. nov.

Hawaii

EU220795

EU220816

UF El 595

G80

H. excellens

Palau

EU220796

EU220817

NMV FI 10524

G257

H. austrinabassa

W Australia

EU220797

EU220818

UFE4480

G200

H. forskali

Portugal

EU220798

EU220819

UFE4831

G186

H. atra

Hawaii

EU220799

EU220820

UFE4460

G175

H. grisea

Florida

EU220800

UF E3359

G247

H. kefersteini

Panama

EU220801

UF E4877

G259

H. mexicana

Belize

EU220802

EU220821

UF E4822

G230

H. floridana

Florida

EU220803

EU220822

NMV FI 20437

N120

H. nigralutea

W Australia

EU220804

EU220823

NMV FI 11 290

G255

H. nigralutea

W Australia

EU220805

EU220824

UF E3644

H. edulis “brown” form

Cocos-Keeling

EU220806

EU220825

UF E2065

J292

H. edulis typical form

Oman

EU220807

EU220826

UF E4987

K140

H. edulis fuschia form

Philippines

EU220808

EU220827

UF E4746

G104

H. edulis typical form

Guam

EU220809

EU220828

UF E3884

J282

H. edulis grey form

Okinawa

EU220810

EU220829

UF E3882

J296

H. edulis grey form

Okinawa

EU220811

EU220830

UF E325

G50

H. signata

Rangiroa

EU220812

EU22083 1

UF E329

G55

H. signata

Rangiroa

EU220813

EU220832

Table 2. Characters distinguishing H. ( Panning othuria) austrinabassa O’Loughlin sp. nov. and H. (Panningothuria) forskali Delle Chiaje

Characters

H. austrinabassa

H. forskali

Body colour

Grey-brown, small brown spots

Black to dark brown

Papilla tubercles

Distinct, ocellate, off-white

Same colour as body wall

Tables in body wall

Abundant, fully developed

Sparse to absent, reduced form

Dorsal table discs

> 50 pm wide

< 50 pm wide

Spire of tables

Always fully developed

Rarely fully developed

Papillae rods

Unbranched rods absent

Unbranched rods present

Tentacle tables

Present, reduced form

Absent

Tube feet

Spinous rods present

Spinous rods absent

Distribution

W and S Australia

NE Atlantic, Mediterranean Sea

New Holothuria species

Figure 1. a, live Holothuria (Panningothuria) austrinabassa O’Loughlin sp. nov, from Western Australia, off Perth (380 mm long;

NMV FI 10523; photo by Karen Gowlett-Holmes). b, preserved H. ( Panningothuria ) austrinabassa, from Western Australia, off Albany

(250 mm long; tentacles at right; NMV F120438; photo by David Staples), c, d, preserved holotype of H. (Panningothuria) austrinabassa,

from Victoria, off Portland (170 mm long; oral end left; NMV F120447; photos by David Staples): c, dorsal view; d, ventral view, e, live

H. ( Panningothuria ) forskali Delle Chiaje, in aquarium in Mons, Belgium (130 mm long; photo by Didier VandenSpiegel). f, live

H. (Panningothuria) forskali , from south of France, off Banyuls, showing expulsion of cuvierian organ tubules (photo by Didier VandenSpiegel).

P. Mark O’Loughlin, Gustav Paulay, Didier VandenSpiegel and Yves Samyn

Figure 2. Holothuria (Panningothuria) austrinabassa sp. nov. (SEM of ossicles from NMV F120447 and NMV F120438). A, dorsal body wall;

B, anal body wall; C, ventral body wall; D, tentacles; E, madreporite; F, tube feet; G, papillae.

New Holothuria species

Figure 3. Holothuria (Panningothuria) forskali Delle Chiaje, 1823 (SEM of ossicles from HO-1854). A, oral body wall; B, anal body wall;

C, tube feet; D, dorsal papillae; E, tentacles.

P. Mark O’Loughlin, Gustav Paulay, Didier VandenSpiegel and Yves Samyn

Figure 4. Bayesian phylogram of species studied together with selected outgroup taxa, with posterior probability values (10 million generations,

GTR-I-Gamma, and uninformative prior) above branches, and parsimony bootstrap values (100 replicates) below.

New Holothuria species

Holothuria (Panningothuria) austrinabassa O’Loughlin sp.

nov.

Figures 1-4, Tables 1, 2.

Material examined. Holotype: Australia, Victoria, 27 miles SW of

Portland, approx. 39°S, 141°E, 293-329 m, Aquarius, M. Gomon and

R. Plant, May 1979, NMV F120447.

Paratypes: Type locality and date, FI 09370 (2).

Other material. Western Australia, Southern Surveyor,

Nov/Dec 2005, SS10/2005 stn 90, off Abrolhos Is, 389-407 m, F110525

( 1 ); SS 1 0/2005 stn 78, off Jurien Bay, 414-^40 1 m, FI 1 0524 (3); SS 1 0/2005

stn 6, off Two Rocks (Perth), 329-370 m, F110523 (2); SS10/2005 stn 32,

off Bald I. (Albany), 728-710 m, FI 11301 (1); SSI 0/2005 stn 34, off Bald

I., 431—408 m, FI 11286 (2); FI 10526 (2); SS 10/2005 stn 39, off Bald I.,

97-99 m, FI 2043 8 (1); off Cervantes, 30°16’ S, 114°30’ E, 600-800 m,

8 Feb 1991, F120441 (2); Great Australian Bight, 33°19’ S, 127°24’ E,

300-3 10 m, 27 Feb 1976, F120442 (1); SouthAustralia, SW of Beachport,

37°49’ S, 139°45’ E, 24 Dec 1981, F120439 (1); Victoria, 20.5 miles S of

Cape Nelson, 403 m, 10 Mar 1977, FI 20440 (1).

Comparative material examined. Holothuria (Panningothuria)

forskali Delle Chiaje, 1823. NE Atlantic Ocean, Portugal, Algarve,

Estrajada, 20 m, between rocks, UM HO-1854 (1).

Description (preserved specimens ). Body up to 250 mm long,

up to 70 mm wide (F120438); elongate, not tapering from mid-

body, rounded anteriorly and posteriorly, oval in transverse

section, longitudinal, deep, mid-ventral furrow frequently

present. Body wall firm-leathery, up to 20 mm thick (FI 2043 8).

Dorsal and lateral body surface pustulose, wrinkled; tubercles

scattered irregularly dorsally and laterally, flat, ocellate, “wart-

like”, oval to round, variable size, up to 2-10 mm across,

sometimes contiguous, with papillae extending as small nipple-

like projections, 1 mm high 0.5 mm wide, 3-12 mm apart,

lacking ampullae. Ventral surface soft, pustulose, wrinkled, tube

feet hard to discern, arranged in very irregular, scattered, paired

series along ventral radii, about 5 mm apart (FI 10524), tube feet

lacking ampullae. Mouth ventral, surrounded by irregular collar

of about 50 inconspicuous oral papillae evident only in largest

specimen (F120438); tentacles 20, peltate, with long, thin,

tubular tentacle ampullae extending off calcareous ring plates,

subequal, up to 25 mm (F109370) long. Anus terminal, lacking

anal teeth. Left dorsolateral radial plate of calcareous ring 7 mm

wide 5 mm high, with 4 anterior points, posterior margin with

shallow rounded indentation. Left dorsolateral interradial plate

3 mm high, 3 mm wide, anterior spire, posterior margin with

rounded indentation (FI 10526). With single dorsal stone canal/

madreporite, stone canal 1 mm long with attached madreporite

2 mm long (F109370), to stone canal 2 mm long with attached

madreporite 3 mm long (F120441, F120442, F120438). With 1

or 2 sac-like polian vesicles, 12 mm (FI 10526) to 33 mm

(F120441) long, narrowed distally ; 2 polian vesicles in holotype,

30 and 15 mm long. Longitudinal muscles flat, broad, thin

median groove, dorsal bands up to 12 mm wide, ventral bands

up to 30 mm wide (F120438). Gonadal tubules long, thin,

multiple branching, extending to mid-body. Respiratory tree

extending to anterior end. Cuvierian organ present, tubules up to

25 mm long, 1.5 mm in diameter, not branched. Gut contents

calcareous detritus, fragments up to 10 mm long.

Ossicles. Dorsal body wall with numerous tables only; tables

variable in size, variable in form of disc and spines; disc

52-72 pm in diameter, with 4—8 perforations, with alternating

narrow and wide perforations that give slightly angular, quadrate

aspect to disc, sometimes with fine spinelet at edge; spire with 4

pillars, typically 40 pm high (including spines), single cross-

beam, crown with conspicuous spines that may extend beyond

disc margin, these spines variable in length and form, up to

32 pm long, straight, curved, forked, with side branch. Dorsal

papillae with tables, perforated plates, spinous spherical bodies;

tables as for body wall, but some larger, with discs to 96 pm

across, spires up to 64 pm high; plates irregularly rectangular (up

to 144x128 pm) to narrowly oval (184x80 pm), plates formed

around thick central rod, with large perforations centrally with

angular edges and smaller perforations marginally with angular

edges, and bluntly spinous marginal edge; reticulate spinous

spherical body at apex of papilla, 320 pm wide. Ventral body

wall with tables only, tables similar in form to dorsal ones, but

often smaller, discs to 48 pm wide only, spire to 32 pm high only.

Tube feet with endplates, support plates, support rods; endplates

irregularly oval, up to 600 pm long, of complex form, partly

single-layered plate with small perforations or mesh-like, partly

with incomplete mesh-like secondary layering; support plates

more elongated and more finely perforate than in papillae, up to

200 pm long; support rods rare, thick, curved, with some thick

spines on outer edge, up to 120 pm long. Body wall around anus

with tables and rods; tables as dorsally, but many larger, disc to

80 pm wide, spire 48 pm long; rods rare, thick, bent, with rugose

spinous surface, up to 552 pm long. Tentacles with rods, reduced

tables; rods thick to thin, rarely with terminal perforations, rarely

branching, with thick spines, up to 652 pm long; tables irregular,

mostly lacking a spire, discs 48-80 pm wide, spire up to 24 pm

long if present, disc with 4—18 perforations, disc variably with

bluntly spinous margin. Stone canal/madreporite with massed

irregular rods, some branched, some branches anastomosing to

form perforations, some with irregularly perforated mesh.

Tentacle ampullae, polian vesicles, gonad tubules,

respiratory trees, longitudinal muscles, circular muscles, wall

of cloaca and cuvierian organ devoid of ossicles.

Colour. Colour (live): background colour grey dorsally and

dorsolaterally, yellowish laterally, and off-white ventrally. Dorsal

and lateral tubercles white “wart-like” flat papillae cones with

green margin and small dark central spot. Body with grey -brown

spots in addition to dark papillae spots. Colour (preserved):

background colour grey -brown dorsally and dorsolaterally, brown

to pale brown ventro-laterally and ventrally. Tubercles off-white

with small dark brown or off-white central papilla. Body with

scattered grey -brown spots in addition to papillae spots. Tube feet

similar colour to body surface. Tentacles yellow-brown. Coelomic

wall with closely paired series of radial dark spots radially, spots

scattered interradially, not associated with papillae or tube feet.

An exceptionally large specimen (F120438) has extensive, brown,

dorso-lateral patches, and papillae not conspicuously ocellate.

Distribution. Australia, Western Australia, Abrolhos Is (29°S),

to Victoria, Portland (39°S, 141°E); southern continental slope,

97-800 m.

Etymology. From the Latin austrinus (southern) and bassus

(deep), referring to the unusually high latitude and deep

occurrence for the genus (feminine).

P. Mark O’Loughlin, Gustav Paulay, Didier VandenSpiegel and Yves Samyn

Remarks. The new species is assigned to Holothuria Linnaeus,

1767, and provisionally referred to the subgenus Panningothuria

Rowe, 1969, as diagnosed in Rowe (1969). Rowe (1969) erected

the monotypic sub-genus Panningothuria for Holothuria

forskali Delle Chiaje, 1823, the principal diagnostic character

being the sparse presence in the body wall of very reduced

tables only. Molecular data (discussed below) indicate that

H. ( Panningothuria ) austrinabassa sp. nov. and

H. (Panningothuria) forskali are sister species. Fully developed

tables are abundant in the body wall of H. austrinabassa sp.

nov., but reduced tables, similar to those in H. forskali, are

present in the tentacles. Both species lack buttons and rosettes

in the body wall. Rowe (1969) also noted a collar of oral papillae

in H. forskali. An inconspicuous irregular collar is evident only

in the largest of the H. austrinabassa specimens. It is premature

to either raise Panningothuria to generic status or create a

synonymy (discussed below).

Types were not designated for Holothuria forskali Delle

Chiaje, 1823, and the author of the species referred to the

image of an undescribed species illustrated by Forsskal (1776).

Koehler (1921) stated that the two characters that distinguish

H. forskali amongst Mediterranean species are the very dark

colour and presence of a cuvierian organ, although other

Mediterranean species also have a cuvierian organ. Koehler

(1921) also noted the white papillae, although not all specimens

of H. forskali have white papillae. All three characters are true

of the specimen examined here and judged to be H. forskali

(UM HO-1854).

H. austrinabassa resembles H. forskali in several

morphological characters, such as: maximum length of 25 cm

(H. forskali in Koehler, 1921); well-developed tuberculated

papillae dorsally and laterally; collar of inconspicuous oral

papillae; single dorsal stone canal and madreporite (pers.

comm, for H. forskali by Giomar Helena Borrero Perez); tables

the only ossicles in body wall; stout cuvierian tubules.

VandenSpiegel et al. (1995) noted and illustrated three-

dimensional, irregularly spherical, mesh-like, “bud-supporting

ossicles” for H. forskali. Similar ossicles are present in the

papilla apices of H. austrinabassa. Both species occur at

exceptional depths for holothuriids. Perez-Ruzafa et al. (1987)

reported H. forskali from the Mediterranean at depths of

0-193 m, and the Canary Is at a depth of 348 m. H. austrinabassa

has been taken as deep as 800 m. Sequence data indicate significant

separation of these sister species (discussed below). Significant

morphological differences also are detailed in Table 2.

Table 3. Characters distinguishing H. (Halodeima) nigralutea O’Loughlin sp. nov. and H. (Halodeima) edulis Lesson

Characters

H. nigralutea

H. edulis

Colour

Ventral black stripe

Dark brown spots

Depth

Discontinuous black over yellow

Present

Only at papillae and tube feet

100 m, on continental slope

Dorsal black, ventral fuschia (red); or dorsal “grey”, ventral cream

Absent

Additional to papillae and tube feet

0-20 m (Rowe and Gates, 1995)

Table 4. Characters distinguishing H. ( Halodeima ) signata Ludwig and H. ( Halodeima ) edulis Lesson

Characters

H. signata

H. edulis

Colour

Length

Tables

Rosettes

Habit

Grey brown with cream spots

Mostly 5-15 cm

Narrower spire (10-15 pim at narrowest)

Mostly simple (mostly 2-5 perforations)

Cryptic in reef during day

Dorsal black, ventral fuschia (red); or dorsal “grey”, ventral cream

Mostly 10-25 cm

Broader spire (15-20 jim at narrowest)

Simple to complex (2-15+ perforations)

Exposed on sand during day

Table 5. Pairwise uncorrected p-distances among specimens of H. edulis complex

1. H. nigralutea N 1 20

2. H. nigralutea G255

0.002

3. H. edulis brown N3

0.028

4. H. edulis typical J292

0.024

0.010

5. H. edulis fuschia K140

0.013

0.011

0.023

0.016

6. H. edulis typical G104

0.011

0.010

0.024

0.021

0.008

7. H. edulis grey J282

0.015

0.013

0.024

0.018

0.005

0.010

8. H. edulis grey J296

0.013

0.011

0.023

0.016

0.003

0.008

0.005

9. H. signata G50

0.062

0.060

0.058

0.057

0.058

0.055

10. H. signata G55

0.066

0.065

0.066

0.063

0.062

0.063

0.060

0.023

New Holothuria species

Figure 5. a, live paratype of Holothuria (Halodeima) nigralutea O’Loughlin sp. nov, from Western Australia, off Point Cloates (220 mm long;

NMV FI 11290; photo by Karen Gowlett-Holmes). b, preserved holotype of H. ( Halodeima ) nigralutea, from Western Australia, off Point Cloates

(148 mm long; upper dorsal, lower ventral; oral end right; NMV F120437; photos by David Staples), c, lectotype of Holothuria edulis Lesson,

1830 from Indonesia, Moluccan Is (160 mm long; MNHN EcHh 543; upper dorsal, lower ventral; photos by Yves Samyn). d, live H. ( Halodeima )

edulis, from Japan, Okinawa (not collected, photo by Gustav Paulay). e, live H. ( Halodeima ) edulis, from northern Australia (not collected, photo

by Neville Coleman), f, live atypical “grey” form of H. ( Halodeima ) edulis, from Japan, Okinawa (UF E3882, photo by Gustav Paulay).

P. Mark O’Loughlin, Gustav Paulay, Didier VandenSpiegel and Yves Samyn

Figure 6. Holotlmria (Halodeima) nigralutea O’Loughlin sp. nov. (SEM of ossicles from NMV F111290). A, dorsal body wall; B, ventral body

wall; C, anal body wall; D, tube feet; E, tentacles; F, respiratory trees; G, madreporite.

New Holothuria species

Figure 7. Holothuria (Halodeima) edulis Lesson, 1830 (SEM of ossicles from NMV FI 13599). A, dorsal body wall; B, anal body wall; C, oral

body wall; D, ventral body wall; E, tentacles; F, tube feet; G, madreporite.

P. Mark O’Loughlin, Gustav Paulay, Didier VandenSpiegel and Yves Samyn

Holothuria (Halodeima) nigralutea O’Loughlin sp. nov.

Figures 4-7, Tables 1, 3-5.

Material examined. Holotype: Western Australia, off Point Cloates,

22.86° S, 113.51° E, 100 m. Southern Surveyor, SS10/2005 stn 135,

9 Dec 2005, NMV FI 20437.

Paratypes: Type locality and date, FI 11290 (1); Dampier, 95-90 m,

19.79°S, 115.47°E, SS05/2007 stn 29, 12 Jun 2007, F146582 (1).

Comparative material examined. H. ( Halodeima ) atra Jager, 1833.

Fiji, F113579 (1); New Caledonia, Noumea, F95939 (1); N Australia,

Gulf of Carpentaria, E Bremer I., F112194 (1).

H. ( Halodeima ) edulis Lesson, 1830. Lectotype, Indonesia,

Moluccan Is, Lesson and Garnot, 1825, MNHN EcHh 543; N Australia,

Gulf of Carpentaria, Bremer I., F95094 (1); Great Barrier Reef, Heron

I., F95093 (1); F95095 (1); FI 13599 (1); Pacific Ocean, Wake Atoll,

UF E4670.

Description ( preserved specimens ). Holotype 155 mm long, up

to 35 mm high, up to 40 mm wide; paratype 145 mm long, up

to 30 mm high, up to 45 mm wide; body length/width ratio less

than 4; oval in tranverse section, not tapering from mid-body,

rounded anteriorly and posteriorly; live body form short, squat,

narrow anterior neck, narrow posterior tail (see photo of

paratype). Body wall thick, soft-leathery, 2-5 mm thick,

wrinkled, surface smooth to slightly rugose. Mouth ventral,

surrounded by an irregular collar of about 60 inconspicuous

papillae. Tentacles 20, peltate, with long thin tubular ampullae

extending off calcareous ring plates, subequal, up to 20 mm

long. Anus terminal, lacking anal teeth, with few anal papillae

dorsally, with paired anal tube feet ventrally. Dorsal and lateral

papillae inconspicuous in size but conspicuous in colour, flat or

nipple-like, about 0.5 mm diameter, scattered irregularly,

2-10 mm apart (holotype), lacking ampullae. Tube feet scattered

irregularly over ventrum, 1-5 mm apart (holotype), retracted or

slightly exposed, about 0.4 mm diameter, lacking ampullae.

Left dorsolateral radial plate of calcareous ring 12 mm wide

and 6 mm high, with 4 anterior points, posterior margin with

shallow rounded indentation. Left dorso-lateral interradial

plate 4 mm high and wide, anterior margin with spire, posterior

margin with rounded indentation. Tuft of small stone canals/

madreporites on each side of dorsal mesentery, extending freely

in coelom, up to 25 per tuft, each up to 3 mm long, some stone

canals branched. Holotype with 4 sac-like polian vesicles, up to

5 mm long, 1 branched; paratype with 4 tubular, thin, polian

vesicles, 3, 8, 10, 25 mm long, 2 branched from common base.

Longitudinal muscles flat, broadly attached, with narrowly free

edges, up to 5 mm wide dorsally, up to 15 mm wide ventrally.

Gonad tubules long, thin, multiple branching, extending half of

body length. Respiratory trees extending to anterior end.

Cuvierian organ absent. Gut contents calcareous detritus, with

fragments up to 6 mm long.

Ossicles. Dorsal body wall with numerous rosettes, few

tables; tables variable in form and size, 48-64 pm, commonly

56 pm long; disc reduced, typically 28 pm wide, smooth with

a single central perforation; spire typically 20 pm wide, with

4 pillars united by a single cross-beam; crown widely spinous,

typically 40 pm wide, with 16-20 large spines; rosettes

plate-like, variable in form, with obtusely angular branches

arising from primary rod, 24-48 pm long, frequently 2 small

terminal and 2 large, lateral perforations (frequently with

transverse bridging connection), but with up to 8 perforations.

Papillae with rods, some mesh-like ossicles; rods up to

160 pm long, variably bluntly spinous, curved, with some

distal perforations; papilla apex with irregular small rods

resembling those in madreporite, some anastomosing to form

an irregular open mesh. Ventral body wall with numerous

rosettes, fewer tables; tables same as dorsal; rosettes larger

than dorsally, up to 10 perforations, up to 40 pm long. Tube

feet with endplates, perforated plates, tables, rosettes;

endplates multilayered, up to 480 pm wide; perforated plates

smooth, thin, subrectangular, formed from primary rod with

perpendicular lateral branches, up to 128x104 pm, typically

with 2 large lateral perforations mid-rod; tables and rosettes

as in ventral body wall. Oral body wall with rosettes, tables,

rods; tables similar to dorsal; rosettes frequently larger than

dorsal ones, up to 56 pm long; rods same as in tentacles, up

to 184 pm long. Anal body wall with rosettes, few tables,

some rods; tables and rosettes as in ventral body wall; rods

frequently with lateral branches, branches frequently joined

to form lateral and terminal perforations, rods up to 88 pm

long, intergrade with rosettes. Tentacle rods up to 344 pm

long, frequently curved, thick to thin, coarsely or finely

spinous, spines close or sparse, rare branches, with rare,

mostly terminal perforations. Stone canal/madreporite

ossicles massed irregular rods, some branched, some

anastomosing to create perforations, some with an irregular,

perforated mesh, up to 134 pm long. Respiratory tree with

numerous irregular rods, up to 160 pm long, frequently with

small node in middle of rod, and with branches at ends and

node, variable in length and form, some branches joined to

create terminal or lateral perforations.

Ossicles absent from tentacle ampullae, polian vesicles,

gonad tubules, longitudinal muscles, circular muscles, and

wall of cloaca.

Colour. Live colour (paratype): black on pale yellow; with

scattered, small, brown spots at papillae. Preserved colour:

variable pattern of black over pale yellow; with small red-brown

spots around papillae and tube feet, spots irregularly distributed

all over body, such spots always associated with papillae or

tube feet; interior body wall with scattered, superficial, irregular

black spots, that are not associated with papillae or tube feet.

Distribution. Off Point Cloates, Western Australia; 100 m.

Etymology. From the Latin niger (black) and luteus (yellow),

referring to the black and yellow live colour (feminine).

Remarks. This species is assigned to Holothuria Linnaeus,

1767, and provisionally referred to the subgenus Halodeima

Pearson, 1914, as diagnosed in Rowe (1969). Samyn et al.

(2005) suggested that Halodeima might need to be raised to

generic rank, but added that “revision of Holothuriidae will

depend on further comparative taxonomic studies as well as on

more detailed phylogenetic analyses before any of the changes

proposed can be solidified into a new classification”. This work

is progressing, and it remains premature to raise Halodeima to

generic status or erect a new genus (see below).

New Holothuria species

The type species of Halodeima Pearson, 1914 is Holothuria

atra Jager, 1833 (by original designation). Rowe (1969)

considered the following species to constitute Halodeima :

H. chilensis Semper, 1868;//. edulis Lesson, 1830 -,H.floridana

Pourtales, 1851; H. grisea Selenka, 1867; Stichopus kefersteini

Selenka, 1867; H. mexicana Ludwig, 1875; H. pulla Selenka,

1867; Halodeima stocki Cherbonnier, 1964. Pawson (1978)

added H. manningi. Samyn (2003), Pawson (1995) and Paulay

(1989, 2003) also listed H. signata Ludwig, 1875 as a valid

species of Halodeima.

Molecular data indicate that H. ( Halodeima ) nigralutea is

most closely related to H. ( Halodeima ) edulis Lesson (see

below), and the morphology of these species is closely similar.

Distinguishing characters are listed in Table 3. In describing

his new species Lesson (1830) referred principally to its

widespread commercial use, but he noted: cylindrical rounded

thin slightly rugose sinuous form; ventral cover of irregularly

distributed papillae; upper body deep sooty black colour;

under body and sides pleasant red colour, speckled with black

spots. Cherbonnier (1951) gave a more detailed description

and illustrated the ossicles of the lectotype of H. edulis. He

noted it had 6 polian vesicles, ranging in size from large to

very small. The specimens of H. edulis examined in this study

are in accord with these features. Feral and Cherbonnier (1986)

illustrated live colour (p. 82 only).

Both specimens of H. nigralutea have ossicles in the

respiratory trees. No ossicles were encountered in the respiratory

tree of the lectotype of H. edulis. Ossicles were noted in only 1

of 7 specimens of H. edulis from northern Australia (NMV

F95095), as they were in a specimen from Wake Atoll (UF

E4670) (GP). Presence or absence of respiratory tree ossicles in

H. edulis appears to be a variable character.

Figure 8. a, preserved lectotype of Holothuria signata Ludwig, 1875 from Tahiti, French Polynesia (100 mm long in Ludwig, 1875; UH E2638;

photo by Peter Stiewe). b, live H. ( Halodeima ) signata, from Moorea, French Polynesia (UF E4986; photo by Gustav Paulay). c, close-up of

preserved lectotype of H. signata (UH E2638). d, close-up of live H. ( Halodeima ) signata (UF E4986).

P. Mark O’Loughlin, Gustav Paulay, Didier VandenSpiegel and Yves Samyn

Figure 9. Holothuria (Halodeima) signata Ludwig, 1875 (SEM of ossicles from UF 173). A, dorsal body wall; B, ventral body wall; C, anal body

wall; D, papillae; E, tube feet; F, tentacles; G, madreporite.

New Holothuria species

Holothuria (Halodeima) signata Ludwig, 1875

Figures 4, 8, 9, Tables 1, 4, 5.

Holothuria signata Ludwig, 1875: 99, pi. V7, fig. 36.— Lampert,

1885: 64,-Theel, 1886: 222-223.-Ludwig, 1889-92: 330,-Lampert,

1896: 53,-Ekman, 1926: 438, fig. Dl.

Holothuria edulis.— Ludwig, 1899: 559-560.— Domantay, 1933:

63 (part, H. signata treated as a junior synonym of H. edulis ).

Holothuria ( Halodeima ) signata.— Paulay, 1989: 10, 27.— Paulay,

2003: 577.— Pawson, 1995: 188,-Samyn 2003: 35.

Holothuria sp. (?) signata— Erhardt and Baensch, 1998: 1088.

Material examined. Lectotype (UH E2638 here designated): Pacific

Ocean, Tahiti, UH E2638.

Other material. Mariana Is, Guam I., Asan, reef slope, in crevice

on sand, night, 22 Jul 1992, RBINS IG30817; Orote Peninsula, south

side, under rubble, 15-25 m, 22 Aug 1994, UF E173; Piti Bombholes,

reef flat, moat, or lagoon, 5-10 m, 19 Jul 2003, UF E4713; Saipan I.,

outside Managaha Survey Site, forereef, under rubble, 8-12 m, 5 Jan

2003, UF E3447; Tinian I., Unai Babui, forereef, under rocks on sand,

15 m, 12 May 2005, UF E4640.

Niue I., off Alofi wharf, outer reef slope, on reef rock, 14 m,

20 May 1986, UFE1333; Namukulu, Limu Reef flat, pools, undersides

of rocks, 0-5 m, 7 Oct 1991, UF E1406; reef flat at Tuapa, <10 m from

shore, 27 Aug 1986, UF E1886; off Alofi wharf, outer reef slope,

12-15 m, 9 Mar 1986, UF E1663.

Cook Is, Rarotonga I., Nikao, outer fringing reef, exposed in

shallow pools, 20 May 1984, USNM E37966; Mauke I., Taunganui

Harbor, 15-20 m, 3 Dec 1984, USNM E37968; Mauke I., Taunganui

Harbor, 12 Dec 1984, UF E1831.

Society Is, Tahiti I., Tautira, in coral rubble zone, under dead coral

blocks, 0.5-1. 5 m, 3 Sep 1984, UF E4999; Moorea I., NE corner of

Moorea, Aroa, 200-300 m E of channel, 6-15 m, 7 May 2006, UF

E5015; Moorea I., barrier reef between Cook’s and Opunohu Bays

(Vaipahu), outer part of barrier reef, within l-60m of reef crest,

0-2 m, 3 Jul 2006, UF E4986.

Tuamotu Is, Rangiroa Atoll, off Hotua Ura Motu, ca. 1 km W. of

Avatoru Pass, outer reef slope, under rocks, 15-21 m, 10 Oct 2001, UF

E325; Rangiroa Atoll, ca. 1 km S of NW point of atoll, off Motu

Maeherehonae, outer reef slope, under rocks, 6-12 m, 10 Nov 2001,

UF E329; Rangiroa Atoll, ca. 2 km S of NW point of atoll, at

southernmost storm lock zone, off Motu Maeherehonae, outer reef

slope, exposed, 3-12 m, 26 Oct 2001, UF E591.

Pitcairn Is, Henderson I., outer reef slope off North Beach, 15 m,

17 May 1987, USNM E50251; outer reef slope off Northwest Beach,

10-14 m, 15 May 1987, USNM E50252; Oeno Atoll, lagoon near south

shore of main island, 2.5 m, 28 May 1987, USNM E50253; Pitcairn I.,

8-20 m. May 1987, USNM E50254.

Description (anatomy based on UFE173 only). Cylindrical, >5

times as long as wide (14.5 cm x 2.5 cm in UF E173), with

rounded anterior and posterior; anus terminal, mouth ventral;

body wall smooth, with velvety texture provided by dense layer

of table crowns arranged right beneath the surface, 0.5-2 mm

thick, thicker dorsally than ventrally. Interior of body wall off-

white, with conspicuous, large, scattered, black spots that do

not positionally correspond to location of tube feet. Ventral and

dorsal tube feet in rough rows, but spread out, all small, not

elevated on tubercles. Pedicels with well developed terminal

disc; dorsal tube feet also with terminal discs, but narrow,

reduced. 2 stone canals and madreporites on left side, 4 on right

side; single, ampulliform, 11 mm long, polian vesicle ventrally.

Gonad on left side. Ring canal 9 mm posterior to calcareous

ring. 18-21 peltate oral tentacles (UF E173 - 21, UF E325 - 18).

No specialized perianal tube feet. No cuvierian tubules.

Longitudinal muscles narrow, bifid, attached only medially,

with broad free margins.

Dorsal body wall with abundant tables and sparser rosettes.

Tables with well developed crown of maltese cross with double

ring of 8 spines typical of species group; spire elongate,

comprised of 4 pillars joined at ends and by mid-level cross

beam; base of table with smooth knob, lacking disk. Tables

1.75+/-0.10 times as long as wide, 51.5+/-2.3 um (N-10, range:

47.5-55 um) long, 29.5+/-2.7 um (N-10, range: 25-35 um) in

diameter (at crown). Rosettes usually simple, with two parallel

perforations, one of these subdivided in some, with 1 or 2

additional, terminal perforations developed in some, rarely

more complex. Respiratory tree with abundant, thin, spiny

rods. Longitudinal muscles, circular muscles, polian vesicles,

and tentacle ampullae without ossicles.

Colour. In life: greyish-brown, somewhat lighter ventrally than

dorsally; with small, round, cream to light tan spots surrounding

each pedicel and papilla, both dorsally and ventrally. Tentacles

yellowish to cream. Pedicels light tan basally, like the spot

from which they arise, rapidly darkening to black-brown

terminally, but with light tan terminal disc. Papillae same.

Distribution. Oceania, at least from the Mariana Is and Niue I.

in the west, to the Pitcairn Is in the east (Paulay, 1989, 2003,

herein).

Remarks. Holothuria signata was relegated into the synonymy of

H. edulis soon after its description. Ludwig himself later (1899)

considered his species synonymous with H. edulis, based in part

on Lampert’s (1896) suggestion that they may be conspecific.

Most literature records subsequent to the original description

(such as Lampert, 1896) are secondary citations, or records of

specimens that, on the basis of their description, are referrable to

Holothuria edulis. The only records of additional specimens of

H. signata are Paulay’s (1989, 2003) records from the Pitcairn

and Mariana Is, although little information was provided in those

papers, and Erhardt and Baensch’s (1998) record.

During the preparation of this paper, we re-examined the

description and, remotely, the type specimen of H. signata and

were able to confirm its identity, as well as its distinctiveness

from H. edulis. Ludwig (1875) clearly describes the unusual and

unique colour pattern of this species, a pattern that, albeit faded,

is still discernible in the lectotype today. Ludwig also illustrates

the body wall tables, which are distinctly narrower than those of

H. edulis. Finally, the identity of the species is also suggested on

biogeographical grounds. Only two species of Holothuria

( Halodeima ) are known from French Polynesia, the type locality

of H. signata: H. signata and the quite different H. atra. As far as

we know H. edulis does not reach this area. One of us (GP) has

studied the holothurians of French Polynesia on several occasions

over the past 25 years, including a 2-month survey in 2006 of

Moorea I. (just 17 km from Tahiti), and has never seen H. edulis

in the area. In contrast H. signata is fairly common there.

Holothuria signata is a relatively small species that

conceals itself during the day within the reef matrix (including

under rocks), emerging at night to feed on the reef surface. Its

P. Mark O’Loughlin, Gustav Paulay, Didier VandenSpiegel and Yves Samyn

habit thus contrasts markedly with that of H. edulis, a day-

active, exposed animal that prefers pockets of soft sediments

within the reef, often in a lagoonal setting. The 2 species are

immediately distinguishable on colour pattern, the shape of

table ossicles, as well as genetically. Holothuria signata also

does not grow as large as H. edulis.

Discussion

The discovery of these two new holothuriid species is

noteworthy for several reasons. It shows that holothuriids are

better represented at moderately high latitudes and in deep

water than heretofore suspected. Rowe and Gates (1995)

reported numerous holothuriid species in the Tasman Sea as

far south as Lord Howe I. (32°S), Holothuria integra Koehler

and Vaney as far south on the east coast of Australia as Botany

Bay (34°S), Actinopyga echinites (Jaeger) and H. atra Jager as

far south on the west coast of Australia as Fremantle (32°S),

and H. hartmeyeri Erwe as far south as Port Lincoln on the

South Australia coast (35°S). Ludwig (1898) (see also Samyn

and Massin, 2003 for a redescription) described H. platei from

the Juan Fernandez Is (33°S). Marsh and Pawson (1993)

reported H. cinerascens (Brandt), H. arenicola Semper and

H. macroperona H.L. Clark from Western Australia, Rottnest

I. (32°S). Similarily on the east coast of Africa several

holothuriids have been reported at high latitudes. For instance

Deichmann (1948) reported H. parva from Port Edward (31°S)

and H. cinerascens from Umtwalumi (31°S). Samyn (2003,

dataset as annex in Samyn and Tallon, 2005) gives accurate

distribution maps of the species reported in the Western Indian

Ocean. H. austrinabassa occurs as far as 39°S. Rowe and

Gates (1995) reported the deepest occurrence of a holothuriid

in Australasian waters as H. uncia Rowe at Norfolk I. in the

Tasman Sea at 342-360 m. H. austrinabassa occurs to a depth

of 800 m.

Ongoing investigation into the phylogenetic relationships

of holothuriid sea cucumbers (Paulay and others, unpublished),

now covering more than 100 species in the family, identifies H.

( Panning othuria) forskali as the closest sequenced relative of

H. (Panning othuria) austrinabassa, and//. (Halodeima) edulis

as the closest sequenced relative of H. ( Halodeima ) nigralutea.

Both relationships are well supported (100/1.0 parsimony

bootstrap and Bayesian posterior probability). The evolutionary

origins of the two new species described here are markedly

different: H. austrinabassa represents an old lineage, the only

other known member of which is the northernmost holothuriid

H. forskali. In contrast, H. nigralutea is a very recent offshoot

of the shallow, tropical H. edulis complex.

Holothuria forskali, the type and only species of Holothuria

(Panningothuria) Rowe, 1969, and H. austrinabassa,

together form an isolated, deep branch in the family, suggesting

that Panningothuria may warrant generic recognition.

However, additional sampling and analysis are necessary to

resolve the deep branching order in the Holothuriidae, before

we are prepared to revise the genus level classification of the

family. The two species differ at 13% of base pairs in the

sequenced portion of 16S-C01, a level of differentiation

typical of widely divergent sister species in this family. The

relationship of these two species is intriguing, as they are the

northernmost and southernmost species of Holothuriidae,

demonstrating extreme temperate, cool water invasion, and

bipolar distribution and dispersal. Holothuriids are

predominantly tropical, shallow water forms, and only a

handful of species invade warm temperate environments.

Holothuria forskali reaches by far the highest latitude among

holothuriids, extending to at least 57°N (Global Biodiversity

Information Facility <gbif.org>) in the northeast Atlantic.

Holothuria austrinabassa is known south to 39°S. It is also

unusual in occupying the only known deep, cold water habitat.

It thus represents the southernmost, and most cold-tolerant

southern hemisphere holothuriid.

Additional morphological and genetic work is needed

to resolve whether Halodeima is monophyletic. Our

preliminary work indicates that Halodeima clusters with the

subgenera Vaneyothuria, Holothuria, Selenkothuria,

Semper othuria, and some Thymiosycia. Three well supported

clades of Halodeima are recognizable based on sequence data:

H. atra, H. mexicana-floridana-grisea-kefersteini, and

H. signata-edulis-nigralutea (fig. 4). In addition to their

unusual ossicle complement (reduced discs on tables, and

rosettes), most investigated Halodeima spp. (nigralutea,

edulis, atra, signata, floridana (Edwards, 1908, with

illustration), and mexicana (Hyman, 1955, with illustration))

have multiple madreporites, providing further morphological

evidence of their potential relationships. On the other hand,

the tables in the H. signata-edulis-nigralutea clade have a

single central disc perforation, while the tables in H. atra (see

Rowe, 1969) and H. floridana-grisea-mexicana (see Hendler

et al., 1995) have additional disc perforations.

H. ( Halodeima ) nigralutea is morphologically and

genetically closest to H. ( Halodeima ) edulis. Species in the

clade signata-edulis-nigralutea are very similar genetically,

as well as morphologically, with maximum 16S-COI sequence

divergence of 5. 5-6. 5 % between the basal H. signata and

other forms (Table 5). While//, signata is clearly differentiated,

specimens assigned to H. edulis and H. nigralutea show very

limited divergence and a more complex pattern (fig. 4). Thus

three forms are reciprocally monophyletic based on the

sequence data on hand: H. edulis from the Pacific basin

(Philippines, Okinawa, Guam), H. edulis from the Indian

Ocean (J292, N3, Oman and Cocos Keeling), and H. nigralutea,

with H. nigralutea sister to the Pacific edulis clade. Thus this

species complex appears to have undergone rapid, recent

differentiation into three forms: H. edulis in the Western

Pacific, H. edulis in the Indian Ocean, and H. nigralutea.

While Pacific and Indian Ocean populations of H. edulis look

similar, H. nigralutea has a distinct colour pattern and also

differs in other details (see above). Similar rapid speciation

has also been documented within the teatfish complex

Holothuria (Microthele) by Uthicke et al. (2004).

Several colour variants are represented among the

sequenced H. edulis specimens. G104 and J292 represent

typical forms, with a dark dorsum and a fuschia venter. K140

is a specimen that is uniformly fuschia, without the dark

dorsum. Although no live colour information is available for

it, N3 is represented by a specimen that has a distinctive colour

New Holothuria species

in pickle: brown both dorsally and ventrally, and tan laterally.

While the above represent rare colour variants, a fairly

common colour form often assigned to H. edulis was also

sequenced. This grey form (J282, J296; fig. 5f), also illustrated

in Feral and Cherbonnier (1986), is known to us from New

Caledonia (Feral and Cherbonnier, 1986), Okinawa and Mauke

(Cook Is) (GP), and Nauru (Alex Kerr, pers. comm.). It differs

from typical H. edulis in its greyer colour, lacking the fuschia

pattern of the latter, dark transverse creases, and habit of

hiding in the reef matrix during the day (at least in Okinawa,

Mauke, and New Caledonia (P. Laboute, pers. comm.)).

Although we expected this form to represent a distinct species,

there are no fixed nucleotide differences discernible within the

sequenced 16S-C01 region, between it and typical Western

Pacific H. edulis. Determining the status of this form will

require further work, but it may be an ecomorph of H. edulis.

Potentially the fuschia colour present in typical H. edulis

could be due to a UV-photo -protective pigment that may be

restricted to animals that live exposed to the sun, and is not

developed in individuals living in cryptic habitats. The other

colour morphs mentioned above were also genetically

undifferentiated from typically-coloured individuals of

H. edulis (fig. 4).

The contrasting evolutionary histories of these two high-

latitude holothurians in Australia have close parallels in other

invertebrates, most notably in cypraeid gastropods (cowries)

(Meyer, 2003). Southern and western Australia are home to a

large number of endemics, including endemic cowries. These

include radiations of Umbilia, Zoila, and Notocypraea\ all old,

divergent cowrie genera that must have evolved the ability to

live at high latitudes some time ago. The last is sister to

Cypraeovula, a temperate genus in South Africa, showing

biogeographic disjunction within the temperate zone. Extinct

Japanese Zoila indicate this genus had a bipolar distribution in

the past. In contrast the cowrie genus Cribarula has given rise to

a series of subtropical western Australian endemic forms rapidly

and in succession, much like the origin of H. nigralutea.

These and other invertebrates show that tropical species

can rapidly give rise to western Australian subtropical and

temperate endemics, but also that other cool-water elements of

this region have specialized to high latitudes a long time ago.

Acknowledgements

We are grateful to the following for their assistance: Cynthia

Ahearn (USNM; literature); Ben Boonen (formatting of

photos); Giomar Helena Borrero Perez (UM; examination of

madreporite in H. forskali-, sending material; literature); Karen

Gowlett-Holmes (live photography on Southern Surveyor)-,

Claude Massin (RBINS; literature); Angel Perez-Ruzafa (UM;

loan of H. forskali specimen; photo of H. forskali); Paul

Postiaufrom (University of Mons; providing fresh material of

H. forskali ); David Staples (NMV; photography); Peter Stiewe

(UH; providing photo of H. signata lectotype); Sarah

Thompson (NMV; initial morphological examinations).

Funding by NSF DEB-1529724 is gratefully acknowledged.

We are appreciative of the manuscript reviews by Dr T. D.

O’Hara and Dr F. W. E. Rowe.

References

Arndt, A., Marquez, C., Lambert P., and Smith, M. J. 1996. Molecular

phylogeny of eastern Pacific sea cucumbers (Echinodermata:

Holothuroidea) based on mitochondrial DNA sequence. Molecular

Phylogenetics and Evolution 6: 425-437.

Cherbonnier, G. 1951. Les Holothuries de Lesson (2 nd Note). Bulletin

du Museum National d’Histoire Naturelle, Paris series 2,

23(4): 396-401.

Deichmann, E. 1948. The holothurian fauna of South Africa. Annals

of the Natal Museum 9(2): 325-3375, pis 17-21.

Delle Chiaje, S. 1823-29. Memorie sulla storia e notomia degli

animali senza vertebre del regno di Napoli. 4 volumes. Fratelli

Fernandes, Napoli.

Domantay, J. S. 1933. Littoral Holothurioidea of Port Galera Bay and

adjacent waters. Natural and Applied Science Bulletin, Manila

3: 41-101.

Edwards, C. L. 1908. Variation, development and growth in Holothuria

floridana Pourtales and in Holothuria atra Jager. Biometrika

6(2/3): 236-301.

Ekman, S. 1926. Systematisch-phylogenetische Studien uber

Elasipoden und Aspidochiroten. Zoologische Jahrbucher -

Abteilung fur Anatomie und Ontogenie der Tiere 47(4): 429-540.

Erhardt, H., and Baensch, H.A. 1998. Meerwasser Atlas Band 4.

Wirbellose, Mergus, Melle: Germany.

Feral J.-P., and Cherbonnier, G. 1986. Les holothurides. Pp. 55-107 in:

Guille A., Laboute P., and Menou, J.-L. (eds). Guide des etoiles de

mer, oursins et autres echinoderms du lagon de Nouvelle-

Caledonie. ORSTOM: Paris.

Forsskal, P. 1776. Fistulariae species non descripta, p. 12, pi. 39 fig. A,

in: C. Niebuhr (ed.), leones rerum naturalium. Post mortem

auctoris edidit Carsten Niebuhr. Hauniae, Moller: Copenhagen.

Hendler, G., Miller, J. E., Pawson, D. L., and Kier, P. M. 1995. Sea

stars, sea urchins and allies: echinoderms of Florida and the

Caribbean. Smithsonian Institution, Washington DC: . 390 pp.

Hyman, L. H. 1955. The Invertebrates: Echinodermata. The coelomate

Bilateria. McGraw-Hill: New York. 763 pp.

Jager, G. F. 1833. De Holothuriis. Dissertatio Inauguralis. Turici.

40 pp., 3 pis.

Koehler, R. 1921. Echinodermes. Faune de France. Lechevalier:

Paris. 210 pp

Lampert, K. 1885. Die Seewalzen. Reisen im Archipel der Philippinen

von Dr. C. Semper. Wissenschaftliche Resultate, Wiesbaden.

2er Theil. IV. iii. 312 pp.

Lampert, K. 1896. Die von Dr. Stuhlmann in den Jahren 1888 und 1889

an der Ostkuste Afrikas gesammelten Holothurien. Mitteilungen

Zoologisches Museum Hamburg 13: 49-71, figs 1-3.

Lesson, R. P. 1830. Centurie zoologique, ou choix d’animawc rares,

nouveaux ou imparfaitement connus. Levrault: Paris. 244 pp., 80 pis.

Linnaeus, C. 1767. Systema Naturae, (ed. 12). Laurentii Salvii,

Holmiae 1(2): 1-1089.

Ludwig, H. 1875. Beitrage zur Kenntniss der Holothurien. Arbeiten

aus dem Zoologisch- Zootomischen Institut in Wurzburg

2:77-118, pis 6,7.

Ludwig, H. 1889-92. Echinodermen. I. Buch. Die Seewalzen. in:

Dr. H.G. Bronn’s Klassen und Ordnungen des Thier-Reichs 2(3).

460 pp., 17 pis. Winter’sche Verlagshandlung, Leipzig.

Ludwig, H.L. 1898. Holothurien. in: Ergebnisse der Hamburger

Magalhaensischen Sammelreise 1892/1893. Herausgegeben

Naturhistorischen Museum Hamburg Band 1. 98 pp., 3 pis.

Ludwig, H. 1899. Echinodermen des Sansibargebietes (in Voeltzkow,

Wissenschaftliche Ergebnisse der Reisen in Madagaskar und

Ost-Afrika in den Jahren 1889-1895). Abhandlungen der

Senckenbergischen Gesellschaft 21: 537-563.

P. Mark O’Loughlin, Gustav Paulay, Didier VandenSpiegel and Yves Samyn

Marsh, L. M. and Pawson, D. L. 1993. Echinoderms of Rottnest Island.

Pp. 279-304 in: Wells, F. E„ Walker, D. I., Kirkman, H„ and

Lethbridge, L. (eds). The Marine Flora and Fauna of Rottnest

Island, Western Australia. Volume 1. Proceedings of the fifth

International Marine Biological Workshop. Western Australia

Museum: Perth. 340 pp.

Meyer, C. P. 2003. Molecular systematics of cowries (Gastropoda:

Cypraeidae) and diversification patterns in the tropics. Biological

Journal of the Linnean Society 79: 401-459.

Palumbi, S. R. 1996. Nucleic acids II: The polymerase chain reaction.

Pp. 205-247 in: Hillis, D. M„ Moritz, C. M„ Mable, B. K„ (eds.).

Molecular systematics, 2nd edn. Sinauer Associates, Inc.:

Sunderland, MA.

Paulay, G. 1989. Marine invertebrates of the Pitcairn Islands: species

composition and biogeography of corals, molluscs, and

echinoderms. Atoll Research Bulletin 326: 1-28.

Paulay, G. 2003. The Asteroidea, Echinoidea, and Holothuroidea

(Echinodermata) of the Mariana Islands. Micronesica

35-36: 563-583.

Pawson, D. L. 1978. Echinoderm fauna of Ascension Island, South

Atlantic Ocean. Smithsonian Contribution to the Marine Sciences,

No. 2. Smithsonian Institution Press: Washington. 31 pp.

Pawson, D. 1995. Echinoderms of the tropical island Pacific: status of

their systematics and notes on their ecology and biogeography.

Pp. 171-192 in: Maragos, J. E., Peterson, M. N. A., Eldredge, L.

G., Bardach, J. E., and Takeuchi, H. F. (eds). Marine and Coastal

Biodiversity in the Tropical Island Pacific Region. Volume 1.

Species Systematics and Information Management Priorities.

East- West Center, University of Hawaii: Honolulu.

Pearson, J. 1914. Proposed reclassification of the genera Muelleria and

Holothuria. Spolia zeylanica 9(35): 163-172, pi. 26.

Perez-Ruzafa, A., Marcos, C., and Bacallado, J. J. 1987. Presencia de

Holothuria ( Panning othuria ) forskali (Echinodermata:

Holothuroidea) en las Islas Carinias. Vieraea 17: 361-367.

Posada, D., and Crandall, K. A. 1998. Modeltest: testing the model of

DNA substitution. Bioinformatics 14: 817-818.

Pourtales, L. F. 1851. On the Holothuriae of the Atlantic Coast of the

United States. Pp. 8-16 in: Proceedings American Association

Advancement Science, Fifth Meeting, Washington 1851.

Ronquist, F. and J. P. Huelsenbeck 2003. MRBAYES 3: Bayesian

phylogenetic inference under mixed models. Bioinformatics

19: 1572-1574.

Rowe, F. W. E. 1969. A review of the family Holothuriidae

(Holothurioidea: Aspidochirotida). Bulletin of the British Museum

(Natural History) Zoology 18(4): 119-170.

Rowe, F. W. E., and Gates, J. 1995. Echinodermata. Wells, A. (ed.).

Zoological Catalogue of Australia 33: i-xiii, 1-510. CSIRO:

Melbourne.

Samyn, Y. 2003. Shallow-water Holothuroidea (Echinodermata) from

Kenya and Pemba Island, Tanzania. Studies in Afrotropical

Zoology 292: i-iv, 1-158.

Samyn, Y., Appeltans, W., and Kerr, A. M. 2005. Phylogeny of

Labidodemas and the Holothuriidae (Holothuroidea:

Aspidochirotida) as inferred from morphology. Zoological

Journal of the Linnean Society 144: 103-120.

Samyn, Y., and Massin, C. 2003. The holothurian subgenus

Mertensiothuria (Aspidochirotida: Holothuriidae) revisited.

Journal of Natural History 37(20): 2487-2519.

Samyn, Y., and Tallon, I. 2005. Zoogeography of the shallow-water

holothuroids of the western Indian Ocean. Journal of Biogeography

32: 1523-1538.

Selenka, E. 1867. Beitrage zurAnatomieund Systematik der Holothurien.

Zeitschrift Wissenschaftliche Zoologie 17: 291-374., pis 17-20.

Semper, C. 1868. Reisen im Archipel der Philippinen. Holothurien. 2.

Wissenschaftliche Resultate. Erster Band, Holothurien Heft iv.

and v. Wilhelm Engelmann: Leipzig. 288 pp. 40 pis.

Swofford, D. L. 2003. PAUP*: Phylogenetic Analysis Using Parsimony

(and Other Methods). Version 4. Sinauer:, Sunderland, MA.

Theel, H. 1886. Report on the Holothurioidea dredged by H.M.S.

Challenger during the years 1873-76. Report on the Scientific

Results of the Voyage of H. M. S. Challenger during the Years

1873-76, Zoology 39: 290 pp.

Uthicke S., O’Hara T. D., and Byrne, M. 2004. Species composition

and molecular phylogeny of the Indo-Pacific teatfish

(Echinodermata: Holothuroidea) beche-de-mer fishery. Marine

and Freshwater Research 55: 837-848.

VandenSpiegel, D., Flammang, P., Fourmeau, D., and Jangoux, M. 1995.

Fine structure of the dorsal papillae in the holothurioid Holothuria

forskali (Echinodermata). Tissue & Cell 27(4): 457-465.

Memoirs of Museum Victoria 64: 53-70 (2007)

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/Memoirs/

New apodid species from southern Australia (Echinodermata: Holothuroidea:

Apodida)

P. Mark O’Loughlin 1 and Didier VandenSpiegel 2

Marine Biology Section, Museum Victoria, GPO Box 666, Melbourne, Victoria 3001, Australia (pmo@bigpond.net.au)

2 Musee royal de l’Afrique centrale. Section invertebrates non-insects, B-3080, Tervuren, Belgium (dvdspiegel@africamuseum.be)

Abstract O’Loughlin, P. M., and VandenSpiegel, D. 2007. New apodid species from southern Australia (Echinodermata:

Holothuroidea: Apodida). Memoirs of Museum Victoria 64: 53-70

A new chiridotid genus is erected: Archedota O’Loughlin gen. nov. In addition, seven apodid species, new to

science, are described (O’Loughlin as author) for the rocky shallows, continental shelf and continental slope of southern

Australia: chiridotids Archedota lapidea, Taeniogyrus papillis, Taeniogyrus tantulus, Trochodota epiphyka ; myriotrochids

Prototrochus burni, Prototrochus staplesi, Prototrochus taniae. Taeniogyrus heterosigmus Heding, Taeniogyrus roebucki

(Joshua), Trochodota allani (Joshua) and Trochodota shepherdi Rowe are discussed. Keys are provided for southern

Australian species of Taeniogyrus Semper and Trochodota Ludwig. A table is provided distinguishing Tasman Sea

myriotrochid species.

Keywords Echinodermata, Holothuroidea, Apodida, Chiridotidae, Myriotrochidae, new genus, new species, taxonomy, keys

Introduction

H. L. Clark (1946), A. M. Clark and Rowe (1971), and Rowe

(1995) summarized an incomplete knowledge of the Australian

apodid fauna. These apodids fall broadly into two groups:

tropical fauna in the north, with species of Chiridota

Eschscholtz, Polycheira H.L Clark, Scoliorhapis H.L Clark,

Taeniogyrus Semper, Trochodota Ludwig, Euapta Ostergren,

Leptosynapta Verrill, Opheodesoma Fisher, Polyplectana

H.L. Clark, Protankyra Ostergren, Rynkatorpa Rowe and

Pawson, Synapta Eschscholtz, Synaptula Orsted; temperate

fauna across the southern Australian coast, with the nine

species Chiridota gigas Dendy and Hindle, Scoliorhapis

theeli (Heding), Taeniogyrus cidaridis Ohshima, Taeniogyrus

heterosigmus Heding, Taeniogyrus roebucki (Joshua),

Trochodota allani (Joshua), Trochodota shepherdi Rowe,

Leptosynapta dolabrifera (Stimpson), Rynkatorpa hickmani

Rowe and Pawson. The record of Taeniogyrus cidaridis

Ohshima (type locality Japan) for southern Australia is based

on a single specimen taken off Rottnest I. near Perth in

Western Australia in 1931. H.L. Clark (1946) doubted the

reliability of this determination. Australian museums hold

many specimens of undescribed apodid species from tropical

and temperate waters. The focus of this paper is a selection

of some chiridotid material from the rocky shallows and

off-shore sediments of southern Australia, and the first

reported myriotrochid material from the eastern continental

slope of Australia.

Material and methods

Material examined here is principally in the Museum Victoria

collection, with single specimens examined from the Western

Australian Museum and Zoological Museum in Hamburg.

Mark O’Loughlin is the author of the new taxa and systematic

comments. For scanning electron microscope (SEM), ossicles

were cleared of associated soft tissues in commercial bleach.

They were then air-dried, mounted on aluminium stubs, and

coated with gold. Observations were done by Didier

VandenSpiegel using a JEOL JSM-6480LV SEM, and Tania

Bardsley and Phil Bock using a Philips XL20 SEM. SEM

measurements were made on large myriotrochid wheel ossicles

by Didier VandenSpiegel with Smile view software. Four

measurements were taken on each wheel: h = hub diameter, s

- spoke length, t = tooth length, w = wheel diameter (see fig.

lOd). Photographs of the smallest type specimens were taken

by Chris Rowley using a Leica MZ16 stereomicroscope, Leica

DC500 digital camera, and “Auto -Montage” software for

composition of images. Compound microscope photos were

taken by Mark O’Loughlin using an Olympus BX50 compound

microscope and Nikon D70 digital camera.

Abbreviations: NMV— Museum Victoria, registration

number prefix F; WAM— Western Australian Museum, prefix

Z; ZMH— Zoologisches Museum fur Hamburg, prefix E.

Throughout this paper Rowe (in Rowe and Gates, 1995) is

referred to as Rowe (1995), Dr. Frank W. E. Rowe being the

systematic authority in that work.

P. Mark O’Loughlin and Didier VandenSpiegel

Figure 1. Archedota lapidea O’Loughlin sp. nov. from Bass Strait, a, holotype NMV F59193, body wall ossicles in situ (insert), b (left), 2

tentacles (vertical) with contracted digits evident left, and smooth rods at top (paratype F59194); b (right), fused plates of calcareous ring, radial

plate (below) with anterior indentation (left), interradial plate with anterior and posterior concave indentations (above) (paratype F59194). c-e,

spinous wheel-hub plates from body wall, with complex hubs and lateral projections (holotype F59193; SEM by Tania Bardsley and Phil Bock),

f, rare wheels from body wall, with complex hub and continuous teeth on inner rim (holotype SEM image left, paratype optical image right).

New apodid species

Order Apodida Brandt, 1835 (sensu Ostergren, 1907)

SuborddB ynaptina Smirnov, 1998

Diagnosis (Smirnov, 1998). Plates of calcareous ring without

prominent anterior projections; excavations for tentacular

ampullae lie on outer side of calcareous ring. Madreporite

situated far from water ring at end of long stone canal. Ciliated

funnels present. One to many polian vesicles. Body wall

ossicles may be wheels of chiridotid type with 6 spokes and a

complex hub and/or sigmoid hooks, or anchors and anchor

plates. Wheels of larvae and juveniles with more spokes and

small denticles on inner side of rim.

Chiridotidae Ostergren, 1898

Diagnosis (Smirnov, 1998). Synaptina with 10, 12 or 18 peltato-

digitate, pinnate or bifurcate tentacles. Juveniles with bifurcate

tentacles. Body wall ossicles wheels of chiridotid type and/or

sigmoid hooks. Chiridotid type wheels with 6 spokes, numerous

small denticles on inner side of rim and a complex hub; on

lower side of each spoke a branch leans against the lower end of

the hub forming a star structure. Ossicles in tentacles usually

rods with branched ends.

Subfamily Taeniogyrinae Smirnov, 1998

Diagnosis (Smirnov, 1998). Chiridotidae with 10 or 12 tentacles.

Body wall ossicles wheels of chiridotid type and sigmoid hooks

or sigmoid hooks only. Radial plates of calcareous ring not

perforated but sometimes slightly notched in anterior (upper)

face for passage of nerves.

Remarks. The characters of the new genus below accord best

with the subfamily Taeniogyrinae, but exceptional characters

of the new genus are an absence of sigmoid hooks, and presence

of spinous plates with wheel-spoked perforations. Smirnov

(1998) included in his new subfamily Taeniogyrinae the genera

to which new species are assigned below: Taeniogyrus Semper,

1868 and Trochodota Ludwig, 1892.

Archedota O’Loughlin gen. nov.

Figure 1

Diagnosis. Taeniogyrid genus with body wall ossicles irregular

thick spinous plates with wheel-spoked perforations with complex

hubs, and rare chiridotid wheels; lacking sigmoid hooks.

Type species. Archedota lapidea O’Loughlin sp. nov. (below;

monotypic)

Distribution. Australia, Victoria, western Bass Strait, 39°S

143 °E, 92-85 m.

Etymology. From the Greek arche (old, beginning), referring to

the apparently primitive form of the wheel-spoked perforated

plates, with dota from the family name Chiridotidae (feminine).

Remarks. The characters of this new apodid genus Archedota

O’Loughlin gen. nov. are in accord with the above diagnoses of

suborder, family and subfamily, with the exception of the presence

of spinous plates with wheel-spoked perforations. This significant

diagnostic character difference supports the erection of new

higher taxa (suborder, family, subfamily), but on the basis of

having only 2 specimens, and in the absence of molecular genetic

data, I am limiting my response to the erection of a new genus

only. Archedota lapidea O’Loughlin sp. nov. (below) differs only

in ossicle form from the other genera of Chiridotidae. The

presence of wheel-spoked single perforations in thick, closely

spinous plates is a unique character amongst the chiridotids. Rare

chiridotid-type wheels are present amongst the abundant, massed,

perforated wheel-spoked plates. Absence of sigmoid hooks is

also exceptional within the diagnosis of Taeniogyrinae. I

acknowledge that in subjectively describing (etymology) the

plate ossicles as “primitive”, and perhaps precursors to wheel

ossicles, the form of the plates may in fact indicate a regressive

condition or wheel ossicles with secondary developments.

Figure 2. Photos of live taeniogyrid specimens, a, Taeniogyrus roebucki (Joshua, 1914) from Flinders rocky shallows, with 2 pairs of digits per

tentacle (NMV F73591; photo by Ian Kirwan). b, Trochodota epiphyka O’Loughlin sp. nov. from Cape Bridgewater rocky shallows, with 3 pairs

of digits per tentacle (FI 25372; 32 mm long live; photo by Leon Altoff and Audrey Falconer).

P. Mark O’Loughlin and Didier VandenSpiegel

Figure 3. Body wall ossicles of specimens of Taeniogyrus Semper, 1868 and Trochodota Ludwig, 1891 (SEM by Tania Bardsley and Phil Bock),

a, b, Taeniogyrus roebucki (Joshua, 1914), NMV F82716: a, wheel with continuous series of teeth on inner rim; b, outer curved edge of hook with

minute spinelets. c-f, Trochodota allani (Joshua, 1912), F82705: c-e, wheels with discontinuous series of teeth on inner rim, and complex hub;

f, sigmoid hooks with minute spinelets on outer curved edge.

New apodid species

Figure 4. Body wall ossicles in body mounts from Taeniogyrus Semper species, a, dense wheel clusters and large hooks in Taeniogyrus

heterosigmus Heding, 1931, NMV F82707; b, parallel rows of large hooks along edges of longitudinal muscles in body wall of Taeniogyrus

roebucki (Joshua, 1914), F73607; c-d, Taeniogyrus tantulus O’Loughlin sp. nov., paratype F59199: c, dorsal body wall with scattered wheels and

subequal hooks; d, ventral body wall with hook ossicles only.

Archedota lapidea O’Loughlin sp. nov.

Figure 1

Material examined. Holotype: Victoria, western Bass Strait, VIMS,

NZOI RV Tangaroa , cruise 81-T-l, BSS stn 205G, 39°13’36”S,

143°55’36”E, fine sandy shell, 85 m, 23 Nov 1981, NMV F59193 (with

microscope slide of ossicles).

Paratype: Western Bass Strait, Hai Kung, cruise 81-Hk-l, BSS stn

119G, 39°06’42”S, 143°28’42”E, fine sand with abundant sponges, 92

m, 31 Jan 1981, F59194 (1; with 4 microscope slides).

Description. Up to 17 mm long, 2 mm diameter (paratype);

body wall hard, calcareous; anterior dorsal body and tentacles

overhang ventral body and tentacles; tentacles withdrawn (both

specimens), tentacles digitate, 10, each with predominantly 5

pairs of digits, longest pair distally, shortest pair proximally;

calcareous ring with 5 radial 5 interradial plates all fused to form

narrow ring; radial plates low, with anterior indentation, rounded

posteriorly; interradial plates with concave anterior and posterior

indentations; single dorsal madreporite; 1 polian vesicle, ventral;

few ciliated funnels along dorsal alimentary canal/mesentery

attachment; 2 unbranched gonad tubules, thick, 1 on each side of

dorsal mesentery, joined dorsally at shared gonoduct.

Body wall ossicles plates and wheels, lacking hooks: plates

densely massed throughout body wall, thick, closely spinous rim

and surface, form irregularly oval with 0-6 lobed projections on

rim, single wheel-spoked perforation with complex hub, typically

6 spokes, plates 48-88 pm wide; wheels sparsely present among

plate ossicles, intergrade in form with wheel-spoked plates, some

with rounded hexagonal form, 6 spokes, inner margin of rim

parallel to outer margin, inner margin with continuous teeth,

wheel diameter 48 pm. Tentacles with rod ossicles, ends bifurcate,

curved, swollen centrally, tapering distally, rods lacking side

branches or denticulations, rods 56 pm long.

Colour ( preserved ). Off-white.

P. Mark O’Loughlin and Didier VandenSpiegel

Figure 5. Taeniogyrus papillis O’Loughlin sp. nov. a, holotype (preserved) from Beachport, with soft papillate body wall, NMV F59195; b,

tentacle crown, with predominantly 5 pairs of digits per tentacle, paratype F59197; c, holotype, section of body wall mount, with scattered

subequal wheels and hooks; d, body wall hooks and wheel (left), and tentacle rods (right), all subequal (from types).

Distribution. Western Bass Strait, 39°S 143°E, 92-85 m.

Etymology. From the Latin lapideus (of stone), referring to the

stone -like ossicles in the body wall (feminine).

Remarks. The body wall ossicle combination of rare chiridotid

wheels, irregular spinous plates with single wheel-spoked

perforation, and absence of hooks distinguishes Archedota

lapidea O’Loughlin sp. nov. from all other chiridotid species.

Taeniogyrus Semper, 1868

Figures 2a, 3a, b, 4-7

Diagnosis (as emended by Rowe, 1976). Chiridotid genus with

wheels and sigmoid ossicles present, scattered, or in groups or

clustered into papillae; wheels with serrations continuous

around the inner margin; tentacles 10 or 12.

Species in southern Australia. Taeniogyrus heterosigmus

Heding, 1931; T. papillis O’Loughlin sp. nov.; T. roebucki

(Joshua, 1914); T. tantulus O’Loughlin sp. nov.

Remarks. An abundance of T. roebucki (Joshua) material from

southern Australia, including the types, is present in the collections

of Museum Victoria and was available for comparative

examination. T. roebucki differs from the other 3 Taeniogyrus

species in southern Australia in having only 2 pairs of digits per

tentacle. Rowe (1995) reported T. heterosigmus Heding as known

only from the type locality (Koombana Bay in SW Australia). I

have found specimens at Normanville in Gulf St. Vincent in

South Australia, in the rock and sediment shallows (NMV F746 1 2

(1), F82706 (4), F82707 (5)), and confirmed their identity with

the type (ZMH E.5032). T. heterosigmus differs in 3 significant

ways from the other 3 species of Taeniogyrus in southern

Australia: dense round clusters of wheels in the body wall; 2

series of ciliated funnels along the coelomic wall, in the left

lateral and right ventral interradii; multiple branching gonad

tubules. T. heterosigmus is similar to T. roebucki: sigmoid hooks

significantly larger than wheels; tentacle rods with lateral

New apodid species

Figure 6. Taeniogyrus tantulus O’Loughlin sp. nov. (SEM by Tania Bardsley and Phil Bock), a, holotype (preserved) from East Gippsland, NMV

F59198; b, 2 tentacles and digits, with smooth-sided rods, paratype F59199; c, calcareous ring plates from paratype, F59199: radial plate above,

interradial plate below; d, wheel from body wall, with continuous series of teeth on inner edge of rim, paratype F59199; e, hook from body wall

(above), and rod from tentacle, lacking lateral denticulations (below), paratype F59199; f, end of hook from paratype, with spines on outer curved

edge, paratype F59199.

P. Mark O’Loughlin and Didier VandenSpiegel

Figure 7. Taeniogyrus tantulus O’Loughlin sp. nov. (SEM by Didier VandenSpiegel; paratype NMV F59199; all scale bars 10 pim). a, tentacle

rods, lacking lateral denticulations; b, hooks from body wall, with spines on outer curved edge; c, wheels from body wall, with continuous series

of teeth on inner rim, and complex hub.

New apodid species

denticulations that are papillate or sub-columnar, never with

additional fine spinelets apically. In T. heterosigmus the wheels

are in rounded dense clusters; in T. roebucki wheels are in close

irregular bands adjacent to the longitudinal muscles, and sparse

mid-interradially. In T. heterosigmus the hooks are scattered in all

interradii; in T. roebucki hooks are aligned transversely in paired

series over the edges of longitudinal muscles.

Key to the southern Australia species of Taeniogyrus

2 emper, 1868

1. Body wall with calcareous white spots comprising

clustered wheel ossicles; gonad tubules with multiple

branching; 2 series of ciliated funnels, not dorsal

a- T. heterosigmus Heding

— Body wall lacking white spots of clustered wheel ossicles;

gonad tubules not branched; 1 series of ciliated funnels,

dorsal 2

2. Tentacles each with 2 pairs of digits; sigmoid hooks

significantly larger than wheels; tentacle rods with lateral

denticulations T. roebucki (Joshua)

— Tentacles each with predominantly 4-5 pairs of digits;

sigmoid hooks not significantly larger than wheels;

tentacle rods smooth laterally 3

3. Large, up to 60 mm long (preserved); relaxed body wall

covered with non-calcareous discrete papillae; papillae

dark red; outer curved side of projecting end of hooks

smooth; tentacle rods widened mid-rod and tapering

distal ly T. papillis O’Loughlin sp. nov.

— Small, up to 11 mm long (preserved); relaxed body wall

not covered with discrete papillae; body white; outer

curved side of projecting end of hooks minutely spinous;

tentacle rods not widened mid-rod

T. tantulus O’Loughlin sp. nov.

Taeniogyrus papillis O’Loughlin sp. nov.

Figure 5

Material examined. Holotype: SE South Australia, Beachport,

“Salmon Hole”, shallow sub-littoral, in sand under rock with

Taeniogyrus roebucki, M. O’Loughlin, 29 Jan 1989, NMV F59195 (1,

with 5 microscope slides).

Paratypes: SE South Australia, Cape Northumberland, algal

“scrapings”, M. Mackenzie, R. McIntosh, M. O’Loughlin, 6 Jan 2001,

F94119 (1 in 2 pieces, with 1 microscope slide). Victoria, Marengo

(SW of Apollo Bay), M. O’Loughlin, 11 Jan 1980, F59197 (1, with 1

microscope slide); Cape Paterson, rocky shallows, M. O’Loughlin,

M. Nyhuis, 29 Jan 1988, F59196 (1, with 2 microscope slides).

Other material. SE South Australia, Cape Banks, W side, off

Caulerpa, 1 m, CRUST 74, 11 May 1990, F94706 (1, fragment).

Description. Up to 60 mm long, 2 mm diameter (preserved);

body wall with close cover of discrete domed projections

(papillae) present in extended and contracted specimens; anterior

dorsal body and tentacles overhang ventral body and tentacles;

tentacles digitate, 10, each with predominantly 5 pairs of digits,

longest pair distally, shortest pair proximally; calcareous ring

with 5 radial 5 interradial plates all fused to form narrow ring;

plates low, with concave indentations anteriorly and posteriorly,

some plates asymmetrical anteriorly with low blunt anterior

projection on one side of indentation; single dorsal madreporite;

1 polian vesicle, ventral; narrow band of ciliated funnels along

mid-dorsal interradius, on both sides of mesentery attachment;

2 unbranched gonad tubules, 1 on each side of dorsal mesentery,

joined dorsally at shared gonoduct.

Body wall ossicles wheels, sigmoid hooks: wheels scattered

in interradii of body wall, sparse ventrally, rounded hexagonal

form, 6 spokes, inner margin of rim parallel to outer margin,

inner margin with continuous teeth, wheel diameters 64-96

pm\ sigmoid hooks over and adjacent to longitudinal muscles,

more numerous and slightly smaller than wheels, outer curved

side of hook smooth, hook lengths 64-80 pm. Papillae lacking

concentrations of ossicles. Tentacles with rod ossicles: rods

curved, swollen centrally, tapering distally, ends with short

lobed to blunt branches, rods lacking side branches or

denticulations, rods 56-96 pm long.

Colour (live). Body translucent with close cover of dark red

papillae. Preserved holotype with red flecking on vascular ring,

polian vesicles and longitudinal muscles.

Etymology. From the Latin papilla (small swelling, bud,

nipple), referring to the close cover of small domed protuberances

on the body surface.

Distribution. Victoria (Cape Paterson) to SE South Australia

(Beachport); rocky shallow sub-littoral, 0-1 m.

Remarks. Taeniogyrus papillis sp. nov. is distinguished in the

key (above) from the 3 other species of Taeniogyrus Semper in

southern Australia. The holotype has 3 anterior tubular growth

infestations arising near the vascular ring, 2 with short branches

distally.

Taeniogyrus tantulus O’Loughlin sp. nov.

Figures 4c, d, 6, 7

Material examined. Holotype: Victoria, East Gippsland, Ninety Mile

Beach, off McGaurans Beach, 800 m offshore, 10 m, fine sand, strong

currents, LVWSB: SWOP 1, stn 7, Site 2, 31 Dec 1979, data from

J. Carey and J. Watson, NMV F59198.

Paratypes: Type locality and date, F59199 (11, with many

microscope slides).

Other material. Type locality and date, F82710 (many); stn 6,

31 Oct 1979, F80938 (many).

Description. Up to 11 mm long, 2 mm diameter at oral and anal

ends (preserved); preserved form commonly with oral and anal

ends swollen, mid-body contracted and narrow, anterior dorsal

body and tentacles overhang ventral body and tentacles; tentacles

digitate, 10, each with 4—5 pairs of digits, longest pair distally,

shortest pair proximally; calcareous ring with 5 radial

5 interradial plates fused to form narrow ring; radial plates low,

with anterior narrow indentation between 2 low rounded

projections, shallow concave posterior indentation; interradial

plates with anterior indentation with 1 lateral low rounded

projection, shallow concave posterior indentation; single dorsal

stone canal, madreporite; 1 polian vesicle, ventral; narrow band

P. Mark O’Loughlin and Didier VandenSpiegel

of ciliated funnels along mid-dorsal interradius, on both sides of

mesentery attachment; 2 unbranched gonad tubules, 1 on each

side of dorsal mesentery, joined dorsally at shared gonoduct.

Body wall ossicles wheels, sigmoid hooks: wheels adjacent

to longitudinal muscles in interradii of body wall, sparse in

ventral interradii, wheels only ossicles anteriorly, wheels with

rounded hexagonal form, 6 spokes, inner margin of rim parallel

to outer margin, inner margin with continuous teeth, wheel

diameters 40-104 pn n; sigmoid hooks absent anteriorly,

scattered throughout interradii in mid-body, more numerous

and slightly smaller than wheels, outer curved side of some

hooks with spinelets, hook lengths 60-80 pm n. Tentacles with

rod ossicles: rods not swollen centrally, ends with short lobed

branches, rods lacking side branches or denticulations, rods

40-64 pim long.

Colour ( preserved ). White, translucent.

Distribution. Eastern Victoria, East Gippsland, offshore

sediments; 11m.

Etymology. From the Latin tantulus (so small), referring to the

very small size of specimens of this species.

Remarks. T. tantulus sp. nov. is distinguished in the key (above)

from the other species of Taeniogyrus Semper in southern

Australia. It is a very small holothuroid, extremely abundant in

the off-shore sublittoral sediments of east Gippsland. Data from

Jan Watson (pers. comm.) gives estimated populations at Stns 6

and 7 of 13,870 per square m. Jan noted (pers. comm.) that

nearby sites had only a few individuals. There was no evidence

of internal brood-protection or fissiparity in the many individuals

examined, but such reproductive strategies could be seasonal.

The only material examined here was collected in mid-summer.

Trochodota Ludwig, 1891

Figures 2b, 3c-f, 8, 9

Diagnosis (as emended by Rowe, 1976). Chiridotid genus with

wheels and sigmoid ossicles present scattered or in groups,

wheels with serrations on the inner margin in well defined

groups; tentacles 10.

Species in southern Australia. Trochodota allani (Joshua,

1912); T. epiphyka O’Loughlin sp. nov.; T. shepherdi Rowe,

1976.

Remarks. An abundance of T. allani (Joshua) material from

southern Australia, including the types, is present in the

collections of Museum Victoria and was available for

comparative examination. Rowe (1995) reported T. shepherdi

Rowe as known only from South Australia (the Gulfs and

Kangaroo I.). Museum Victoria holds specimens from eastern

Victoria (Nooramunga, NMV F82694 (3); Corner Inlet,

F82704 (5)) and South Australia (Port Lincoln, 15 m,

F82703 (1)). No specimens of T. shepherdi have been found on

the thoroughly examined coast between Wilsons Promontory

(Victoria) and the Gulfs (South Australia). In addition to the

form of the wheel ossicles, T. allani and T. shepherdi are similar

in each having: tentacle rods with denticulations on the sides,

variable in form from low papillate to columnar to flared or

bifurcate distally, often with a small apical spinelet; 3 series of

ciliated funnels, in the dorsal, left lateral and right ventral

interradii; spinelets on the outer curved side of hook ossicles,

more evident in T. shepherdi.

Rowe (1976) emended the diagnosis of Trochodota Ludwig,

1891. Subsequently Rowe (1995) discussed in detail the

uncertain validity of the generic name Trochodota. Smirnov

(1997) rejected the emended diagnosis of Trochodota by Rowe

(1976), without reference to the uncertain validity of

Trochodota raised by Rowe (1995). Smirnov (1997) reverted

to the diagnosis of Trochodota by H. L. Clark (1921), while

recognizing that “Clark’s system itself needs revision”. Rowe

(pers. comm.) indicates that he disagrees with Smirnov (1997)

on the identification of the type species of Trochodota , namely

Chirodota studerii Theel, 1886, sensu Ludwig, 1891 =

Holothuria (Fistularia) purpurea Lesson, 1830 (not Theel,

1886 - Taeniogyrus contortus Ludwig, 1874) (subsequent

designation by Rowe, 1995). Resolution of these issues will be

undertaken elsewhere, and the emended diagnosis of

Trochodota by Rowe (1976) is followed here.

Key to the southern Australia species of Trochodota Ludwig,

1891

1. Live colour uniform black; wheels grouped in a band along

all mid-interradii Trochodota shepherdi Rowe

— Live colour never uniform black; wheels scattered, sparse

to absent in the 2 ventral interradii 2

2. Smaller, upto 14mmlong(preserved);foundpredominantly

in shallow sublittoral algal growth; live colour white with

dark purple to black flecks, consistent; 2 longitudinal

seriesof ciliated funnels (left lateral, right ventral interradii);

wheel diameters smaller, 40-160 pm: sigmoid hooks

shorter, 88-136 pm, outer side of curved hooks with paired

series of spinelets

Trochodota epiphyka O’Loughlin sp. nov.

— Larger, up to 80 mm long (live); found predominantly in

deep sublittoral sediments; live colour predominantly

solid carmine, blood red, variable; 3 longitudinal series of

ciliated funnels (dorsal, left lateral, right ventral interradii);

wheel diameters larger, 40-184 pn n; sigmoid hooks longer,

136-184 pm, outer side of curved hooks with single series

of spinelets Trochodota allani (Joshua)

Trochodota epiphyka O’Loughlin sp. nov.

Figure 2b, 8b, e-f, 9

Trochodota allani.— O’Loughlin, 1984: 155.— Rowe, 1995: 268

(part) (non Trochodota allani (Joshua, 1912))

Material examined. Holotype: Victoria, Flinders, Mushroom Reef,

sieved from Amphibolus in rocky shallows, A. Falconer, 20 Apr 2007,

NMV F132690 (photo live by Leon Altoff).

Paratypes: (all paratype specimens from algal scrapings in the

rocky shallows, collected by M. O’Loughlin). Flinders, West Head,

M. Benavides-Serrato, D. Marie, M. O’Loughlin, 27 Jan 2007,

F121896 (1); F121897 (1); Flinders, ocean platforms, 13 Apr 1985,

F73564 (1); 13 Jul 1990, F73565 (1); 16 Nov 1980, F73566 (3);

New apodid species

Figure 8. Trochodota Ludwig, 1891 species, a, tentacle mount of Trochodota allani (Joshua, 1912) with 5 pairs of digits, NMV F45031. b, tentacle

mount of Trochodota epiphyka O’Loughlin sp. nov. with 3 pairs of digits, and rods with lateral denticulations, paratype F73587. c-f, part body

wall mounts at same magnification: c, d: Trochodota allani , F82705; c, dorsal body wall with larger wheels and hooks; d, ventral body wall with

hooks and rare wheels, e, f, Trochodota epiphyka , F73584: e, dorsal body wall with smaller wheels and hooks; f, ventral body wall with hooks,

lacking wheels.

P. Mark O’Loughlin and Didier VandenSpiegel

Figure 9. Trochodota epiphyka O’Loughlin sp. nov., paratype NMV F73586 (SEM by Didier VandenSpiegel) a, radial and interradial plates of

calcareous ring (scale bar 50 pm)\ b, tentacle rods with lateral denticulations (scale bars 10 pm); c, hooks from body wall, with short paired rows

of small spinelets on outer curved edges (scale bars 10 pm); d, wheels from body wall, with discontinuous series of teeth on inner margin of rim,

and complex hub (scale bars 20 pm).

New apodid species

Table 1. Wheel ossicle characters for the species of Prototrochus Beljaev and Moronov, 1982 from the Tasman Sea: P. australis (Beljaev and

Mironov, 1981); P. burni O’Loughlin sp. nov.; P. staplesi O’Loughlin sp. nov.; P. taniae O’Loughlin sp. nov. (optical measurements by Mark

O’Loughlin)

Species

Diameter

Spokes

Teeth

Spokes/

Hub/wheel

Rim

(depth)

(average)

teeth ratio

(diameters)

P. australis

226 pm

34%

Not given

Round

1500 m

(155-297)

(7-11)

(23-30)

(25^12)

(n = 51)

P. burni

272 pm

31-35

25-31%

22-25%

Round

2900 m

(240-336)

(8-12)

(n = 21)

P. staplesi

136 pm

18-20

40-50%

14—16%

Scalloped

1119m

(112-152)

(7-9)

(n = 10)

P. taniae

232 pm

24—28

33%

19-20%

Angular

996 m

(192-248)

(7-10)

( n = 37)

Table 2. Measurements (pm) for 10

“large” wheels of Prototrochus taniae O’Loughlin sp. nov.

(paratype NMV F59192; SEM measurements by

Didier VandenSpiegel; wheel parameters in fig. lOd).

Wheel diameter

Hub diameter

Spoke length

Tooth length

(averages at bottom)

179.9

39.5

50.4

20.3

170.8

49.5

49.8

18.0

188.7

45.3

50.0

17.7

184.7

47.6

50.1

20.4

193.8

47.3

57.3

19.9

291.6

54.1

56.0

21.5

212.0

54.3

60.3

23.4

176.6

43.0

48.3

20.5

184.3

42.4

52.8

24.7

191.2

46.9

55.4

23.4

188.4 pm

47.0 pm

53.0 pm

21.0 pm

10 Mar 1980,

F73567 (1); 7 Apr

1980, F73568 (3); 6

Mar 1982,

short truncate anterior projection, shallow

' concave posterior

F73586 (1, photo by I. Kirwan); 17 Feb 1990, F73587 (5).

Other material (selection). Victoria, Cape Paterson, 25 Jan 1992,

F59230 (2); 18 Jan 1980, F73590 (4); Mullet Holes (10 km NE of

Apollo Bay), 2 Jan 1988, F73584; Portland, W side of Bridgewater

Bay, 25 Feb 2007, F125372 (1, photo live by Leon Altoff). N Tasmania,

Lulworth, Black Rock Point, 22 Nov 1982, F82765 (5). South Australia,

Robe, 10 Jan 1988, F82766 (3); Victor Harbor, The Bluff, 9 Nov 1988,

F82720 (4); Cape Jervis, 10 Nov 1988, F82769 (1); Kangaroo I., Emu

Bay, 17 Jan 1990, F82768 (3). Western Australia, Cape Naturaliste,

Eagle Bay, 25 Feb 1975, WAM Z464-76 (1).

Description. Up to 14 mm long, 2 mm diameter (preserved);

anterior dorsal body and tentacles overhang ventral body and

tentacles; tentacles digitate, 10, each with predominantly

3 pairs of digits, longest pair distally, shortest pair proximally;

calcareous ring with 5 radial 5 interradial plates all fused to

form narrow ring; radial plate subrectangular with narrow

indentation; interradial plate asymmetrical with mid-anterior

small notch and short projection, concave indentation

posteriorly; single dorsal stone canal, hook-shaped madreporite;

1 polian vesicle, ventral; 2 narrow bands of ciliated funnels

along left lateral interradius adjacent to left ventrolateral

muscle, and along right ventral interradius adjacent to

midventral muscle; 2 unbranched gonad tubules, 1 on each side

of dorsal mesentery, joined dorsally at shared gonoduct.

Body wall ossicles wheels, sigmoid hooks: wheels in dorsal

and lateral interradii, no wheels in 2 ventral interradii, not grouped

into papillae, wheels with 6 spokes, rarely more, outer rim of

wheels with rounded hexagonal form, inner rim not parallel to

outer rim, undulating, wide across spokes with continuous teeth,

narrow between spokes and lacking teeth at narrowest part, wheel

diameters 40-160 pm: sigmoid hooks evenly distributed around

body, outer side of curved hooks with short parallel series of

P. Mark O’Loughlin and Didier VandenSpiegel

minute spinelets, hook lengths 88-136 pm. Tentacles with rod

ossicles: rods curved, slightly tapering distally, ends with short

lobed branches, rods with irregular side denticulations, papillate

to short columnar to bifurcate, some flared distally, often with

small spinelet apically, rod lengths 64—80 pm.

Colour (live). Body white, cream or grey, with dark flecks or

broken bands of purple, brown or black; tentacles white.

Distribution. From Cape Paterson (eastern Victoria) to Cape

Naturaliste (south-western Australia), northern Tasmania;

shallow sub-littoral on algae.

Etymology. From the Greek epi (upon) and phykos (seaweed,

alga), referring to the microhabitat of the species (feminine).

Remarks. In contrast with the small size and broken colours of

Trochodota epiphyka O’Loughlin sp. nov., Joshua (1912)

reported T. allani to be 80 mm long and 6 mm wide, and

described the live colour as carmine and blood red (Joshua,

1914). T. epiphyka is distinguished in the key above from the

other two species of Trochodota in southern Australia.

Suborder Myriotrochina Smirnov, 1998

Diagnosis ( Smirnov , 1998). Ten or 12 digitate or peltato-

digitate tentacles. Plates of calcareous ring with large anterior

projections; excavations for tentacular ampullae are on anterior

side of calcareous ring. Madreporite placed close to water ring.

No ciliated funnels. One polian vesicle. Body wall ossicles

represented by wheels with large numbers of spokes (8-25) and

without a complex hub (only Family Myriotrochidae).

Myriotrochidae Theel, 1877

Diagnosis. As for suborder.

Prototrochus Beljaev and Mironov, 1982

Figures 10, 11; Tables 1, 2

Diagnosis ( after Gage and Billett, 1986). Myriotrochid with

10 tentacles; calcareous ring symmetrical, with dorsal and

ventral plates subequal in size; dorsolateral radial plates with

single anterior projection; wheels with teeth distributed

regularly, pointing towards centre of hub; rods absent from

body wall, sometime occurring in and around tentacles.

Remarks. Beljaev and Mironov (1982) referred 12 species to

their new genus Prototrochus. Only Prototrochus australis

(Beljaev and Mironov, 1981) occurs near eastern Australia, the

holotype coming from south of Lord Howe I. in the northern

Tasman Sea at 1500 m. Beljaev and Mironov (1981) noted that

their new species Myriotrochus australis was the smallest

known myriotrochid. The 7 specimens comprise 2 complete

and 5 incomplete specimens, none longer than 2.8 mm. The

holotype (Stn 1244; oral end part specimen; less than 2 mm

long) diagnostic characters of the “larger wheels” given by

Beljaev and Mironov (1981) are summarized in Table 1. These

characters vary greatly across the specimens of Prototrochus

australis analysed by Beljaev and Mironov (1981), as do the

distribution (5 locations from east of New Zealand to northern

Tasman Sea) and depth range (570-3013 m), suggesting to me

the probability of more than 1 species. Beljaev and Mironov

(1981) acknowledged that their new species might well

comprise “two or more species or subspecies”. The 3 new

species from eastern Australia described below are diagnosed

against the “larger wheels” data and illustrations given for the

holotype of P. australis (Stn 1244). The 3 new species described

below are the first myriotrochid records for Australian

continental waters.

Prototrochus burni O’Loughlin sp. nov.

Figure lOe; Table 1

Material. Holotype: Eastern Australia, E Victoria, 96 km S of Point

Hicks, 38°40’S, 149°17’E, 2900 m, lower continental slope, compacted

clay, stn SLOPE 66, RV Franklin , G.C.B. Poore et al., 25 Oct 1988,

NMV F94697 (with 2 microscope slides of wheel ossicles).

Description. Anterior body part; length 2.0 mm; calcareous

ring diameter 1.0 mm; 10 peltato -digitate tentacles; calcareous

ring symmetrical, 10 plates, dorsal and ventral plates subequal,

radial and interradial plates with single long anterior spire,

radially digitiform and distally narrowly rounded, interradially

narrower and distally pointed, all plates with posterior

indentations, lacking posterior projections.

Body wall ossicles massed wheels only: average (21) wheel

diameter 272 pm (range 240-336 pm)\ spokes thick, average

10 per wheel (range 8-12); wheel rim slightly undulating, not

angular rounded, not scalloped or straight across each tooth;

wheel hubs simple, not perforated; hub diameter 56 pm for

wheel diameter 256 pm (22%), hub diameter 80 pm for wheel

diameter 320 pm (25%); wheel teeth subequal in size,

distributed regularly around inner rim, not aligned with

spokes, bluntly rounded, all pointing towards hub; small

8 spoke wheel with 32 teeth (25%), large 11 spoke wheel with

35 teeth (31%); tooth length 3 pm for wheel diameter 30 pm

(10%), tooth length 6 pm for wheel diameter 42 pm (14%).

Tentacles lack ossicles.

Colour. Off-white, translucent; tentacles with large brown spot

distally, small pair proximally.

Distribution. Eastern Australia, E Victoria, S of Point Hicks,

lower continental slope; 2900 m.

Etymology. Named for Robert Burn (Marine Research Group

of Victoria; Honorary Associate of Museum Victoria), in

appreciation of his decades of generous and dedicated

contribution to marine research and Museum Victoria, and his

invaluable service to the Marine Research Group.

Remarks. Prototrochus burni O’Loughlin sp. nov. is based on

a single small part-specimen. Tentacles, calcareous ring, and

wheel ossicles are all present, and adequate for a specific

diagnosis. The symmetrical calcareous ring, with single long

anterior projection on each plate and 10 tentacles, wheels with

evenly distributed teeth pointing towards the hub, and absence

of rod ossicles, identify the new species as a Prototrochus

Beljaev and Mironov, 1982. The large diameter of the wheels

and high number of teeth per wheel distinguish P. burni sp.

New apodid species

Figure 10. Species of Prototochus Beljaev and Mironov, 1981. a-d, Prototrochus taniae O’Loughlin sp. nov.: a, holotype (preserved), NMV

F59191; b, anterior projections of interradial and radial plates of calcareous ring, paratype F59192; c, wheels from body wall, with longer teeth

over spokes, and angular margin almost flat over spokes, holotype F59191; d, wheel parameters measured by Didier VandenSpiegel for data in

Table 2. e, Prototrochus burnt O’Loughlin sp. nov., wheels from body wall with rounded rim, subequal teeth and more than 8 spokes, holotype

F94697. f, Prototrochus staplesi O’Loughlin sp. nov., wheels from body wall with flat or shallow concave outer rim over each tooth, subequal

teeth, holotype F94698.

P. Mark O’Loughlin and Didier VandenSpiegel

nov. from P. australis (Beljaev and Mironov), P. staplesi sp.

nov. (below) and P. taniae sp. nov. (below). In the data given by

Beljaev and Mironov (1981) the “bigger” wheel diameters of

the holotype of P. australis are significantly larger than for any

of their other P. australis specimens. All are significantly

smaller than the P. burni wheels. P. burni occurs at a

significantly greater depth (2900 m) than the holotype of

P. australis and the other new species (below) (Table 1).

Prototrochus staplesi O’Loughlin sp. nov.

Figure lOf; Table 1

Material. Holotype. Eastern Australia, Victoria, 67 km S of Point

Hicks, 38°24’S, 149°16’E, 1119 m, upper continental slope, fine mud,

stn SLOPE 67, RV Franklin, G.C.B. Poore et al„ 25 Oct 1988, NMV

F94698 (microscope slide of wheel ossicles).

Description. Anterior body part; length 1.2 mm; calcareous

ring diameter 1.0 mm; 10 peltato-digitate tentacles; calcareous

ring symmetrical, 10 plates, dorsal and ventral plates subequal,

radial and interradial plates with single long anterior spire,

radially digitiform and distally narrowly rounded, interradially

narrower and distally pointed, all plates with posterior

indentations, lacking posterior projections.

Body wall ossicles massed wheels only: average (10) wheel

diameter 136 pm (range 112-152 pm)\ spokes thin, average 8

per wheel (range 7-9); wheel rim slightly scalloped to straight

across each tooth; wheel hubs simple, not perforated; hub

diameter 24 pm for wheel diameter 152 pm (16%), hub

diameter 16 pm for wheel diameter 112 pm (14%); wheel teeth

subequal in size, distributed regularly around inner rim, not

aligned with spokes, bluntly rounded, all pointing towards

hub; teeth large, small 9 spoke wheel with 18 teeth (50%),

large 8 spoke wheel with 20 teeth (40%); tooth length 16 pm

for wheel diameter 112 pm (14%), tooth length 24 pm for

wheel diameter 152 pm (16%). Tentacles lack ossicles.

Colour. Off-white, translucent; tentacles lacking brown spots.

Distribution. Eastern Australia, off eastern Victoria, upper

continental slope; 1119 m.

Etymology. Named for David Staples (Marine Research Group

of Victoria; Honorary Associate of Museum Victoria), in

appreciation of his decades of generous and dedicated

contribution to marine research and Museum Victoria, and his

invaluable service to the Marine Research Group.

Remarks. Prototrochus staplesi O’Loughlin sp. nov. is based

on a single small part-specimen. Tentacles, calcareous ring,

and wheel ossicles are all present, and adequate for a specific

diagnosis. The symmetrical calcareous ring, with single long

anterior projection on each plate and 10 tentacles, wheels with

evenly distributed teeth pointing towards the hub, and absence

of rod ossicles, identify the new species as a Prototrochus

Beljaev and Mironov, 1982. The small diameter of the wheels,

wheel rims slightly scalloped or straight across each tooth,

small wheel hubs, and large teeth distinguish P. staplesi sp.

nov. from P. australis (Beljaev and Mironov), P. burni sp. nov.

and P. taniae sp. nov. (below) (Table 1).

Prototrochus taniae O’Loughlin sp. nov.

Figures lOa-d, 11; Tables 1, 2

Material. Holotype: Eastern Australia, New South Wales, 54 km ESE

of Nowra, 34°53’S, 151°17’E, 996-990 m, upper continental slope,

mud, fine sand, fine shell, stn SLOPE 53, RV Franklin, G.C.B. Poore

et al., 22 Oct 1988, NMV F59191 (with microscope slide of ossicles).

Paratypes: Type locality and date, F59192 (4, with 2 microscope

slides of ossicles and 1 anterior body mount).

Description. Up to 7 mm long; calcareous ring and body

diameter 1.0 mm; 10 peltato-digitate tentacles, each with

3 pairs of digits; calcareous ring symmetrical, dorsal and

ventral plates subequal, 10 plates, radial and interradial plates

with single long anterior spire, radially digitiform and distally

rounded, interradially narrower and distally pointed, all plates

with posterior indentations, lacking posterior projections;

single dorsal madreporite; single ventral polian vesicle;

branched gonad tubules.

Body wall ossicles massed wheels only, present dorsally

and laterally, absent ventrally: average (37) wheel diameter

232 pm (range 192-248 pm); spokes thin, average 9 per wheel

(7-10); wheel rim slightly angular rounded, not scalloped,

rounded angles between spokes, flat across spokes; wheel hubs

simple, lacking perforations, hub diameter 48 pm for wheel

diameter 248 pm (20%), hub diameter 40 pm for wheel

diameter 208 pm (19%); teeth distributed regularly around

inner rim, all pointing towards hub, bluntly rounded, 2 sizes,

longer teeth aligned with spokes, shorter teeth between spokes;

for wheel diameter 240 pm longer teeth 40 pm, shorter teeth

32 pm: when 9 spokes 27 teeth (33%), when 8 spokes 24 teeth

(33%). Tentacles lacking ossicles.

Colour. Off-white, translucent; tentacles each with brown

lateral bands.

Distribution. Eastern Australia, off southern NSW, upper

continental slope; 996 m.

Etymology. Named for Tania Bardsley (formerly of the Marine

Science Section of Museum Victoria), in appreciation of her

personal collaboration in my holothuroid research, and her

significant contribuiton to marine science systematics.

Remarks. Prototrochus taniae O’Loughlin sp. nov. is based

on 1 complete and 5 small part-specimens. The symmetrical

calcareous ring, with single long anterior projection on each

plate, and 10 tentacles, wheels with evenly distributed teeth

pointing towards the hub, and absence of rod ossicles, identify

the new species as a Prototrochus Beljaev and Mironov, 1982.

The angular rounded wheel rims, and 2 sizes of teeth, the

longer teeth aligned with spokes, distinguish P. taniae sp.

nov. from P. australis (Beljaev and Mironov), P. burni sp.

nov. and P. staplesi sp. nov(Table 1). In the SEM images of

the larger wheels in P. taniae Didier observed rare ones with

rounded rims and subequal teeth, but the wheels were

predominantly as described and illustrated with longer teeth

over the spokes. Beljaev and Mironov (1981) reported no such

character. Rare small wheels were observed in the SEM

images of the paratype of P. taniae, some with a rim like

P. staplesi sp. nov. and with more numerous spokes. The

New apodid species

Figure 11. Prototrochus taniae O’Loughlin sp. nov., paratype NMV F59192 (SEM by Didier VandenSpiegel). a, radial plates of calcareous ring

with canal (outer view left, inner view right; scale bar 100 pi m); b, wheels from body wall (scale bars 50 pim except bottom right bar 20 pim).

P. Mark O’Loughlin and Didier VandenSpiegel

diagnosis here is based on large wheel comparisons. The

lengths of the wheel teeth in the description above were

measured to the edge of the rim (for wheel diameter 240 pm

longer teeth 40 p m, shorter teeth 32 p m). The SEM

measurements (average 21.0 pm) were measured to the inner

rim (see fig. lOd).

Acknowledgments

We are grateful to the following for their assistance: Cynthia

Ahearn (literature); Leon Altoff, Audrey Falconer and Ian

Kirwan (photographs); Phil Bock and Tania Bardsley (SEM

images); Ben Boonen (format of images); Chris Rowley

(photography); Igor Smirnov (Russian translation); Jan Watson

(field data). We acknowledge the thorough work of the scientists

on the RV Franklin , Hai Rung and Tangaroa who found the

very small myriotrochid and taeniogyrid specimens. We are

grateful for the manuscript reviews by Dr T. D. O’Hara and Dr

F. W. E. Rowe and Dr A. S. Thandar.

References

Beljaev, G. M., and Mironov, A. N. 1981. New deep-sea species of the

Myriotrochidae (Holothuroidea) from the northern and south-

western parts of the Pacific Ocean. Academy of Sciences of the

USSR. Works of the Institute of Oceanology 115: 165-173, 1 plate.

(In Russian, with English abstract. Translation of relevant parts

provided by Igor Smirnov.)

Beljaev, G. M., and Mironov, A. N. 1982. The holothurians of the

family Myriotrochidae (Apoda): composition, distribution and

origin. Academy of Sciences of the USSR. Works of the Institute of

Oceanology 117: 81-120, pis 1-4. (In Russian, with English

abstract. Translation of relevant parts provided by Igor Smirnov.)

Brandt, J. F. 1835. Prodromus descriptionis animalium ab H. Mertensio

in orbis terrarum circumnavigatione observatorum. Petropoli

5(1): 1-75, 1 pi.

Clark, A. M., and Rowe, F. W. E. 1971. Monograph of shallow -water

Indo-West Pacific echinoderms. Pp. vii+238, 100 figs, 31 pis.

British Museum (Natural History): London.

Clark, H. L. 1921. The Echinoderm fauna of Torres Strait: its

composition and its origin. Carnegie Institution of Washington

Publication 214. 233 pp., 10 pis.

Clark, H. L. 1946. The echinoderm fauna of Australia. Its composition

and its origin. Carnegie Institution of Washington Publication

566: 567 pp.

Gage, J. D., and Billett, D. M. S. 1986. The family Myriotrochidae

Theel (Echinodermata: Holothurioidea) in the deep northeast

Atlantic Ocean. Zoological Journal of the Linnean Society

88: 229-276.

Heding, S. G. 1931. Uber die Synaptiden des Zoologischen Museums

zu Hamburg. Zoologische Jahrbiicher, Abteilung Systematik,

Jena 61: 637-698.

Joshua, E. C. 1912. On a new holothurian of the genus Taeniogyrus

found in Port Phillip Bay. Proceedings of the Royal Society of

Victoria 25(1): 80-81, pis 3, 4.

Joshua, E. C. 1914. Victorian Holothuroidea, with descriptions of new

species. Proceedings of the Royal Society of Victoria 27(1): 1-11,

figs 1^1.

Ludwig, H. 1889-1892. Echinodermen. I. Buch. Die Seewalzen, in: Dr

H.G. Bronn’s Klassen und Ordnungen des Thier-Reichs 2(3).

460 pp., 17 pis. C. F. Winter’sche Verlagshandlung, Leipzig.

O’Loughlin, P. M. 1984. Class Holothurioidea. Pp. 149-155 in:

Phillips, D. A. B., Handreck, C. P., Bock, P. E., Burn, R., Smith,

B. J., and Staples, D. A. (eds). Coastal Invertebrates of Victoria.

An Atlas of Selected Species. Marine Research Group of Victoria

in association with the Museum of Victoria: Melbourne.

Ostergren, H. J. 1898. Das system der Synaptiden. Ofvers Kongelige

Vetebskaps-Akademien Forhandlingar 55: 111-120.

Ostergren, H. J. 1907. Zur Phylogenie und Systematiek der Seewalzen.

Pp. 191-215 in Sartryck ur Zoologiska studier tillagnade

T. Tullbergpahans 65-ars dag. Almquist et Wiksell: Uppsala.

Rowe, F. W. E. 1976. Restriction of the chiridotid genus Trochodota

Ludwig (1891) (Holothurioidea: Apodida), with the description of

a new species from South Australia. Transactions of the Royal

Society of South Australia 100(4): 203-206.

Rowe, F. W. E., and Gates, J. 1995. Echinodermata in: Wells, A. (ed.).

Zoological Catalogue of Australia 33: i-xiii, 1-510. CSIRO:

Melbourne. (Referred to throughout this paper as Rowe (1995))

Semper, C. 1868. Holothurien. Reisen im Archipel der Philippinen

1: 1-288, pis 1-40.

Smirnov, A. 1997. New apodid holothurians (Holothurioidea, Apodida)

from the New Caledonian continental slope collected during

“BIOGEOCAL” expedition 1987. Zoosystema 19(1): 15-26.

Smirnov, A. V. 1998. On the classification of the apodid holothurians.

Pp. 517-522 in: Mooi, R. and Telford, M. (eds). Echinoderms: San

Francisco. Proceedings of the Ninth International Echinoderm

Conference. Balkema: Rotterdam.

Theel, H. 1877. Note sur quelques Holothuries des Mers de la Nouvelle

Zemble. Nova acta Regiae Societatis scientiarum upsaliensis

3(17): 1-18.

Memoirs of Museum Victoria 64: 71-78 (2007)

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/Memoirs/

A new fissiparous mie^e- asteriid from southern Australia (Echinodermata:

Asteroidea: Asteriidae)

Milena Benavides- Serrato 1 , P. Mark O’Loughlin 2 and Chris Rowley 3

'Echinoderms Curator, Colombian Museum of Marine Natural History (MHNMC), The Institute of Marine and Coastal Research “Jose Benito

Vives de Andreis” (INVEMAR), Santa Marta, Colombia 1016 (milena_benavides@invemar.org.co)

2 Honorary Associate, Marine Biology Section, Museum Victoria, GPO Box 666, Melbourne, Vic. 3001, Australia (pmo@bigpond.net.au)

Collection Manager, Marine Biology Section, Museum Victoria, GPO Box 666, Melbourne, Vic. 3001, Australia (crowley@museum.vic.gov.au)

Abstract Benavides-Serrato, M., O’Loughlin. P. M., and Rowley, C. 2007. A new fissiparous micro -asteriid from southern Australia

(Echinodermata: Asteroidea: Asteriidae). Memoirs of Museum Victoria 64: 71-78

The fissiparous micro-asteriid Allostichaster palmula Benavides-Serrato and O’Loughlin sp. nov. from south-

eastern Australia is described. The diagnostic characters of juveniles of the four other shallow asteriid genera and species

from south-eastern Australia are discussed: Allostichaster polyplax (Muller and Troschel); Coscinasterias muricata

Verrill; Smilasterias multipara O’Loughlin and O’Hara; Uniophora granifera (Lamarck). Diagnostic characters are

tabulated. Photos are provided. Lissiparity in these asteriids is noted. The R/r ratio is discussed.

Keywords Echinodermata, Asteroidea, Asteriidae, Allostichaster, new species, lissiparity, taxonomy

Introduction

The rocky littoral and shallow sublittoral coast of south-eastern

Australia has been surveyed thoroughly for marine

invertebrates. As a result, Museum Victoria houses many small

juvenile asteroid specimens. In this study the juveniles of the

family Asteriidae were isolated and determined. Four asteriid

species occur abundantly on this coast, and are represented in

the museum collections by many juveniles: Allostichaster

polyplax (Muller and Troschel, 1844); Coscinasterias muricata

Verrill, 1867; Smilasterias multipara O’Loughlin and O’Hara,

1990; Uniophora granifera (Lamarck, 1816). During this

study small specimens of a fifth asteriid fissiparous species

were found. This species is new to science, and is represented

by seven very small specimens. Recently a live specimen was

found in Port Phillip Bay, and photographed.

For comparative diagnoses, small juveniles of all five

asteriid species were compared, and photographed by Chris

Rowley using a Leica MZ16 stereomicroscope, Leica DC500

digital camera, and “Auto -Montage” software for composition

of images. Museum Victoria (NMV) registration number

prefix is F.

Forcipulatida Perrier, 1844

Remarks. In diagnosing the Forcipulatae, Perrier (1844)

referred to the 2-valved pincer-like pedicellariae, frequent

4 rows of tube feet, normally reticulate skeleton, and at least

part cover of spines that are rarely granular. Subsequently

Fisher (1928) noted for the order Forcipulata: stellate form with

5 or more arms, frequently long and slender; crossed and/or

straight pedicellariae; reticulate skeletal plates in definite

longiseries with marginal and carinal series usually regular;

ambulacral and adambulacral plates equal in number, short and

crowded, compressing the double series of tube-feet into 2

zigzag, 4 or even 6 longiseries; mouth plates frequently

inconspicuous, sunken in actinostome. Recently Liao and Clark

(1995) followed Blake (1987), and diagnosed the order

Forcipulatida as having “disc relatively small, often well-

defined, and arms almost cylindrical, marginals not conspicuous,

inferomarginals aligned ventrolateral ly; abactinal skeleton

usually reticulate but sometimes compact, at least a carinal

longitudinal series more or less evident; ambulacral plates

numerous, very short, often staggered, at least proximally, to

bring the suckered tube feet into four longitudinal series; oral

plates narrow; papulae also present on lower side; pedicellariae

consisting of a basal piece and two valves, either straight or

crossed, or both”. Our observations in this study found

conspicuous marginal plates on some species, and did not

always find papulae on the lower side. We question these recent

diagnostic characters of the Forcipulatida.

Asteriidae Gray, 1840

Remarks. Gray (1840) diagnosed his family Asteriadae as

“skeleton netted with a single mobile spine at each anastomosis

of the ossicula; body covered with more or less prominent

elongate mobile spines”. Fisher (1928) considered the Asteriidae

to be a “polyphyletic aggregation of genera placed for

Milena Benavides-Serrato, P. Mark O’Loughlin and Chris Rowley

Table 1. Diagnostic distinctions between Allostichaster palmula Benavides-Serrato and O’Loughlin sp. nov., Coscinasterias muricata Verrill,

Smilasterias multipara O'Loughlin and O’Hara and Uniophora granifera (Lamarck) for specimens with R up to 6 mm.

Diagnostic character

Allostichaster palmula

Coscinasterias muricata

Smilasterias multipara

Uniophora granifera

Number of arms

predominantly 6

predominantly 10

Fissiparity

fissiparous

non-fissiparous

Abactinal plates

closely imbricate

openly reticulate

closely imbricate

Dorsolateral plates

none

link carinal and

superomarginal plates

link carinal and

superomarginal plates

none

Carinal series

regular

irregular

Carinal plates

quadrilobed form

oblong-elliptical form

quadrilobed form

trilobed form

Abactinal spinelets

distally widened

or columnar;

coarsely spinous

styliform; acicular

spiniform

sub-capitate to

slightly tapered

deeply serrate

globose and

subcolumnar form;

finely spinous

Pedicellariae

crossed abactinally,

straight in furrow

crossed around

spines only

crossed only, not in

furrow

crossed only, not in

furrow

Superomarginal plates

lobed on proximal edge

cruciform

diamond shape

Superomarginal spinelets

up to 3 per plate

one per plate

two per plate

one per plate

Inferomarginal spines

single, broad blade distally

two styliform

one truncate, not flared

two globose

Actinal plates

none

long series

none

proximal to disc only

Table 2. Diagnostic distinctions between Allostichaster palmula Benavides-Serrato and O’Loughlin sp. nov. and Allostichaster polyplax (Muller

and Troschel) for specimens with R up to 6 mm.

Diagnostic character

Allostichaster palmula

Allostichaster polyplax

Form of arms

broad, not tapering, blunt

narrow, tapering, pointed

Abactinal spinelets

distally widened or columnar, coarsely

spinous

mostly globose, few columnar, finely spinous

distally

Form of carinal plates

quadrilobed

triangular

Superomarginal plates

proximal lobe prominent

lacking prominent proximal lobe

Inferomarginal plates

predominantly monacanthid

predominantly diplacanthid

Inferomarginal spines

narrow basally, short broad blade distally

elongate club-shaped

Adambulacral spines

pairs per plate digitiform, subequal

subambulacral spine broader than furrow

spine

A new fissiparous micro-asteriid

Figure 1. a, b. Allostichaster palmula Benavides-Serrato and O’Loughlin sp. nov. (NMV FI 13585, holotype): a, abactinal view showing blunt

arms, post-fissiparous form, paddle-like inferomarginal spines; b, actinal view showing evidence of 6 arms (2 large, 2 small, 2 detached not

shown), c, d. Allostichaster polyplax (Muller and Troschel) (F73988): c, abactinal view of regenerating arm showing clavate marginal spines; d,

actinal view showing post-fissiparity form and typical 8 arms, e, f. Allostichaster palmula (NMV FI 13566, paratype): e abactinal view showing

post-fissiparous form, carinal series, papular spaces, and paddle-like inferomarginal spines; f, actinal view showing 3 normal blunt arms and 2

detached not present.

Milena Benavides-Serrato, P. Mark O’Loughlin and Chris Rowley

Figure 2. a. Allostichaster palmula sp. nov. (NMV FI 13585): abactinal view showing 2 typical inferomarginal spines (centre) with distinct stem,

broad flat blade with vertical and radiating ribs, and coarsely serrate distal edge. b. Allostichaster polyplax (F73988): abactinal view showing

clavate inferomarginal spines, c. Allostichaster palmula (NMV FI 13566): abactinal view of disc showing distally widened, coarsely spinous,

spinelets, and small crossed pedicellaria (top), d. Allostichaster polyplax (F73988): abactinal view of proximal arm showing finely spinous globose

and subcolumnar spinelets, and small crossed pedicellaria (top), e. Allostichaster palmula (NMV FI 13566): abactinal view of arm showing carinal

series, papular spaces, and typical paddle-shaped inferomarginal spines (top), f. diagram showing typical skeletal plates of an arm of Allostichaster

palmula : a, adambulacral; i, inferomarginal; s, superomarginal; p, papular space (shaded); c, carinal (proximal ray at top).

A new fissiparous micro-asteriid

Figure 3. Asteriid species of the rocky shallows of the coast of Victoria, a, b. Coscinasterias muricata Verrill (NMV F73314): a, abactinal view

showing unequal arm lengths (fissiparous when juvenile), alternating spiniferous and non-spiniferous small carinal plates, and digitiform thin

marginal spines; b, actinal view showing 10 arms (2 very small regenerating) of a typically 11 arm species, c, d. Uniophora granifera (Lamarck)

(NMV FI 13567): c, abactinal view showing typical 5 equal rays, globose abactinal spinelets, and globose marginal spines; d, actinal view

showing globose spines with distinct stem, e, f. Smilasterias multipara O’Loughlin and O’Hara (NMV F121895): e, abactinal view showing

typical 5 equal rays, digitiform thin marginal spines; f, actinal view.

Figure 4. Live specimen of Allostichaster

palmula sp. nov. from 10-12 m at Popes

Eye in Port Phillip Bay (NMV F132700;

R = 1 .2 mm; 5 equal rays at this smallest

size; photo by Trevor McMurrich).

convenience under the aegis of Asterias”. He characterized the

family as having usually 5 or 6 rays, 5 primary longitudinal

series of plates (carinal, 2 superomarginal, 2 inferomarginal),

generally reticulate dorsal skeleton, crowded ambulacral plates,

and mostly 2 or 4 longiseries of tube feet. A.M. Clark (1962)

characterized the Asteriidae as having: usually 4 series of tube

feet, short adambulacral plates, usually straight pedicellariae at

least in the furrow, marginal spines not needle-like. Most

recently McKnight (2006) diagnosed the family as

“Forcipulatida with five or more arms, usually merging into the

disc, sometimes more sharply set off from it. Abactinal skeleton

reticulate, with longitudinal and transverse series of plates, or

reduced to isolated plates, in no apparent order. Skeleton

extending to tip of rays, the plates armed with one or more

spines or spinelets. Adambulacral plates short, with the spines

in a single transverse series, usually one or two, but up to seven

may be present. Tube feet in two or four rows”. The

morphological characters of the asteriid species in this study

are in accord with these diagnoses.

Allostichaster Verrill, 1914

Remarks. Verrill (1914) erected his genus for A. polyplax, and

diagnosed the genus as “diplacanthid and multiple rayed, with

one to five madreporic plates, and is probably autotomous. The

two rows of marginal plates are stout and imbricated; dorsal

plates and spines form five somewhat irregular longitudinal

rows, several short, obtuse spines on each plate. Minor

pedicellariae are dermal, usually not circumspinal”. Fisher

(1923) characterized Allostichaster as having: carinals and

superomarginals broader than other plates; narrow dorsolateral

area; fissiparous habit; superomarginal plates with beaded

surface. A.M. Clark (1962) noted for Allostichaster. rarely as

few as 5 arms; fissiparous habit; narrow dorso-lateral area.

Most recently McKnight (2006) diagnosed the genus as

“Asteriidae with the abactinal crossed pedicellariae scattered,

not in circumspinal wreaths; skeleton closeknit, plates in

definite longiseries; carinals and superomarginals broader than

other plates; adradial plates narrow, in a single straight or

zigzag series; inferomarginals form edge to arm; one series of

Milena Benavides-Serrato, P. Mark O’Loughlin and Chris Rowley

actinal plates. Adambulacral plates usually diplacanthid;

cleaned superomarginal plates with beaded area; multiple

madreporites, fissiparous, rays 5-8, often in 2 sizes”. We found

the morphological characters of Allostichaster polyplax to be

in accord with these diagnoses.

Allostichaster palmula Benavides-Serrato and O’Loughlin sp.

nov.

Figures 1-4, Tables 1, 2.

Material examined. Allostichaster palmula Benavides-Serrato and

O’Loughlin sp. nov. Holotype: SE Australia, Victoria, E Western Port,

San Remo, N of bridge, bank of main channel, shallows, soft sediment

or rocky substrate. Marine Research Group of Victoria, 13 Jan 1990,

NMV FI 13585 (dry, 6 arms; disc and 4 arms intact, 1 arm detached and

cleared of integument, 1 arm detached uncleared; max R = 2.5 mm,

r = 1 mm, R/r = 2.5).

Paratypes: E Victoria, Mallacoota, MSL Abalone Survey, VAC

S1Q2, 24 May 1987, F120432 (1, dry, 6 arms, 3 long, 3 very short,

whole specimen cleared of integument; max R = 5 mm, r = 1 mm, R/r

= 5); N Western Port, WBES Stn 1704, Bouchier Channel, S-M Grab,

12 m, sand, 9 Jan 1974, F87056 (1, dry, 3 arms; disc and 1 arm

complete, 2 arms detached; max R = 2.5 mm, r = 0.5 mm, R/r = 5);

NW Western Port, between Stony Point and Tankerton, dredge,

12 Nov 1974, F86026 (1, dry, 6 arms; disc with 2 arms complete;

4 detached arms; max R = 3 mm, r = 0.5 mm, R/r: 6); W Western Port,

dredged off Cowes, 2-5 m, 1977, F86023 (1, dry, 6 arms; disc and

5 arms complete, 1 arm detached; max R = 4 mm, r = 1 mm, R/r = 4);

Port Phillip Bay, Popes Eye, 10-12 m, found eating encrusting

bryozoan Membranipora on brown alga frond, J. Watson, R. Burn,

T. McMurrich, 29 Apr 2007, F132700 (1, ale, 5 arms, max R = 1.2 mm,

r = 0.7 mm, R/r = 1.7); 6-10 m, J. Watson, R. Burn, from alga, sponge,

hydroid, bryozoa sample, 6 Aug 2006, F113566 (1, dry, 5 arms; disc

and 3 arms complete; max R = 2 mm, r = 1 mm, R/r = 2).

Allostichaster polyplax (Miiller and Troschel, 1844). Victoria,

1 km E of Harmers Haven, CPA Stn 15, 300 m offshore, off algae,

6 Mar 1982, NMV F120422 (2, ale; 1 with 6 arms, max R = 6 mm,

r = 1.5 mm, R/r = 4; 1 with 6 arms, max R = 5.5 mm, r = 2 mm,

R/r = 2.75); Western Port, Crib Point Benthic Survey, CPBS Stn 03 S,

2 m, sandy-mud, 13 Apr 1965, F71968 (2, dry; 1 with disc and 3 arms

complete, 1 detached, max R = 3 mm, r = 1 mm, R/r = 3; 1 with 6

arms, 3 long, 3 very short, max R = 3 mm, r = 1 mm, R/r = 3); CPBS

Stn 12 N, mud and Zostera, 16 Apr 1965, F71967 (1, ale, 3 arms, 2

long, 1 very short, max R = 8 mm, r = 1 mm, R/r = 8); CPBS, Stn 10

O, 4 m, mud and Zostera, 24 Apr 1965, F71969 (1, dry, 7 arms; max

R = 6 mm, r = 1 mm, R/r = 6); Flinders, rocky shallows, 13 Apr 1985,

F120423 (1, ale, 5 arms, 3 long, 2 very short, max R = 6 mm, r = 1

mm, R/r = 6); Port Phillip Bay, Environmental Study Benthic Survey,

PPBES Stn 953 , 3 m, sand, 11 Jun 1971, F71975 (1 dry, 4 arms, 2

detached, max R = 7 mm, r = 1 mm, R/r = 7); Popes Eye, rocky

shallows, 30 Nov 1980, F73409 (1, dry, 5 arms, disc and 4 arms

complete, max R = 9 mm, r = 3 mm, R/r = 3); Point Cook, shallows,

F73405 (2, dry; 1 with 7 arms, 5 long, 2 very short, max R = 9 mm,

r = 1 mm, R/r = 9; 1 with 8 arms, max R = 8 mm, r = 2.5 mm,

R/r = 3.2); Tasmania, Derwent R. estuary, Opposum Bay, rocky

shallows, 15 Nov 1982, F73988 (1, dry, 8 arms, max R = 8 mm, r = 2

mm, R/r: 4).

Coscinasterias muricata Verrill, 1867. Victoria, Point Hicks,

subtidial rocky reefs, 10 m, 26 Mar 1996, FI 13590 (1, dry, 5 arms; max

R = 4 mm, r = 1 mm, R/r = 4); Flinders ocean platforms, algal epifauna,

0-2 m, 11 Aug 1990, F72193 (1, dry, integument cleared, 7 arms, 6

long, 1 very short, max R = 7 mm, r = 1 mm, R/r = 7); Port Phillip Bay,

Popes Eye, off algae, 30 Nov 1980, F73314 (1, dry, 10 arms, 8 long, 2

A new fissiparous micro-asteriid

very short, max R = 6 mm, r = 1 mm, R/r = 6); Western Australia,

Albany, Princess Royal Harbor, 1.6 m, 21 Jan 1988, F121890 (1, ale, 8

arms, max R = 5 mm, r = 1.5 mm, R/r = 3.33).

Smilasterias multipara O’Loughlin and O’Hara, 1990. Victoria,

Flinders ocean platforms, rocky shallows, 26 Feb 2000, F121895 (7,

ale; 1 dry, 5 arms, max R = 2.5 mm, r = 0.8 mm, R/r = 3.13).

Uniophora granifera (Lamarck, 1816). Victoria, Bunurong, off

Cape Paterson, subtidial rocky reefs, 10-11 m, 1 Apr 1997, F113567 (1,

dry, 5 arms, max R = 2 mm, r = 1 mm, R/r = 2); South Australia, Rapid

Bay jetty, sand, rubble, 12 m, 7 Apr 1980, F126862 (1, dry, 5 arms,

max R = 9 mm, r = 2 mm, R/r = 4.5); Smoky Bay, 12 m, sand and

weed, 25 Apr 1973, F120434 (1, dry, cleared of integument, max

R = 8 mm, r = 2 mm, R/r = 4).

Description. 6 discrete arms, or 5 (2 smallest); arms wide, not

tapering, rounded distally, max R = 5 mm, r = 1 mm, R/r = 5

(F120432); 6 specimens show post-fissiparous form, smallest

non-fissiparous; madreporites inconspicuous; arms flat

actinally, domed abactinally; margin acute, defined by

inferomarginal plates; oral plates inconspicuous; abactinal

plates thick, imbricate; disc plates irregular in form, imbricate,

larger than carinal plates, irregularly arranged; longitudinal

regular series of quadrilobed carinal plates, narrowly

imbricating longitudinally, imbricating with superomarginal

plates laterally; rare small dorso-lateral plates; superomarginal

plates largest, regular longitudinal series, plates transversely

elongate, proximal lobes narrowly imbricating longitudinally,

narrowly imbricating laterally with carinal and inferomarginal

plates; papular areas distinct, smaller than plates, 2 longitudinal

series between carinal and superomarginal plates;

inferomarginal plates longitudinally elongate; lacking actinal

plates; adambulacral plates transversely narrow, about 2-3

contiguous with each inferomarginal plate; 2 contiguous

proximal adambulacral plates forming adoral corona; tube feet

quadri serial.

About 2-3 spinelets per disc, carinal or superomarginal

plate; spinelets widened distally or columnar, coarsely spinous

distally; spinelets distributed irregularly over abactinal surface

of arms and disc; crossed pedicellariae present abactinally and

marginally, smaller than spinelets, not associated with

individual spinelets, scattered amongst spinelets;

inferomarginal plates predominantly monacanthid, rarely

diplacanthid; inferomarginal spines project widely from the

margin, each with proximal stem and distal broad flat blade

with vertical and radiating ribs, blade distally slightly rounded

and strongly serrate; adambulacral plates diplacanthid, single

series of subambulacral spines, single series of furrow spines,

pairs typically forming a “V”; adambulacral spines subequal,

shorter than inferomarginal spines, subclavate, subspatulate,

distinctly spinous distally; some straight pedicellariae

scattered in furrow, larger than crossed pedicellariae.

Colour (live). Upper proximal rays and disc brown, lower and

distal rays white, inferomarginal spines brown.

Distribution. SE Australia, Mallacoota to Port Phillip Bay,

sediment, 0-12 m.

Etymology. From the Latin palmula (blade of an oar), referring

to the distinctive form of the inferomarginal spines.

Remarks. Allostichaster palmula shares many diagnostic

characters with the other local shallow asteriid species

Allostichaster polyplax, Coscinasterias muricata,

Smilasterias multipara and Uniophora granifera : stellate

form with discrete rays; 5 primary longiseries of plates (1

carinal, 2 superomarginal, 2 inferomarginal); abactinal

skeleton of transverse arches on arms, forming a network of

rectangular or irregular mesh; both series of marginal plates

well developed; crossed and straight pedicellariae; tube-feet

in 4 longiseries. The diagnostic distinctions between these

species are listed in Tables 1 and 2.

Allostichaster palmula and A. polyplax share many

characters at R up to 6 mm: fissiparity; predominantly 6 rays;

large, thick, imbricate abactinal plates; prominent abactinal

series of carinal and superomarginal plates; lack dorsolateral

and actinal plate series; superomarginals are largest plates;

paired longitudinal series of prominent papular spaces

abactinally; scattered, distally-widened abactinal spinelets;

crossed pedicellariae abactinally; straight pedicellariae in

furrow, orally; 2 pairs of post-oral adambulacral plates form

adoral corona, with post-oral plates joined along interradial

margins; adambulacral plates diplacanthid, pairs typically

forming a “V”, with 2 single series of furrow and subambulacral

spines. The diagnostic distinctions between the 2 species are

listed in Table 2.

The pedomorphic new species Allostichaster palmula

exhibits the diagnostic characters of the order Forcipulatida,

family Asteriidae, and genus Allostichaster referred to above.

However, the small specimens do not have actinal plates and

madreporite plates were not recognized. As noted above, the

marginal plates are conspicuous, and there are no ventrolateral

papulae.

For the 3 fissiparous species, R/r ratios vary greatly and

reflect the variable regenerating arm lengths following

fissiparity: A. palmula from 1.7 to 6; A. polyplax from 2.8 to

9; C. muricata from 3.3 to 7. But with each of these fissiparous

species the largest ratio was measured on the largest specimen,

suggesting from this limited sample that R/r increases with

maximum R. This is true for the 3 specimens of the non-

fissiparous U. granifera, with R/r increasing from 2 (R = 2

mm) to 4.5 (R - 9 mm). A. polyplax adults have predominantly

8 arms. C. muricata adults have predominantly 11 arms.

Neither of these maxima was evidenced in specimens below

R - 8 mm, suggesting that arm number increases with size in

these fissiparous species. In the new species A. palmula the 2

smallest specimens have only 5 arms, the rest 6 arms. We

note that the smallest specimen of C. muricata (R = 4 mm)

has 5 equal arms and does not show evidence of fissiparity,

suggesting that fissiparity does not occur until R > 4 mm.

Likewise the smallest specimen of A. palmula (R = 1.2 mm)

has 5 equal arms and does not show evidence of fissiparity,

suggesting that fissiparity does not occur until R > 1.2 mm.

Other characters are also size-dependent, such as the presence

of actinal plates in larger specimens of A. polyplax.

O’Loughlin and Rowe (2006) described 2 micro-species of

fissiparous Asterinidae, with maximum R = 5 mm: Aquilonastra

colemani from Papua New Guinea and Indonesia, and

Aquilonastra doranae from Okinawa. Allostichaster palmula

is a comparably small-sized micro-asteriid, with maximum

R - 5 mm. These are the smallest known asteroid species.

Acknowledgments

We are grateful to: Bob Burn, Jan Watson and Trevor

McMurrich for recognizing, collecting and photographing the

live specimen at Popes Eye; the many survey personnel whose

careful work brought the specimens of this very small seastar

into the Museum collections; Ben Boonen for preparation of

the figures; and referees Alan Dartnall and Frank Rowe for

their careful reviews of the paper.

References

Blake, D. B. 1987. A classification and phylogeny of post-Palaeozoic

sea stars (Asteroidea: Echinodermata). Journal of Natural History

21(2): 481-528.

Clark, A. M. 1962. Asteroidea. Reports of B.A.N.Z. Antarctic Research

Expedition, 1929-1931. Series B (Zoology and Botany) 9.The

Griffin Press: Adelaide. 104 pp., 18 figs, 14 tbls, 6 pis.

Fisher, W. K. 1923. A preliminary synopsis of the Asteriidae, a family

of sea-stars. Annals and Magazine of Natural History 9(12)28,

62: 247-258, 595-607.

Fisher, W. K. 1928. Asteroidea of the North Pacific and adjacent waters.

2: Forcipulata. United States National Museum Bulletin 76: 1-245.

Gray, J. E. 1840. A synopsis of the genera and species of the class

Hypostoma (Asterias Linnaeus). Annals and Magazine of Natural

History (1)6: 175-184; 275-290.

Eamarck, J. B. P. A. de 1816. Stellerides. Pp. 522-568 in: Histoire

naturelle des animaux sans vertebres 1(2). Verdiere, Paris .

Milena Benavides-Serrato, P. Mark O’Loughlin and Chris Rowley

Eiao, Y., and Clark, A. M. 1995. The echinoderms of southern China.

Science Press: Beijing. 614 pp., 23 pis.

McKnight, D. G. 2006. The Marine Fauna of New Zealand.

Echinodermata: Asteroidea (Sea-stars). 3. Orders Velatida,

Spinulosida, Forcipulatida, Brisingida with addenda to Paxillosida,

Valvatida. NIWA Biodiversity Memoir 120. National Institute of

Water and Atmospheric Research Etd (NIWA): Wellington.

187 pp.

Miiller, J., and Troschel, F. H. 1844. Beschreibung neuer Asteriden.

Archiv fiir Naturgeschichte 10(1): 178-185.

O’Foughlin, P. M., and O’Hara, T. D. 1990. A review of the genus

Smilasterias (Echinodermata, Asteroidea), with descriptions of

two new species from south-eastern Australia, one a gastric

brooder, and a new species from Macquarie Island. Memoirs of

the Museum of Victoria 50(2): 307-323.

O’Eoughlin, P. M., and Rowe, F. W. E. 2006. A systematic revision of

the asterinid genus Aquilonastra O’Eoughlin, 2004

(Echinodermata: Asteroidea). Memoirs of Museum Victoria 63(2):

257-287.

Perrier, E. 1884. Memoire sur les etoiles de mer recueillies dans la

Mer des Antilles et le Golfe du Mexique. Nouvelles Archives du

Museum National d’ Histoire Naturelle (Paris) 6(2): 127-276.

Verrill, A. E. 1867. Notes on the Radiata in the Museum of Yale

College, with descriptions of new genera and species. 1.

Descriptions of new starfishes from New Zealand. Transactions

of the Connecticut Academy of Arts and Sciences 1(2)5: 247-251.

[Also in: Transactions and Proceedings of the New Zealand

Institute (1880) 12(34): 278-283]

Verrill, A. E. 1914. Monograph of the shallow-water starfishes of the

North Pacific coast from the Arctic Ocean to California. Harriman

Alaska Series, Smithsonian Institution 14: 1-408, 110 pis.

Memoirs of Museum Victoria 64: 79-94 (2007)

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/Memoirs/

A new species of Colossendeis (Pycnogonida: Colossendeidae) together with

records from Australian and Ne^. ealand waters

David A. Staples

Museum Victoria, GPO Box 666, Melbourne, Victoria 3001 Australia (dstaples@museum.vic.gov.au)

Abstract Staples, D. A. 2007. A new species of Colossendeis (Pycnogonida: Colossendeidae) together with records from Australian

and New Zealand waters. Memoirs of Museum Victoria 64: 79-94.

Six species of the genus Colossendeis Jarzynsky, 1870 and one species of Hedgpethia Turpaeva, 1973 are reported

from Australian and New Zealand waters; namely Colossendeis arcuata Milne-Edwards, 1885, C. colossea Wilson, 1881,

C. tasmanica sp. nov, C. melancholicus Stock, 1975, C. spicula Child, 1994, C. mycterismos Bamber, 2004 and Hedgpethia

dampieri (Child, 1975). Colossendeis melancholicus, C. spicula and C. mycterismos are recorded from the region for the

first time. Diagnoses for each species are provided. Type specimens of Hedgpethia dampieri have been re-examined.

Keywords Pycnogonida, southern Australia, north-west Australia, New Zealand, Colossendeidae, Colossendeis, Hedgpethia, deep-

sea, Tasman Sea, NORFANZ.

Introduction

This paper reports on pycnogonid material belonging to the

family Colossendeidae collected from Australian and New

Zealand waters, between approximate latitudes of 21°S and

55°S. Although not represented in the collection sites, New

Caledonia partly falls within these latitudes and three species

from that area are also included. Two genera belonging to this

family are represented in this report; Colossendeis Jarzynsky,

1870 and Hedgpethia Turpaeva, 1973. Colossendeis is typically

a deep-sea genus that includes the largest pycnogonids,

commonly with far-ranging distributions. Because of their

size, frequently with leg spans ranging from 40-50 cm,

Colossendeis is the most conspicuous genus represented in

deep-sea trawls. Colossendeis was first recorded from the

Australian region by Hoek (1881) from Challenger station 158

(latitude about 50° S). Clark (1963) and Child (1995)

subsequently recorded specimens from the Great Australian

Bight, Western Australia and from south of Tasmania

respectively. Child (1998) provided an excellent review of the

pycnogonid fauna of New Zealand between approximate

latitudes of 25°S to 55°S. He documented nine species of

Colossendeis and described one new species of Hedgpethia

but appears to have overlooked Fage’s (1956) report on the

pycnogonids collected by the Galathea expedition in which

five species of Colossendeis from New Zealand waters were

recorded. The number of specimens available for study has

increased substantially in recent years, reflecting the increased

activity in deep-sea research in the region. This report records

a further four species of which one is new and three represent

new records. A large number of specimens collectively

grouped under the macerrima complex of species (Stock,

1978), will be the subject of a separate paper. Deep-sea

observations of a Colossendeis swimming off the bottom

(Grassle et al., 1975), another floating near the bottom (Monod,

1954) and records from bathypelagic samples (Bamber, 2002;

Mauchline, 1984) support the probability that distribution of

some species is assisted by slow-moving currents found at

these depths.

Unlike Colossendeis, which may be collected in large

numbers, Hedgpethia species are usually represented by one

or two species from few collecting sites. Hedgpethia does not

reach the great size of most Colossendeis, and although they

share a wide depth range, they generally extend into much

shallower depths. Three species of Hedgpethia are represented

from Australia, New Zealand and New Caledonia. This

collection is predominantly based on sampling by the

Australian Commonwealth Science and Industry Research

Organization (CSIRO) vessels RV Franklin and RV Southern

Surveyor from localities in the Tasman Sea, off the New South

Wales and Victorian coasts, the east and west coasts of

Tasmania, off the South Australian coast and the south and

north west Western Australian coast. Specimens were recorded

between latitudes 20°95.01'S and 41°54.54'S at depths ranging

from 55 m to 2800 m. The NORFANZ voyage material is part

of a larger collection by the New Zealand research vessel RV

Tangaroa in a deep-sea trawling expedition around Norfolk I.,

Lord Howe I. and northern New Zealand from 10 May to

8 June 2003. The expedition documented the biodiversity of

David A. Staples

the marine fauna from seamounts and slopes on the Norfolk

Ridge and Lord Howe Rise. A brief diagnosis of species

represented in this report together with additional figures, is

provided to supplement existing descriptions. Specimens are

lodged in the South Australian Museum (SAM); Australian

Museum (AM); Museum Victoria (NMV); Tasmanian Museum

and Art Galleries (TMAG) and Western Australia Museum

(WAM). Duplicate NORFANZ specimens have been lodged

in the National Museum of New Zealand, Te Papa (NMNZ).

2 pecies of Colossendeis and Hedgpethia known from the

Australian and NevK ealand region

Colossendeis angusta Sars, 1877

Colossendeis arcuata Milne-Edwards, 1885

Colossendeis australis Hodgson, 1907

Colossendeis bruuni Fage, 1956

Colossendeis colossea Wilson, 1881

Colossendeis cucurbita Cole, 1909

Colossendeis drakei Caiman, 1915

Colossendeis hoeki Gordon, 1944

Colossendeis longirostris Gordon, 1938

Colossendeis macerrima Wilson, 1881

Colossendeis media Hoek, 1881

Colossendeis megalonyx Hoek, 1881

Colossendeis melanocholicus Stock, 1975

Colossendeis minor Schimkewitsch, 1893

Colossendeis mycterismos Bamber, 2004

Colossendeis pipetta Stock, 1991

Colossendeis sinuosa, Stock, 1997

Colossendeis spicula Child, 1994

Colossendeis tasmanica sp. nov.

Colossendeis tortipalpis Gordon, 1932

Hedgpethia dampieri (Child, 1975)

Hedgpethia eleommata Child, 1998

Hedgpethia tibialis Stock, 1991:166

Colossendeidae Hoek, 1881

Diagnosis. Trunk and legs typically glabrous. Lateral processes

short, either clearly separated or crowded. Proboscis long,

typically longer than trunk. Chelifores present or absent in

adults. Palps 10-segmented (one species with 9 segments), basal

segments 1 and 2 very short. Ovigers 10-segmented, terminal

claw strong, strigilis well-formed. Legs long, 4, 5 or 6 pairs,

auxiliary claws absent.

Colossendeis Jarzynsky, 1870

Diagnosis. Specimens often large; trunk unsegmented, smooth

(very rarely with spines), tubercles or ridges absent; lateral

processes usually clearly separated. Abdomen well-developed,

usually articulated at base. Ocular tubercle low, rounded or

conical, sometimes terminally acute; 2-4 eyes present, or

absent. Chelifores absent in adults. Palps and ovigers touching

at bases; strigilis tightly curved, terminal claw strong. 4 pairs

of legs, large propodal heel spines absent, main claw long or

short, genital pores tiny. Sexual dimorphism little understood.

Remarks. Pale areas principally defined by a change of texture

of the integument, are present on the dorsal surface of the 2nd

coxa of all legs of most species. These areas are comprised of

thinner cuticle and are either flat or blister-like (fig. 7B).

Provisionally referred to as coxal glands (Staples, 2002: 541),

the term coxal pellicula (= filmy protective covering) is now

used to avoid implying a function and purpose which has not

been established. Similar areas have also been noted in

Pentapycnon (Bouvier, 1913) and Pycnogonum (Flynn, 1919).

In some instances they resemble large genital pores and probably

represent what Stiboy-Risch (1993) described and illustrated as

dorsal genital openings in C. glacialis Hodgson, 1907, C. arcuta

Stiboy-Risch, 1993 and C. robusta Hoek, 1881. As far as I am

aware, the genital pores of all Colossendeis are placed ventrally

on the 2nd coxae of some, or all legs. A single gland opening on

the outer surface of palp segment 5 and the ecto-posterior surface

of oviger segment 4 is present in most species.

Colossendeis arcuata A. Milne-Edwards, 1885

Figures 1A-J, 1C, D.

Colossendeis arcuatus A. Milne-Edwards, in Filhol, 1885:151,

fig. 48.

Colossendeis arcuata Stock, 1978: 403—405, fig. lg-j [earlier

synonymy]; Stock, 1986: 417— Bamber, 1983: 71-72, fig. 5; Bamber,

2004, 6-Child, 1992: 41; Child, 1998, 56-Bamber and Thurston,

1993: 859; Bamber and Thurston, 1995:143-45, fig. 9E.

Material examined. South Australia. Investigator Group, approx 75 n

miles SSW of Pearson I., 35°08'S, 132°47'E, 1000 m, trawled, 1989,

SAME3383(1 specimen). Approx 100 n miles SSEofCape de Covedic,

Kangaroo I., 37°S, 137’E, 900-1000 m, trawled, FV Comet, G. Newton,

14-8 Feb 1988, SAM E3384 (1 specimen). Approx. 120 n miles SW of

Cape Adieu, Great Australian Bight, 33°58’S, 13 1°22'E, 1000 m, trawled,

FV Saxon Progress, P. Wheenan, Nov 1989, SAM E3385 (1 specimen).

Due SW of Kangaroo I., approx. 36°10'S, 135°45'E, 1060 m, ‘orange

roughy’trawl, G. Newton, July 1988, SAM E3387 (1 specimen). Western

Australia. Approx. 1 1 n miles due S of Eucla, Great Australian Bight,

33°31'S, 128°49'E, 1059-1914 m, FV Longva 111, K. Gowlett-Holmes,

10 Dec 1989, SAM E3386 (1 specimen).

Diagnosis. A large, robust species. Trunk and proboscis covered

in tiny but mostly inconspicuous, spinules. Ocular tubercle lowly

conical in lateral view, two large eyes on the sloping anterior

surface, unpigmented in preserved material. Proboscis 1.25-1.50

times length of the trunk, robust, down-curved throughout its

length. Abdomen clavate, articulated with trunk. Palp segment 3

longest, segment 5 less than half length segment 3, distal segments

characteristically doubly-recurved. Oviger claw linear, gently

curved. Legs; tarsus about three-quarters length of propodus,

claw less than one quarter propodus length.

Distribution. Cosmopolitan. Depth 730-2177 m.

Type locality. W of Moroccan Coast.

Records of Colossendeidae from Australian Waters

Figure 1. Colossendeis arcuata (SAM E3384): A, B, trunk, dorsal and ventral views of trunk; C, cephalon, lateral; D, palp; E, oviger;

F, oviger claw; G, leg 3; H, propodus and claw; I, coxa 2 and genital pore; (SAM E3383); J, abdomen.

David A. Staples

Figure 2. Colossendeis colossea (NMV J40745): A, dorsal view of trunk; B, palp; C, palp segments 8 to 10; D, tip, palp segment 10; E, oviger;

F, oviger segments 7-10; G, oviger segment 10; H, oviger spines; I, tarsus and propodus leg 3; J, abdomen, dorsal.

Records of Colossendeidae from Australian Waters

Figure 3. Colossendeis tasmanica (J48897): A, B, dorsal and lateral views of trunk; C, ocular tubercle; D, tarsus and propodus; E, oviger;

F, oviger segment 10; G, (J40744), juvenile oviger segment 10; H, oviger spines; I, palp; J, palp segments 8-10; K, tip, palp segment 10.

David A. Staples

Figure 4. Hedgpethia dampieri Child, 1975 (NMV J48903): A, Trunk, lateral view; B, ocular tubercle; C, oviger segment 10; holotype (WAM

70-3953) D, oviger spine. Colossendeis spicula (NMV J54504): E, palp; F, leg 2; G, tarsus and propodus; H, oviger.

Records of Colossendeidae from Australian Waters

Figure 5. Colossendeis melancholicus (NMV J48898): A, B, dorsal and lateral views of trunk; C, ocular tubercle; D, oviger segments 7-10;

E, leg 2; F, tarsus and propodus leg 2; G, claw; H, palp.

David A. Staples

Figure 6. Colossendeis mycterismos sp. nov. holotype (NMV J48824): A, B, dorsal and lateral views of trunk; C, oviger; D, oviger segments 7-10;

E, palp; F, leg 3; G, tarsus and propodus.

Records of Colossendeidae from Australian Waters

Figure 7. A. Colossendeis colossea, dorsal (Photo Gowlett-Holmes, CSIRO) B. Colossendeis melancholicus. (J40746), coxal pellicula. (Photo

D.A. Staples) C. Colossendeis arcuata ( SAM E3383) genital pore, leg 3. D. Colossendeis arcuata ( SAM E3383) sensory setae, oral surface.

(Photos D.A. Staples)

Remarks. These specimens agree in all respects with previous

observations. Scattered cone-shaped pits each with a single

median spine surround the oral surface and presumably serve a

sensory function (fig. 7D). The down-curved proboscis of this

species resembles C. rostrata Turpaeva, 1994 from which it

otherwise differs in the proportions of palp segments 3 and 5

and by having the trunk and legs covered in small spines; the

slightly taller spines on the leg segments are interspaced by 5-7

shorter spines. The leg span is about 400 mm. Coxal pellicula

are present on all legs. Genital pores (fig. 7C) tiny, round, on

distoventral surface of coxa 2 of all legs.

This is the first record for Australian waters, although it

has been recorded from nearby New Zealand (Child, 1998).

Colossendeis colossea Wilson, 1881

Figures 2A-J, 7A, Table 1.

Colossendeis colossea Wilson, 1881: 224-246, pl.l, fig. 1, pi. 3,

figs 5-7— Fry and Hedgpeth 1969: 53-54 [earlier literature], fig. 8—

Stock, 1975: 987; Stock, 1987: 508 (literature)— Bamber and Thurston,

1993: 859; Bamber and Thurston, 1995: 143-144, 147-Child, 1994:

10-11; Child, 1995: 76; Child, 1998: 56-57-Bamber, 1995: 147.

Material examined. Western Australia. 80 km WNW of Green Head,

from 29°51.9'S, 114°11.6'E, bottom 770 m, to 29°50.3'S, 114°10.9'E,

bottom 760 m. Western Deep-Water trawl, RV Southern Surveyor, M.

F. Gomon and CSIRO, 7 Feb 1991 (SSOl/1991 stn 62), NMV J40745

(2 specimens). NW Australia, 20°95.01'S, 114°.01.58'E to 20°98.82'S,

113°99.38’E, 1018 m. Benthic Dredge, RV Southern Surveyor, CSIRO,

9 Jun 2007, (SS05/07 stn 002), NMV J55743 ( 1 specimen).^ NORFANZ

Ford Howe Rise, 32° 03.98’S, 159°52.80’E, 1934 m. Ratcatcher bottom

trawl, 24 May 2003, (Tan 0308, stn 071), NMV J48818 (1 specimen).

West Norfolk Rise, Wanganella Bank, 35°35.83'S, 169°33.43'E,

1760 m. Ratcatcher bottom trawl, 5 Jun 2003, (Tan 0308, stn 167),

NMV J53079 (4 specimens). Ford Howe Plateau, 32°25.94’S

161°47.62'E, 1132 m to 32°25.08'E 161°44.31'S, 1197 m. Ratcatcher

bottom trawl, 24 May 2003, (Tan 0308, stn 73), MNZ PY.55 (2

specimens). South Australia. Approx 80 n miles SW of Cape du

Covedic, Kangaroo I. from 36°38'S, 137°08.20'E, to 36°30'S, 137°20'E,

1000-1200 m, trawled, FV Adelaide Pearl, KJ. Olsson, Aug 1988,

SAM E3389 (2 fragmented specimens). Tasmania. E of Piccaninny

Point, Tasman Sea, 41°40’S, 148°41’E, 1097 m, amongst orange roughy

haul, FV Pacific Dynasty, (no date), AM P6 111 (1 specimen).

David A. Staples

Diagnosis based on specimens in this collection : A large

species. Trunk smooth, unsegmented, lateral processes clearly

separated. Proboscis straight, bottle-shaped, 1.7-1. 9 times

length of trunk, 5.8-6. 8 times as long as greatest width, basal

third narrowest, mid-region swollen, slightly tapering to 1.1-1 .4

times basal width at tip. Abdomen articulated, clavate, 13-18%

of trunk length. Palp segment 3 longest, segment 10 very

slender, length 7. 5-9.3 times median width, tapering evenly to

rounded tip. Oviger claw and segment 10 coalesced; length of

segment 10, 4.3-5.2 times distal width and conspicuously

tapered to form a continuum with terminal claw.

Expanded description based on specimens in this collection.

First lateral processes inclined and the cephalon angled

downwards at about 45°. 2nd and 3rd lateral processes separated

by one-quarter to one-third basal widths. Post-ocular mound low

and lacking the internal tubules found in the surrounding cuticle,

two eyes unpigmented in preserved material. Ocular tubercle

variable, either conical or broad in anterior view, with or without

small mid-dorsal papilla; lateral sensory organs well-defined.

Palp segment 3, 1. 1-1.2 times as long as segment 5; segment 7

about twice segment 6, 1.9-2. 1 times segment 8; segment 8,

1. 1-1.4 times as long as segment 9; segment 10, 1.0-1. 4 times

length of segment 9, segment 10 with 3 to 4 forward-facing

spines, segments 7-9 more spinous than remaining segments.

Segment 5 has a single gland on external surface. Oviger

segment 6 longest, about 1.1 times as long as next longest,

segment 4; segment 4 has a single gland opening at about 75%

of its length, segments 4-6 with scattered small, simple spines,

distal four segments each bearing a dense field of long spines on

the raised sole of each segment, spines spatulate, some with

faint marginal serrations and obscure crenulation; terminal claw

hooked, slightly skewed. Legs about 12 times length of trunk.

Femur gently curved, 35-38 times as long as distal width, femur

and tibia 1 subequal, tibia 1 about 22% longer than tibia 2, the

tarsus is 1. 7-2.3 times as long as the propodus and the claw

47-6 1 % of the propodal length. Genital pores are on the proximal

surface of a low distoventral transverse ridge on legs 3 and 4;

those of some specimens about half the size of larger pores,

possibly indicating sexual dimorphism. Coxal pellicula present

on the dorsal surface of coxa 2 of all legs.

Distribution. A cosmopolitan deep-sea species. Regional

records from Campbell Plateau, SE of Bounty Is; Lord Howe

Rise and Raukkumara plain, E of North Island New Zealand.

East, south and west coasts of Australia. Rarely recorded south

of the Antarctic convergence. Depth, 647-5219 m.

Type locality. Eastern coast United States, ( Blake stn 307,

41°29.45'N, 65°47.10'W).

Remarks. These specimens ranged in size from 255 to 530 mm

and agree in all significant respects with Wilson’s description

of the holotype. In the light of this material, additional

observations of intraspecific variability are noted. The distal 3

palp segments are usually recorded as being subequal, whereas

in this material there are consistent but small differences. In

the absence of a segmentation line separating the oviger claw

from segment 10, the length of the segment is measured from

the basal margin of the segment, to the distal end of the spine

field and the width of the segment from the outer margin of the

segment to the same point at the base of the spines. In life

(specimen NMV J55743), the trunk and longer leg segments

were generally a straw-colour; the proboscis, palps and ovigers

a deep orange-red; the ocular tubercle, coxae and propodi of a

lighter shade. The proboscis was almost blood red when the

specimen was first retrieved but soon changed to match the

palps and ovigers (fig. 7A). In contrast to preserved specimens

with unpigmented eyes, the eyes were highly reflective, possibly

luminescent. Hedgpeth’s (1948: 272) observation of the species

being bright orange-scarlet in life may be a generalization or

indicate intraspecific colour variation.

Colossendeis tasmanica sp. nov.

Figures 3A-H, Table 1

Material examined. Holotype: Tasmania, E of Furneaux Group from

39°48.27'S, 149°06.02'E 1923 m, to 39°47.06'S, 149°05.19'E, 1962 m,

McKenna Market trawl. RV Southern Surveyor, CSIRO, 29 Apr 2000

(SS01/00 stn 260), NMV J55741.

Paratypes: Details as for holotype, NMV J55742 (4 specimens).

Other material. New South Wales. 67 km ENE of Nowra, from

34°41.97'S, 151°22.44'E, 1896 m, to 34°42.14'S, 151°21.72'E, 1642 m,

3.5 m beam trawl, RV Franklin , G.C.B. Poore et al., 22 Oct 1988 (stn

Slope 59), NMV J54503 (3 specimens). Off Nowra, from 34°58.40'S,

151°23.20'E, bottom 1750 m, to 34°56.40'S, 151°29.10'E, bottom 1650

m to 1750 m, trawl, 5 m Otter, RV Franklin, M.F. Gomon et ah,

16 Jul 1986 (stn Slope 15), NMV J40746 (2 specimen). 100 km ENE

Nowra, from 34°34.43'S, 151°40.82'E, 2800 m, to 34°34.45'S,

151°39.89’E, 2700 m, trawl, 3.5 beam, RV Franklin, G.C.B. Poore et

ah, 23 Oct 1988 (stn Slope 60), NMV J40742 (2 specimens). Tasmania.

E of Furneaux Group from 39°48.27'S, 149°06.02'E 1923 m, to

39°47.06'S, 149°05.19'E, 1962 m, McKenna Market trawl, RV Southern

Surveyor, CSIRO, 29 Apr 2000 (SS01/00 stn 260), NMV J48897 (30

specimens). E of Furneaux Group from 39°48.27'S, 149°06.02'E 1923

m, to 39°47.06'S, 149°05.19'E, 1962m, McKenna Market trawl, RV

Southern Surveyor, CSIRO, 29 Apr 2000 (SS01/00 stn 260), MNZ

PY.56 (2 specimens). 41 km NE of Cape Tourville, Freycinet Peninsula,

from 41°54.54'S, 148°45.15'E, 1273 m, to 41°42.60'S, 148°42.60'E,

1190 m, trawl, 3.5 beam, RV Franklin, G.C.B. Poore et ah,

30 Oct 1988, (stn Slope 83), NMV J40743 (1 specimen), victoria.

85 km E of Point Hicks from 38 0 31.41'S, 149°21.10'E, 1986 m, to

38°30.58'S, 149°21.50'E 1360 m, 3.5 m beam trawl, RV Franklin,

G.C.B. Poore et ah, 26 Oct 1988, (stn Slope 72) NMV J40744, (18

specimens). 38°30.66'S, 149°22.99’E to 38°30.89'S, 149°21.63'E,

1859 m, Epibenthic sled, RV Southern Surveyor, CSIRO, 19 Apr 2000,

(SS01/00 stn 172), NMV J48899 (4 specimens).

Diagnosis. A large species. Colossendeis colossea- like. Lateral

processes clearly separated. Proboscis bottle-shaped, 1. 7-2.0

times length of trunk, straight, median swelling preceded by

narrower basal part and tapering distally to terminate in a

rounded oral surface. Abdomen articulated, maximum width

in distal one -third, length 19-29 % of trunk. Palp segment 3

longest, segment 10, 6.3-7.4 times as long as median width.

Oviger 10-segmented, terminal claw strongly curved, distinctly

articulated with segment 10, segment 10 not tapered distally.

Description of holotype. (Range of variability in brackets). Leg

span up to about 550 mm (400-550 mm). 2nd and 3rd lateral

processes separated by about one-sixth of basal width (one-sixth

Records of Colossendeidae from Australian Waters

to greater than half). Cephalon directed downwards slightly.

Ocular tubercle bluntly conical with apical papilla (bluntly

conical or broad in anterior view, mid-dorsal papilla variably

developed), 2 well-developed eyes, unpigmented in preserved

specimen, lateral sensory organs prominent; post-ocular mound

low. Abdomen originating from lateral surface between 4th pair

of legs, length 21% (19-29%) of trunk, clavate, anus on

dorsodistal surface. Proboscis 2.0 (1.7-2. 0) times length of trunk

and 6.4 (6. 1-6.8) times as long as maximum width (subadults

about 7.2 times), straight, median swelling preceded by narrower

basal part and tapering distally to terminate in a rounded oral

surface, width at tip 1.3 (1.2-1. 4) times basal diameter. Oviger

10-segmented, terminal oviger claw hooked and distinctly

articulated with segment 10; proximal and distal widths of

segment 10 about equal, length 3.4 (2. 5-3. 5) times distal width

(measured from outer margin to base of spines); strigilis strong,

carried somewhat horizontally with claw resting against outer,

or lower, side of segment 10; spine fields on segments 7-10

dense, trailing edge spines longer, laid-back, individual spines

each with fine marginal serrations, particularly evident in

subadults (fig. 3H), scattered, short, simple, spines on longer

segments; segment 6 marginally longer than segment 4 (equal to

1.1 times), single gland opening on interior surface of segment 4

at about 75% of length. Palp segment 3, 1.2 times longer than

segment 5 (1.0-1. 2); segment 7, 2.4 times segment 6 (2. 2-2. 5);

segment 10 narrowing markedly towards tip, slightly irregular

distally with a slight to marked constriction, length 7.3 (6.3-7.4)

times median width, with 3 to 4, forward-facing spines at the tip

(fig. 3K) and 2^4 strong spines on inner and ventral margins,

smaller spines all over; spines most abundant on segments 7 and

8; single gland openings on outside surface of segment 5. Leg

length 12.2 (9.3-12.2) times trunk, longer segments with

scattered, short spines, femur curved, 25-33 times as long as

distal width, equal to, or a little longer than tibia 1; tibia 1 about

25% longer than tibia 2, tarsus 1.7-2. 8 times propodus; terminal

claw 40-72% length of propodus; coxal pellicula are present on

the dorsal surface of coxa 2 of all legs in adult forms, absent or

not evident in subadults; genital pores on the proximal surface

of a low distoventral transverse ridge on legs 3 and 4.

Measurements of holotype (in mm). Length trunk (frontal

margin cephalic segment to tip 4th lateral process), 21.5; width

across 2nd lateral processes, 11.0; length proboscis (lateral)

42.0; greatest width proboscis, 6.6; length abdomen, 4.5. Third

leg: coxa 1, 3.1; coxa 2, 5.3; coxa 3, 5.3; femur, 86.0; tibia 1,

86.0; tibia 2, 68.0; tarsus, 5.5; propodus, 3.5; claw, 1.5.

Measurement of palp segments (in mm). Seg. 1, 1.3; seg. 2, 0.8;

seg. 3, 13.1; seg. 4, 2.1; seg. 5, 16.7; seg. 6, 4.2; seg. 7, 10.1;

seg. 8, 4.6; seg. 9, 3.9; seg. 10, 4.1.

Etymology. Referring to the collection locality, the Tasman Sea.

Distribution. East coast of Australia; off the coast of Portugal,

1190-2800 m depth.

Remarks. This species shares much in common with C.

colossea but constant and conspicuous differences in the

articulation of the oviger claw, the less tapered oviger segment

10, the proportions of the abdomen and the longer, more slender

palp segment 10, distinguish the species (Table 1).

Size differences of genital pores were noted between

specimens. The smaller pores were about half the size of the

larger, but based on this difference alone, specimens could not

be assigned to sex with confidence. To some extent, the size of

these pores is proportionate to the size of the specimen and in

the apparent absence of other dimorphism, sex is uncertain.

The abdomen shows slight variability; in some cases more

narrowed distally than in others. Leg spans of subadults were

in the range of 290-350 mm. The oviger claw is straight to

slightly curved and palp segment 10 is much shorter that in

adults, the length ranging from about 4 times median width.

Articulation of the oviger claw with segment 10 is constant,

but the shape of the claw and the proportions of palp segment

10 are unquestionably correlated with maturity. To enable

comparison with C. colossea , the length of oviger segment 10

is measured from the proximal margin of the segment to the

distal edge of the spine field rather than to the point of

articulation with the claw. The width of the segment is

measured from the outer margin of the segment to the base of

the spines. The particularly fine serrations of the oviger spines

in subadults is perhaps indicative of a lack of wear and the

spines are very thin, so much so, that the tip of several spines

were folded over (fig. 3H). Although not a constant character,

the first lateral processes were less inclined and directed more

forward than in C. colossea.

Table 1. Primary characters distinguishing C. colossea and C. tasmanica.

C. colossea

C. tasmanica

Oviger claw

Coalesced

Segmented

Oviger segment 10

Tapered distally

Uniform width

Oviger segment 10, L/W

43-5.2

2. 5-3. 5

Palp segment 10, L/W

1.5-93

6. 1-7.8

Palp segment 10, distal

Uniformly rounded

Irregular, narrowed

Abdomen/trunk

13-18% (<20%)

19-29% (>20%)

David A. Staples

Colossendeis tasmanica is found sympatric with

C. colossea in the Tasman Sea although of the 75 specimens

documented in this report, the two species were never recorded

together from the same collection site. Regional records of

C. tasmanica are confined to the eastern coastline, whereas

C. colossea is more widely spread around the Australian

continent and elsewhere. Nogueira, (1967) recorded and

illustrated what appears to be a juvenile C. tasmanica from a

similar depth to the Tasman Sea specimens off the coast of

Portugal, confirming the probability that records of

C. tasmanica lie unrecognised amongst collections of

C. colossea. Regional records of C. tasmanacia are from a greater

depth than those for C. colossea. This species also shares a

resemblance to C. curcurbita (Cole, 1909), previously recorded

in the region from New Zealand and south of Australia.

Colossendeis cucurbita can be readily distinguished from

C. tasmanica by the shape of the terminal oviger claw and the

proportions of the palp segments. Colossendeis cucurbita is a

member of the ‘ macerrima complex’ a group characterized by

having palp segment 3 much shorter than 5 and in which the three

distal most segments are equal to, or less than, segment 7. Based

on Cole’s illustration of the holotype (pi. 3, fig. 7), the proboscis

is more upturned and wider distally than C. tasmanica.

Encapsulated juvenile gastropods were attached to the legs

of several specimens of C. tasmanica and in one case, to the

trunk and proximal palp segments. Most capsules contain a

single gastropod and many had been vacated. This apparent

phoretic association with the genus Colossendeis is common

and although not evidenced in this material, may extend to being

symbiotic or ectoparasitic (Sirenko, 2000; Lehmann et al. 2006).

Two deep-water species of stalked barnacle were recorded

primarily on the dorsal surfaces of the trunks and legs of several

specimens. Glyptelasma carinatum (Hoek, 1883) is a

cosmopolitan barnacle species previously recorded from the

Challenger Plateau, Tasman Sea and the other species, tentatively

placed in Catherinum sp. cf sinuatum (Pilsbry, 1907), is a deep-

water Atlantic species (J. Buckeridge pers. com.).

Colossendeis spicula Child, 1994

Figure 4E-H

Colossendeis spicula Child, 1994: 14. Fig. 6 (A-B)

Material examined. Victoria. 85 km S of Point Hicks 38°31.41'S,

149°21.10'E, 1986 m, to 38°30.58'S, 149°21.50'E, 1360 m, 3.5 Beam

trawl, RV Franklin , G.C.B. Poore et al., 26 Oct 1988 (stn SLOPE 72),

NMV J54504 ( 3 specimens).

Diagnosis. Leg span to about 285 mm. Lateral processes shorter

than their diameters, fringed distally with a few scattered, short,

spines; 2nd and 3rd lateral processes separated by about one-

third basal widths, 1st pair not conspicuously raised. Anterior

margin of cephalon with pair of small but prominent apophyses

over base of palp insertions. Ocular tubercle low, two eyes,

unpigmented. Proximal quarter of proboscis narrow, inflated in

mid-region, tapering distally to a rounded tip, width marginally

less than basal diameter. Palps conspicuously spiny, segment 3,

1.4 times segment 5; segment 7 greater than twice length of

segment 6. Abdomen articulated, clavate, little less than 30% of

trunk length. Oviger 10-segmented, terminal claw gently curved

and articulated with segment 10. Legs about 9 times length of

trunk; femur marginally longer than tibia 1; tibia 1, 1.3 times

tibia 2. Tarsus 1.8 times propodus, claw 36% of propodus.

Spines in rows, straight or curved slightly, longer spines equal

to, or longer than width of segment.

Distribution. West and east Pacific (Tasman Sea and off the

Oregon coast), Depth 1360-2832 m.

Type locality. Off the Oregon coast, USA.

Remarks. This collection consists of one large and two smaller

specimens about half the size of the larger specimen. Although

having fewer spines, they are presumed to be sub-adults of this

species. The ocular tubercles of the smaller specimens terminate

in an apical cone which was not present in the larger form. The

larger specimen is of the same size as the holotype and agrees

in almost all respects with Child’s description. Differences are

principally confined to spination of oviger segments 4-6 which

carry numerous long, sharp, simple spines not present on the

holotype. Another minor difference is found in the proportions

of the femur and tibia 2. Internal ganglia and smooth cuticle in

the area where two eyes are usually positioned, suggests that

the apparent absence of eyes in the holotype may be a legacy of

preservation. Well-defined lateral sensory organs were present

on the dorsolateral surface of the ocular tubercle. Palp and

oviger gland openings are not evident. Child (1994, fig. 4A)

clearly figures a 10-segmented palp; however his description

overlooks the small 1st segment. His reference to the 2nd palp

segment being longest should in fact be the 3rd segment; the

4th segment should be the 5th and so on. Spines on all longer

segments are straight and often longer than the corresponding

segment. Child describes the three distal segments as being

progressively shorter but in this specimen the 10th segment is

1.2 times longer than the 9th, otherwise all segments agree

with the holotype in their proportions. Coxal pellicula and

genital pores are not evident in this material.

Numerous gastropod egg capsules were attached to the

dorsal surface of the trunk of the larger specimen and ventral

surface of one or more legs of all specimens. Most of these

capsules were vacated. This species has also much in common

with C. ensifer Child, 1995 but that species is distinguished by

the presence of strong, hooked spines on the palps and on the

longer leg segments.

Colossendeis melancholicus Stock, 1975

Figures 5A-H, 7B

Colossendeis melancholicus Stock, 1975: 988-990, figs llc-f,

12.— Child, 1994:14 [synonymy]

Material examined. Tasmania. NW flank of St Helens Hill, 41°14.7'S,

148°461'E, 1755 m. Benthic dredge. RV Southern Surveyor, CSIRO,

27 Jul 1999, (cruise SS03/99, stn 62), NMV J48898 (1 female).

Diagnosis. A large, glabrous species with a leg span to about

450 mm. Proboscis tubular, extremely long and down-curved,

diameter almost uniform throughout the length; 13-14 times as

long as wide and close to 3 times length of the trunk. Anterior

Records of Colossendeidae from Australian Waters

margin of cephalon with 2 small apophyses. Oviger claw short,

strongly curved. Palp segments 3 and 5 of about equal length,

two large, unpigmented teardrop-shaped eyes, lateral sensory

organs present. Abdomen arched, reaching beyond coxa 1 of

leg 4. Tarsal spines irregular in size, several smaller spines

interspaced by a single larger spine. Palp segment 10, 6.3-7.4

times as long as median width.

Distribution. Florida Straits, Caribbean region and the Tasman

Sea, off Tasmania. 732 m to 1755 m depth.

Type locality. Grand Bahama: (27°57'N, 78°56'W-27°55'N

78°59'W).

Remarks. The extraordinarily long, down-curved proboscis of

this species sets it apart from any other species of Colossendeis.

Child’s (1994: 14) observation of inconsistencies between Stock’s

(1975) figures and his measurements are more general than he

noted. Stock’s measurements indicate the proboscis length of the

holotype is a little more than twice the trunk length and almost 20

times the maximum width. However, based on his fig. lld,c, the

length of the proboscis is closer to 14 times its maximum width

and 3 times the trunk length; the same proportions as found in the

Tasman Sea specimen. The main claw of all legs is blunt and the

terminal claw of the oviger is much reduced and more strongly

curved than figured by Stock (figs Ilf, 12e). Oviger segment 6 is

longest, gently curved, and a little longer than segment 4. In

agreement with the holotype, tiny genital pores are present on the

ventral surface of the 2nd coxae of all legs. Propodal sole spines

are worn to flat stubs. Faint suture lines separate the trunk

segments. The coxal pellicula are pale and have the appearance

of a collapsed blister (fig. 7B). This record represents a significant

extension in geographic and bathymetric range for this rarely

recorded species.

Colossendeis cf mycterismos Bamber, 2004.

Figure 6A-G

Colossendeis mycterismos Bamber, 2004:7-9. Fig, 3 (A-E)

Material examined. NORFANZ Stations. Holotype: Lord Howe

Plateau, 34°12.20'S, 162°41.44'E, 751 m, 26 May 2003, (Tan 0308, stn

084), NMV J48824 (1 specimen).

Paratype: West Norfolk Ridge, Wanganella Bank, (34°37.20’S,

168°57.03’E), 521 m, 3 Jun 2003, (Tan 0308, stn 154), NMV J53080

(1 specimen).

Diagnosis. A fine, delicate species. Leg span to about 55 mm.

Proboscis almost 1.5 times length of trunk, greatest diameter in

proximal 3rd, down-curved throughout length, strongly tapered

distally. Ocular tubercle with apical point, 2 or 4 eyes, pigmented

or unpigmented. Legs slender, terminal claw of all legs short,

less than one-third propodus; tarsus, shorter than propodus,

propodus ratio variable.

Distribution. East coast of Taiwan; Lord Howe Plateau, Tasman

Sea.

Remarks. This material enables additional observations to

compliment the original description. The proboscis is gently

down-curved through its length but more so in distal one-third

and articulates from about horizontal, downwards, to what

appears to be a more natural position of about 45°. Palp segment

5 is longest, about 1.2 times longer than segment 3, segment 6,

1. 1-1.2 times longer than segment 7 and segments 8, 9 and 10

progressively increase in length. The distal four palp segments

were covered in numerous spinules of uniform size; segment 10

is about 4 times as long as wide. The terminal oviger claw is

straight, smooth and a little longer than half the length of segment

10, finely crenulate spines on segments 7 to 10 are in single row,

and number 7: 6: 6: 9. The length of the tarsus relative to the length

of the propodus decreased from the 1st pair of legs to the 4th pair

in 1 specimen, but in no particular order in the other; the length

of the tarsus ranged from 48-97% of the propodus length, the

main claw ranged from 27^46% of propodus length. The longer

leg segments are gently curved, tibia 1 is equal to, or marginally

longer than the femur and tibia 2 is 24—35% longer than tibia 1.

The tarsus and propodus have a row of short spines along ventral

margin; all segments are covered in short spines, the larger spines

interspaced among more numerous shorter spines. Coxal

pelliculae were not evident. The ocular tubercle is slightly taller

than its basal width, with a variably developed apical point. The

four darkly pigmented eyes are of equal size and have convex

lenses. Lateral sensory organs were not evident. The genital pores

are tiny and placed on the distoventral surface of coxa 2 of all

legs. The abdomen is fusiform, curved with a convex dorsal

surface and distinctly clavate distally. Differences between the

holotype and the Tasman Sea specimens can be summarized as

follows. The holotype is about one -third larger than the Tasman

Sea specimens and has only one pair of unpigmented eyes; palp

segments 3 and 5 are of equal length and segments 6 to 10 are

subequal. The femur of the 3rd leg of the holotype is almost 30%

shorter than tibia 1, and tibia 2 is only 10% longer than tibia 1.

The proboscides of the Tasman Sea specimens are uniformly

inflated proximally with a tapered, curved distal region; Bamber ’s

figures (3A, B) show a distinct bulge at one-third the proboscis

length and minimal distal curvature. The holotype abdomen was

not described, but based on the same figures, it is of uniform

width and somewhat convex dorsally. The oviger claw is nearly

half the length of the 10th segment and has a ‘flattened expansion’

along its ventral margin (fig. 3C). The number of oviger spines in

the holotype was not documented for comparison. Oviger and

palp glands are not evident.

The status of these specimens will have to be reassessed

on examination of additional material, particularly as both the

holotype and these specimens are recorded from similar

depths and are adult, decreasing the chances of differences

being attributed to heterogonic growth. Characters of particular

significance are the unique variability in the number of eyes

from 2 to 4; the differences in the proportions of longer leg

segments and differences in the supposed characteristic shape

and orientation of the proboscis for which the species was

named. Should the proboscis orientation and shape of the C.

mycterismos holotype prove to be an artefact of preservation,

then apart from differences noted above, differences are

relatively minor. Rather than introduce another species into a

genus already bedevilled by species complexes, I have

provisionally referred the specimens to C. mycterismos. The

specimen from stn 154 was enveloped in a clear, diatom-

embedded slime.

David A. Staples

Additional measurements and illustrations are provided

for future comparison.

Measurements (in mm). Length trunk (frontal margin cephalic

segment to tip 4th lateral process) 2.64; width across 2nd lateral

processes 0.88; length proboscis (lateral) 3.25; greatest width

proboscis 0.50; length abdomen 0.43. Third leg: coxa 1, 0.38;

coxa 2, 0.48; coxa 3, 0.38; femur 7.43; tibia 1, 7.43; tibia 2, 9.80;

tarsus 0.80; propodus 0.98; claw 0.28.

Oviger; seg. 1, 0.10; seg. 2, 0.25; seg. 3, 0.27; seg. 4, 2.27;

seg. 5, 0.62; seg. 6, 3.60; seg. 7, 0.44; seg. 8, 0.35; seg. 9, 0.25;

seg. 10, 0.25; claw, 0.16. Palp segments (in mm), seg. 1, 0.02;

seg. 2, 0.09; seg. 3, 1.78; seg. 4, 0.18; seg. 5, 2.10; seg. 6, 0.50;

seg. 7, 0.44; seg. 8, 0.31; seg. 9, 0.34; seg. 10, 0.40.

Two other species share a similar proboscis shape with C.

mycterismos ; Colossendeis pipetta Stock, 1991 and C. sinuosa

Stock, 1997. As noted by Bamber, the tarsus in both species is

longer than the propodus and the proboscides are more tubular

distally in both species. Colossendeis pipetta can further be

distinguished by the higher numbers of spines on oviger

segments 7 to 10. Stock described the lateral processes of this

species as being separated by twice their own diameter;

however his fig. 28B shows them to be separated by about their

own diameter. Also, his reference to oviger segments 3 and 5

should be to segments 4 and 6. Stock’s brief description of C.

sinuosa does not enable adequate comparison with that species

and his relative descriptions of the palps as being “less

elongate” and of “different slenderness”, necessitates re-

examination of the type material. In the meantime, C. pipetta

can be primarily characterised by the ‘sinuous’ shape of the

distal portion of the proboscis.

Hedgpethia Turpaeva, 1973

Colossendeis.— Loman, 1908: 22-23

Rhopalorhynchus.— Stock, 1958:116 (part).

Hedgpethia Turpaeva, 1973: 184-185

Type species. Colossendeis articulata Loman, 1908

Diagnosis. Trunk clearly segmented, posterior margin of first

three segments swollen or flared. Abdomen short, directed

somewhat ventrally, sometimes not visible in dorsal aspect.

Ocular tubercle prominent, sometimes acutely conical, eyes

rarely absent, often large with convex lenses. Proboscis with

inflated mid-region, tapering distally, inflated for most of its

length, extent of distal taper variable. 4 pairs of legs. Large

propodal heel spines absent. Genital pores are on legs 3 and 4,

the female genital pores being much larger than those of male.

Hedgpethia dampieri (Child, 1975).

Figure 4A-D

Rhopalorhynchus dampieri.— Child, 1975: 8-10, fig. a-h

Hedgpethia dampieri Turpaeva, 1973: 185

Material examined. South Australia. Great Australian Bight,

31°50.05'S, 130°45.0'E, 55 m, RV Southern Surveyor CSIRO, 13 May

2000, (SS01/00 stn 378), NMV J48903 (1 specimen). Holotype:

Western Australia. W of Lancelin I., beam trawl, with bryozoans,

113-122 m, 5 Feb 1964, CSIRO stn 46, WAM 70-3953 (1 male).

Paratypes: Western Australia. W of Mandurah, 110 m, 23 Nov 1970,

R.V. Diamantina, stn. 4. USNM 149237, WAM 71-1789 (1 female).

SW of Jurien Bay, 110 m, 9 Dec 1970, R.V. Diamantina, stn 108,

WAM 71-1791 (1 female).

Diagnosis. A slender species with leg span to about 40 mm.

Lateral processes 1, 2 and 3 separated by about twice basal

diameter. Ocular tubercle short, eyes bulging. Proboscis slightly

down-curved with short basal part, followed by a similarly

short inflated part that narrows to a longer, tapered distal part,

rounded at the tip. Abdomen almost hidden in dorsal view.

Small genital pores present ventrally on 2nd coxa of legs 2-4.

Distribution. S and SW Australia. 110-122 m depth.

Type locality. W of Lancelin I. Western Australia.

Remarks. This specimen is in good agreement with Child’s

(1975) description. Re-examination of the type material enables

a few additional comments. Small genital pores are present on

coxa 2 of the female paratypes but are not evident on the smaller

holotype which Child determined to be a male. The ventrally

placed abdomen is articulated at its base. Segment 10 of the

dissected holotype oviger appears to be lost and segments 5-10

of the remaining oviger are missing. The terminal oviger claw of

the South Australian specimen is smooth, with a fine, broad knife

edge (fig. 4C) and lacks the two tiny teeth of the holotype.

Acknowledgments

For accessing their Colossendeis collections, I am grateful to:

Dr Wolfgang Ziedler and Thierry Laperousaz (South

Australian Museum), Dr Penny Berents and Dr Stephen Keable

(Australian Museum), Dr Mark Harvey and Julianne Waldock

(Western Australian Museum) for the loan of the Hedgpethia

type material, Diana Jones (Western Australian Museum) and

Prof. John Buckeridge (RMIT University) for identification of

the cirrepedia. Luba Sosnin and Sarabel Minero who

respectively generously assisted with the translation of Russian

and Portugese texts. Dr Ken Walker (Museum Victoria), for

access to the digital microscope through which the high

resolution digital images were taken. Michela Mitchell for her

assistance in identifying the Australian Museum specimen.

Finally, I am indebted to the reviewers for their constructive

comments on the drafts of the manuscript.

References

Bamber, R. N. 1983. Some deep water Pycnogonids from the north-east

Atlantic. Zoological Journal of the Linnean Society 77: 65-74

Bamber, R. N. 1995. Pycnogonida. Pp 59-62 in: Mackie, A. S. Y., Oliver,

P. G., and Rees, E. I. S. (eds). Benthic Biodiversity in the Southern

Irish Sea. National Museums and Galleries of Wales: Cardiff.

Bamber, R. N. 2002. Bathypelagic pycnogonids (Arthropoda,

Pycnogonida) from the Discovery deep-sea cruises. Journal of

Natural History 36: 715-727.

Bamber, R. N. 2004. Pycnogonids (Arthropoda: Pycnogonida) from

Taiwan, with description of three new species. Zootaxa 458: 1-12.

Records of Colossendeidae from Australian Waters

Bamber, R. N., and Thurston, M. H. 1993. Deep water pycnogonids of

the Cape Verde slope. Journal Marine Biology Association UK

73: 837-861.

Bamber, R. N., and Thurston, M. H. 1995. The deep-water Pycnogonids

(Arthropoda: Pycnogonida) of the northeastern Atlantic Ocean.

Zoological Journal of the Linne an Society 115: 117-162.

Bouvier, E. L. 1913. Pycnogonides du Pourquoi Pas? Deuxieme

Expedition Antarctique Francaise (1908-1910), 6: 1-169.

Caiman, W. T. 1915. Pycnogonida. British Antarctic ( Terra Nova)

Expedition, 1910. Zoology. 3(1): 1-74; 22 figs.

Child, C. A. 1975. Pycnogonida of Western Australia. Smithsonian

Contributions to Zoology 190: 1-29.

Child, C. A. 1992. Pycnogonida of the Southeast Pacific Biological

Oceanographic Project (SEPBOP). Smithsonian Contributions to

Zoology 526: 1-43.

Child, C. A. 1994. Deep-Sea Pycnogonida from the temperate west

coast of the United States. Smithsonian Contributions to Zoology

556: 1-23.

Child, C. A. 1995. Antarctic and Subantarctic Pycnogonida IV.

The families Colossendeidae and Rhynchothoracidae.

Pp. 69-111 in: Cairns, S. (ed Biology of the Antarctic Seas XXIV

Antarctic Research Series, 69. American Geophysical Union:

Washington D.C.

Child, C. A. 1998. The marine fauna of New Zealand. Pycnogonida

(Sea Spiders). NIWA Biodiversity Memoir 109: 1-71.

Clark, W. C. 1963. Australian Pycnogonida. Records of the Australian

Museum 26(1): 1-81.

Cole, L. J. 1909. XIX. Pycnogonida. Reports on the scientific results of

the expedition to the Eastern Tropical Pacific in charge of Alexander

Agassiz, by the U.S. Fish Commission Steamer “Albatross” from

October 1904 to March 1905, Lieut. Commander L.M. Garrett

U.S.N., Commanding. Bulletin of the Museum of Comparative

Zoology at Hazard College, 52(11): 185-192; pis. 1-3.

Fage, L. 1956. Les Pycnogonides (excl. le genre Nymphon). Galathea

Reports 2: 167-182; figs. 1-22.

Flynn, T. T. 1919. A re-examination of Professor Haswell’s types of

Australian Pycnogonida. Royal Society of Tasmania: Papers and

Proceedings 1919: 70-92.

Fry W. G., and Hedgpeth, J. W. 1969. The fauna of the Ross Sea, Part

7. Pycnogonida, 1: Colossendeidae, Pycnogonidae, Endeidae,

Ammotheidae. New Zealand Department of Scientific and

Industrial Research Bulletin 198, New Zealand Oceanographic

Institute Memoir 49: 1-139.

Gordon, I. 1932 Pycnogonida. Discovery Reports 6: 1-138; figs. 1-75.

Gordon, I. 1938. Pycnogonida. Scientific Reports of the Australasian

Antarctic Expedition, (C), (Zoology & Botany), 2 (8): 1-40;

figs. 1-8.

Gordon, I. 1944. Pycnogonida. Reports of the British, Australian and

New Zealand Antarctic Research Expedition, (B): 5 (1): 1-72;

figs. 1-27.

Grassle J. F., Sanders, H. L., Hessler, R. R, Rowe, G. T., and McLennan,

T. 1975. Pattern and zonation; a study of the bathyal megafauna

using the research submersible Alvin. Deep-Sea Research 22 (7):

457-481; figs. 1-9.

Hedgpeth, J.W. 1948. The Pycnogonida of the Western North Atlantic

and the Caribbean. Proceedings of the United States National

Museum No. 3216 (97): 157-342, figs. 4-53, charts 1-3.

Hodgson, T. V. 1907. Pycnogonida. National Antarctic Expedition

1901-1904. Reports of the National Antarctic Expedition of

1901-1904, Natural History 3: 1-72; 10 pis.

Hoek, P. P. C. 1881. Report on the Pycnogonida dredged by HMS

Challenger 1873-76. Reports of the Scientific Results of the

Exploring Voyage of HMS Challenger. Zoology 3(10): 1-167.

Hoek, P. P. C. 1883. Report on the Cirrepidia collected by the H.M.S

Challenger during the years 1873-76. Report on the Scientific

Results of the Exploring Voyage of H.M.S. Challenger. Zoology

8(25): 1-169.

Jarzynsky,T. 1870. Praemissus catalogus Pycnogonidarum, inventarum

in Mari Glaciali, ad oras Lapponiae rossicae et in Mari Albo, anno

1869 et 1870. Annals de la Societe des Naturalistes de St.

Petersbourg. 1: 319-320. (Reproduced in N. Wagner (1885). Die

Wirbellosen des Weissen Meeres: 168-171. Leipzig.)

Lehmann, T., Gailer, J. P, Melzer, R. R., Schwab, E. 2006. A scanning-

electron microscope study of Dickdellia labioflecta (Dell, 1990)

(Gastropoda, Littorinoidea) on Colossendeis megalonyx Fry and

Hedgpeth, 1969 (Pycnogonida Colossendeidae): a test for

ectoparasitism. Polar Biology (2007) 30: 243-248.

Loman, J. C. C. 1908. Die Pantopoden der Siboga -Expedition. Siboga

Expeditie Monographie 40: 1-88; 1-XV, 4 figs.

Mauchline, J. 1984. Pycnogonids caught in bathypelagic samples from

the Rockall Trough, northeastern Atlantic Ocean. Journal of

Natural History 18.2: 315-322.

Milne-Edwards, A. In Filhol, H. 1885, Pycnogonides. In: La vie au

fond des mers. Les explorations sous -marines at lesvoyages du

Travaillieur et du Talisman: 150-154.

Monod, T. 1954. Sur un premier essai d’utilisation scientifque du

bathyscaphe F. N. R. S. 3. Comptes rendus de Academie des

Sciences de Paris 238: 1951-1953.

Nogueira, M. 1967. Bases para a determinagao dos Pantopodos das

costas Portuguesas. Arquivos do Museu Bocage. Series 2a.l(15):

283-341.

Pilsbry, H. A. 1907. The Barnacles (Cirrepidia) contained in the

collections of the US National Museum. Bulletin and Proceedings

of the US National Museum.

Sars, G. O. 1877. Prodromus descriptionis Crustaceorum et

Pycnogonidarum, quae in expeditione norvegica anno 1876

observavit. Archive for Mathematik og Naturvidenskab,

Kristiania, 2: 237-271.

Schimkewitsch, W. 1893. Compte-rendu sur les Pantopodes. In:

Reports on the dredging operations off the west coast of Central

America to the Galapagos, to the west coast of Mexico, and in the

Gulf of California, in charge of Alexander Agissiz, carried on by

the U. S. Fish Commission Steamer “Albatross”, during 1891,

Lieut. Commander Z. L. Tanner, U. S. N., commanding. Bulletin

of the Museum of comparative Zoology, Harvard College 25,

27-43, pis. 1-2.

Sirenko, B. 1. 2000. Symbiosis of an Antarctic gastropod and pantopod.

Ruthenica 10: 159-162.

Staples, D. A. 2002. Pycnogonum (Pycnogonida: Pycnogonidae) from

Australia with descriptions of two new species. Memoirs of the

Museum of Victoria 59(2): 541-553.

Stiboy-Risch, C. 1993. Funde antarktischer und subantarktischer

Pantopoden einschlieBlich Colossendeis acuta sp. n. - sowie ein

Beitrag zur Artbestimmung von Colossendeis glacialis

HODGSON, 1907 und Colossendeis robusta HOEK, 1881.

Mitteilungen aus dem hamburgischen zoologichen Museum und

Institut 90: 251-264.

Stock, J. H. 1958. The Pycnogonid Genus Rhopalorhynchus Wood-

Mason, 1873. Overdruk uit het Tijdschrift voor Entomologie,

101(2): 113-137; figs 1-63.

Stock, J. H. 1975. Pycnogonida from the continental shelf, slope, and

deep-sea of the tropical Atlantic and East Pacific. Biological

results of the University of Miami deep-sea expeditions, 108.

Bulletin of Marine Science 24(4): 957-1092.

Stock, J.H. 1978. Abyssal Pycnogonida from the North-eastern

Atlantic Basin, part 11. Cahiers de Biologie Marine 19: 397-413.

David A. Staples

Stock, J.H. 1986. Pycnogonida from the Caribbean and the Straits of

Florida. Bulletin of Marine Science 38: 399-441.

Stock, J. H. 1987. Faunistic transit between the Atlantic and the

Mediterranean: the deep water Pycnogonida. Cahiers de Biologie

Marine 28: 505-519.

Stock, J. H. 1991. Deep-water Pycnogonida from the surroundings of

New Caledonia. In A. CROSNIER (ed.), Resultats des Campagnes

MUSORSTOM, Volume 8. Memoires du Museum national

d’Histoire naturelle, (A)151: 125-212.

Stock, J. H. 1997. Pycnogonida collected in recent years around New

Caledonia and Vanuatu. In: A. CROSNIER, (ed.), Resultats des

Campagnes MUSORSTOM, 18. Memoires Museum National

d’Histoire Naturelle 176: 389-409.

Turpaeva, E. P. 1973. [Pantopoda from the Northeast Pacific Ocean.]

Trudy Instituta Okeanologii P.P. Shirshov, Akademiya Nauk

SSSR 91: 178-191; figs 1-2. [In Russian]

Turpaeva, E. P. 1994. A new species of Colossendeis (Pycnogonida)

and some remarks on morphological features of the species of the

genus Colossendeis belonging to the complex “ macerrima ”.

Zoologichesky Zhurnal 73 (9): 91-96 (in Russian).

Wilson, E. B. 1881. Reports on the Pycnogonida. Reports on the results

of dredging under the Supervision of ALEXANDER AGASSIZ,

along the East Coast of the United States, during the Summer of

1880, by the U.S. Coast Survey Steamer “Blake”, COMMANDER

J. R. BARTLETT, U.S.N. COMMANDING Bulletin of the Museum

of Comparative Zoology, Harvard 8(12): 239-256: pis. 1-V.

Memoirs of Museum Victoria 64: 95-101 (2007)

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/Memoirs/

Pycnogonids (Arthropoda: Pycnogonida) from the Great Australian Bight,

southern Australia, with description of two new species.

David A. Staples

Museum Victoria, GPO Box 666, Melbourne, Victoria 3001, Australia (dstaples@museum.vic.gov.au)

Abstract Staples, D. A. 2007. Pycnogonids (Arthropoda: Pycnogonida) from the Great Australian Bight, southern Australia, with

description of two new species. Memoirs of Museum Victoria 64: 95-101.

Twelve species of shallow-water pycnogonid belonging to nine genera are represented in this report. Specimens

were collected from the Great Australian Bight, southern Australia, at depths of 1-180 m. Two new species in the family

Callipallenidae are described: Pseudopallene chevron sp. nov. and Parapallene gowlettae sp. nov.

Keywords Pycnogonids, Southern Australia, Eyre Peninsula, Great Australian Bight, Nymphonidae, Ammotheidae, Callipallenidae,

Phoxichilidiidae, Pycnogonidae, Austrodecidae.

Introduction

This collection is mainly comprised of specimens from the

west coast of the Eyre Peninsula, South Australia but also

includes two species from West Australian waters. The most

recent reports on pycnogonids collected from the region are

those of Bamber (2005) who reported on the pycnogonids from

the Recherche Archipelago, Esperance, Western Australia and

Staples (2005; 2007) who reported on pycnogonids collected

from two island groups in South Australian waters. The scarcity

of reports on the pycnogonid fauna in the intervening region is

largely a reflection of the exposed and inaccessible nature of

that coastline. It is nevertheless expected that the coastal fauna

is typical of a high energy regime and relatively sparse.

Previous ship-based surveys have collected few specimens and

the logistics of mounting future deep-sea surveys in the region

represent a significant barrier to more intensive collecting.

Specimens are lodged in the South Australian Museum,

Adelaide (SAM) and Museum Victoria (NMV).

Nymphonidae Wilson, 1878

Nymphon aequidigitatum Haswell, 1884.

Nymphon aequidigitatum Haswell, 1884: 1022-1024, pi. 54,

figs 1-5— Clark, 1963: 5-7, fig. 3-Stock, 1973a: 107-1 08 -Staples,

1997: 1050, fig. 21.1a, 21.2c, plate 68.8.

Material examined. South Australia, W side of Wittelbee Point, E of

Ceduna, 1-3 m, 7 Mar 1993; coll. W. Zeidler, K.L. Gowlett-Holmes

and B. McHenry SAM E3675 (1 male).

Type locality. Port Jackson, New South Wales.

Distribution. Recorded from Gulf St. Vincent, South Australia

to Cape Byron, New South Wales, from the intertidal to 20 m

depth.

Remarks. The chelae of N. aequidigitatum are sexually

dimorphic; the male palm more swollen than that of the female.

The species is most often found on hydroids, algae, bryozoans

and sponge surfaces. Colour is typically straw to pale orange

but specimens predominantly assume the colour of their gut

content. A narrow, pale mid-dorsal stripe is often present.

Ammotheidae Dohrn, 1891

Achelia shepherdi Stock, 1973b

Achelia shepherdi, Stock, 1973b: 92-95, figs 1-2— Staples, 1997:

1056; fig. 21.7e— Child, 1975: 22-24, fig. 10.

Material examined. S of Eucla, South Australia, Great Australian

Bight, (31°50'E, 129°0'S), stn GAB 007, semi-epibenthic sled, 42 m,

P. E. Bock and S. J. Hageman, 15 Jul 1995 SAM E3676 (1 male).

Type locality. Bruny I., Tasmania.

Distribution. Western Australia, South Australia, Victoria,

Tasmania and east coast of Australia at depths to 50 m.

Remarks. This species is readily distinguished from its

Australian congeners by the serrated appearance of the distal

palp and possession of a bulbous proboscis.

Ammothea australiensis Flynn, 1919

Ammothea australiensis Flynn, 1919: 95-99— Child, 1975: 24

(earlier refs.) —Staples, 1997: 1067; fig. 21.8b.

David A. Staples

Figure 1 Parapallene gowlettae sp. nov. female holotype (SAM E3678): A, trunk, dorsal; B, trunk, lateral; C, cephalon, ventral; D, oviger

segments 3 and 4; E, oviger; F, leg 1; G, coxae; H, propodus, leg 3; I, chela.

Pycnogonida from Great Australian Bight

Material examined. Point Sinclair jetty, amongst Galeolaria tubes,

D. Howlett, Jan 1980. SAM E3677 (1 subadult).

Type locality. Port Jackson, New South Wales.

Distribution. Garden I., WA to Port Jackson, NSW and

Tasmania. Intertidally to 10 m depth.

Remarks. This small, subadult specimen possesses dorsal trunk

tubercles characteristic of A. australiensis. This is the most

common species along the southern Australian coastline,

typically collected from beneath stable rocks and in association

with the sedentary polychaete Galeolaria caespitosa on which

it feeds.

Callipallenidae Hilton, 1942

Parapallene Carpenter, 1892

Parapallene gowlettae sp. nov.

Figure 1A-I

Material examined. Holotype: Elliston, in algae, S. A. Shepherd, 26

Feb 1978. SAM E3678 (1 female).

Diagnosis. Trunk slightly arched, smooth, fully segmented.

Chelifore scape with prominent dorsodistal process. Ovigers

10-segmented, segments 5-7 lying parallel to segments 1-4,

terminal claw divided into 5 finger-like processes. Femur with

long distal process about one-third length of the segment, tarsus

short, propodus strongly curved.

Description. Female holotype. Leg span about 35 mm. Trunk

smooth, segmented, lateral processes 2 and 3 separated by

about 1.3 times own basal diameters, lateral processes 1-3

separated from trunk by thin cuticular line, segment 4 divided

dorsally by longitudinal cuticular line, posterior to the abdomen

and extending ventrally, to the anterior margin of trunk segment

4; cephalon neck angled downwards from ocular tubercle,

expanding distally. Ocular tubercle conical, positioned over

anterior margin of 1st lateral processes, 2 sensory organs

prominent; 4 eyes lightly pigmented in preserved specimen.

Abdomen curved, fusiform, positioned on dorsal surface of

segment 4, short, erect, not visible from ventral aspect, strongly

cleft, small papillae either side of anal slit. Proboscis short,

attached to ventrodistal surface of cephalon, basal region

barrel-shaped with tiny spines on ventral surface, strongly

constricted prior to inflated oral region, oral surface bearing

numerous tiny spines, lips protruding. Chelifore scape with

prominent dorsodistal process bearing scattered spinules, inner

surface with few spines; chela palm almost oblong, inflated,

with numerous small, scattered spinules; fingers short, off-set

from distal margin of palm, moveable finger longest, with tiny,

but well-defined crenulations distally. Ovigers 10-segmented,

attached to ventrolateral surfaces of neck, immediately below

the anterior margin of the 1st lateral processes; segments 5-7

folded back, lying parallel with segments 1-4, strigilis resting

beneath basal segments; segment 1 longer than segment 2,

segment 3 significantly swollen, more-so on the outside surface,

separated from segment 4 by faint suture line, segments 5 and

6 each with a small dorsodistal swelling, segments 7-10 with 2

long, strongly curved ventral spines and 4 smaller dorsal spines;

terminal claw about 1.3 times as long as segment 9, without

crenulations or serrations, distally, the claw divides into 5

pointed finger-like processes, one of which is bifurcate. The

2nd leg is the only intact, complete leg and is used for

measurements: coxa 2, 1.2 times length of coxa 1; femur having

a long, distal process almost equal to one-third the length of

entire segment and more or less continuous with the median

line of the femur, numerous small setae distally; tibia 1 slightly

curved, with similar but shorter dorsodistal process, shorter

than femur or tibia 2; tibia 2 more slender than tibia 1; tarsus

short; propodus curved, extended distally, overreaching base of

claw; heel variably defined but not prominent, bearing 3-4

strong spines, distal spine longest; sole armed with about 5

strong spines in mid-region accompanied by smaller lateral

spines, all spines finely crenulated. Genital pores large, placed

on swollen ventrodistal surface of coxa 2 in all legs.

Measurements of holotype (mm): trunk length (frontal

margin of cephalon to tip of 4th lateral process), 7.40; width

(across second lateral processes), 2.85; proboscis length

(ventral), 1.64; 2nd leg; coxa 1, 0.88; coxa 2, 1.38; coxa 3, 0.73;

femur, 3.7; tibia 1,2.13; tibia 2, 5.20; tarsus, 0.13; propodus, 1.90;

claw, 0.70.

Etymology. Named for Karen Gowlett-Holmes in recognition

of her collecting and astute observations of the southern

Australian pycnogonid fauna.

Remarks. The exoskeleton of this specimen is partially

transparent, revealing a fibrous and diverticulate network of

underlying tissue or cuticle. If this feature is evident in live

material, it will prove to be a useful diagnostic character. The

swollen oviger segment 3 is reminiscent of the similarly swollen

segment 6 in several species of Endeis (Staples, 1982: 461).

Three species share a distal process on the femur and tibia

1: Parapallene avida Stock, 1973; P. famelica Flynn, 1929

and P. haddoni Carpenter, 1892. In all 3 species the distal

femoral processes are much shorter than in P. gowlettae and

none share the pointed, finger-like processes on the oviger

claw. Parapallene avida can further be distinguished by the

shape of the chelifores and spination of the leg segments; the

lateral processes of P. famelica (non Clark, 1963) are separated

by about 4 times their own width and Parapallene haddoni

has a much longer abdomen.

Parapallene australiensis (Hoek, 1881)

Pallene australiensis Hoek, 1881: 76-78, pi. 11: figs 1-7.

Parapallene australiensis Stock, 1991:190 (earlier refs) —Staples,

1997:1057, fig. 21.4e pi. 67.2, 68.3.

Material examined. Great Australian Bight, approx 96 nm SW of

Elliston, (34° 54.13'S, 133°42.68'E), 180 m epibenthic sled,

RV Franklin , stn PL 94/08-09, 27 Jun 1994, K. L. Gowlett-Holmes,

S. Hagman, Y. Bone, SAM E3679 (1 male).

Type locality. East Moncoeur I., Bass Strait, Tasmania.

Distribution. Cape Naturaliste WA, along the east coast, north

to Cape York and New Caledonia at depths 10-240 m.

David A. Staples

Figure 2 Pseudopallene chevron sp. nov. male holotype (SAM E3681): A, trunk, lateral; B, trunk, dorsal; C, trunk, anterior; D, leg 2; E, oviger;

F, oviger claw; G, chela exterior; H, chela interior; I, abdomen lateral; J, tarsus and propodus leg 4.

Pycnogonida from Great Australian Bight

Remarks. The proboscis of this specimen is missing. Colour

and markings of live specimens are variable. In southern

Australia, this seasonally abundant species is typically

uniformly scarlet in colour, matching the hydroid Halopteris

glutinosa, on which it feeds (Staples, 1997).

Pseudopallene Wilson, 1878

Pseudopallene reflexa (Stock, 1968)

Spasmopallene reflexa Stock, 1968: 40-42, fig. 15a-h.

Pseudopallene reflexa Staples, 2005: 164-166, fig. 4A-I, fig. 5 F, G.

Material examined. Southern Eyre Peninsula, Point Drummond,

exposed, 5 m, site 14, code 56, 3 Dec 1995 SAM E3680 (1 male with

eggs, 2 females).

Type locality. Galathea stn. 571, Great Australian Bight.

Distribution. Investigator Group, Port Phillip Bay, Victoria and

southeast coast of Australia at depths 3-72 m.

Remarks. This species is most readily distinguished from its

congeners by the paired arrangement of the propodal heel

spines.

Pseudopallene Wilson, 1878

Pseudopallene watsonae Staples, 2005

Staples 2005: 160-164, fig. 2A-I.

Western Australia, King George Sound, N of False Bay, on red

algae, bryozoa from rock face, 27 m, SCUBA, G. C. B. Poore and H.

M. Lew Ton, 15 Apr 1984 (Stn SWA 57) NMV J45348 (1 female).

Type locality. Althorpe I., South Australia.

Distribution. King George Sound, Western Australia; Althorpe

I., South Australia; Port Phillip Bay, Victoria.

Remarks. The shape of the chelifore fingers is the most

recognizable character separating this species from its congeners.

Specimens are uniformly yellow in life. This is a much smaller

and finer species than the similarly coloured P. ambigua.

Pseudopallene Wilson, 1878

Pseudopallene chevron sp. nov.

Figure 2A-J

Material examined. 1 male, holotype, Waldergrave I., 25 m, 25 Oct 1973

SAME 3681.

Diagnosis. Trunk smooth, completely segmented. Post-ocular

surface of cephalon evenly rounded, not divided longitudinally,

mid-dorsal mound not present. Abdomen more or less tubular.

Proboscis bullet-shaped, without constrictions, margins evenly

curved and tapered towards tip. Oviger terminal claw scooped,

margin lined with rounded teeth. Red chevron markings on

trunk may be a useful diagnostic character.

Description. Leg span about 27.0 mm. Trunk smooth,

completely segmented; neck region of cephalon sloping away

from base of ocular tubercle; post-ocular surface evenly

rounded, not divided longitudinally, mid-dorsal mound not

present; length of lateral processes about 1.5 times maximum

width, 1st and 2nd pair separated by about one-quarter of basal

widths. Ocular tubercle with 2 prominent dorsal papillae,

lateral sensory organs not evident; 4 eyes, darkly pigmented.

Abdomen more or less tubular, constricted distally, cleft anal

opening. Proboscis bullet-shaped, without constrictions,

margins evenly curved and tapered towards tip, 3 lips prominent,

extended, oral fringe not evident. Chelifore scape without basal

constriction, chela fingers with linear cutting edge, length of

moveable finger slightly less than length of palm, dorsal surface

of immoveable finger with several strong setae on outer surface.

Oviger 10-segmented, segment 5 longest, strongly curved,

distal apophysis prominent, all segments covered in small, but

strong, simple spines; compound spine formula segments 7 to

10, 14:11:10:10, terminal claw scooped, margin lined with

22-26 rounded teeth. 3rd leg: coxa 2, 2.5 times length of coxa

3, tibia 2 longest, femur longer than tibia 1, propodus with 4

strong heel spines, distal-most spine longest, greater than half

width of heel, heel spines followed by 2 lesser spines followed

by 10-15 much smaller sole spines. Genital pores round, tiny,

on ventrodistal surface of legs 3 and 4.

Measurements of holotype (mm): trunk length (frontal margin

of cephalic segment to tip of 4th lateral process), 3.5; width

(across 2nd lateral processes), 1.55; proboscis length (dorsal),

1.20; 3rd leg: coxa 1, 0.55; coxa 2, 1.38; coxa 3, 0.55; femur,

3.05; tibia 1, 2.64; tibia 2, 3.75; tarsus, 0.25; propodus, 0.85;

claw, 0.48.

Remarks. This small species is of a similar size to P. reflexa

Staples, 2005 with which it shares the absence of a preocular

mound and the longitudinal division of the cephalon. It

otherwise differs in the arrangement of the propodal heel

spines, the shape of the proboscis and abdomen and not having

an irregular surface of the legs. The evenly rounded preocular

region of the cephalon also resembles that of the much larger

and more robust P. ambigua but from which it also differs

conspicuously in the shapes of the proboscis, the chelifores, the

oviger claw and the propodus. It is of interest to note that

Bamber (2005: 332) records markings on the trunk and legs of

P. ambigua from the Recherche Archipelago; a feature

uncharacteristic of specimens from southeastern Australia

where they are uniformly yellow. Photographs of live P. chevron

show colour to be predominantly yellow with red markings.

Although this preserved specimen has lost all trace of colour,

dark V-shaped markings persist on the trunk and a median line

extends dorsally along the lateral processes and femur.

Bandings on the tibiae, the chelae and part of the cephalon

indicate that these areas also were pigmented, perhaps providing

useful diagnostic character in live material. This is a common

species of Pseudopallene in South Australian waters (pers.

com. Karen Gowlett-Holmes).

Distribution. Based on photographic records of live specimens,

this species may be widely spread in SE Australia.

Etymology. Named for the V-shaped dorsal trunk markings

(chevrons) which, in combination with the leg markings, appear

to be a distinctive diagnostic character; a noun in apposition.

100

David A. Staples

Pycnothea Loman, 1921

Pycnothea flynni Williams, 1940

Williams, 1940: 202-204, figs 6-9-Clark, 1963: 46-48,

fig. 23— Arnaud, 1972:160-161, fig. 2-Stock 1973a:121-Child, 1975:

16, fig. 6-Hooper, 1980: 475-Child, 1992: 30-Staples 1997: 1058,

fig. 21.5b.

Material examined. Wittelbee Point, near Ceduna; 9 Aug 1974; coll.

W. Zeidler. SAM E3682 (1 specimen).

Type locality. Rottnest I., Western Australia.

Distribution : Madagascar; Pelsart I., Western Australia; South

Australia; Victoria; Tasmania; New South Wales, Indo-Pacific.

Intertidal to 50 m depth.

Remarks. Genital pores are not evident, suggesting that this

specimen may be sub -adult.

Phoxichilidiidae Sars, 1891

Anoplodactylus Wilson, 1878

Anoplodactylus evansi Clark, 1963

Anoplodactylus evansi Clark, 1963: 51-53, fig. 26 A-G— Stock,

1973: 121-122 fig. lOb-Staples, 1997: 1063 fig. 21.6 pi. 67.5-Bamber,

2005: 338.

Material examined. Point Brown, coralline, rock, 10 m, H. Kirkman

SAM E3683 (1 male).

Type locality. Port Jackson, New South Wales.

Distribution. West I., South Australia to Tweed Heads,

Queensland and Tasmania. Intertidal to 16 m depth.

Remarks. A particularly colourful species most often collected

from amongst red algae in southern Australia (Poore, 2006).

Austrodecidae Stock, 1954

Austrodecus Hodgson, 1907

Austrodecus ( Austrodecus ) staplesi Stock 1990

Austrodecus staplesi Stock 1990: 269-271, figs 1-8— Bamber

2005: 339-340.

Austrodecus tubiferum Staples 1997: 1068, fig. 21. 8d.

Material examined. Western Australia, south of Esperance (34°32'S,

123°40'E), 80 m, epibenthic sled, stn GAB 087, 23 Jul 1995, P. E. Bock

NMV J56094 (1 male).

Type locality. Split Solitary I., New South Wales.

Distribution. Esperance Bay, Western Australia and along the

southeast coast to Coffs Harbour, New South Wales and

Tasmania. Depth 14-30 m.

Remarks. This single male is assigned to this species on the

basis of the propodus being longer than tibia 2, the location

of the cement gland tube on the mid-ventral surface of the

femur, the absence of auxiliary claws and possession of

4-segmented ovigers.

Pycnogonidae Wilson, 1878

Pycnogonum Brunnich, 1764

Pycnogonum (Retroviger) aurilineautum Flynn, 1919b

Pycnogonum aurilineatum Flynn, 1919: 92-95, Xlll, figs 1-2, pi.

XIV fig. 3-Stock, 1973a: 125-Staples, 1997: 1068-1070, fig. 21.8e,

pi. 68.5-Staples, 2002, 549-552, fig. 4A-H.

Material examined. Four Hummocks I. 10 m. shelf, site 16, code 64

bag, H. Kirkman, 3 Dec 1995. SAM E3684 (1 female).

Type locality. Port Arthur, Tasmania.

Distribution. Investigator Group, Great Australian Bight, South

Australia; Victoria; SE Tasmania to Coffs Harbour, New South

Wales. Intertidal to 23 m.

Remarks. This species is readily recognized by possession of a

pale, mid-dorsal stripe.

Acknowledgments

I am indebted to Thierry Laperousaz for providing material

from the South Australian Museum collections and to the

reviewers for their constructive comments.

References

Arnaud, F. 1972. Pycnogonides des recifs coralliens de Madagascar 3.

Famille des Callipallenidae. Tethys, suppl. 3, 157-164, figs 1-6.

Bamber, R. N. 2005. Pycnogonids (Arthropoda: Pycnogonida) from the

Recherche Archipelago, Esperance, Western Australia, Australia.

Pp. 325-341, in: The Marine Flora and Fauna of Esperance,

Western Australia. Western Australian Museum: Perth.

Carpenter, G. H. 1892. Pycnogonida. Reports on the zoological

collections made

in Torres Strait by Prof. A. C. Haddon, 1888-89. Scientific Proceedings

of the Royal Dublin Society 7 (n.s.), 522-558.

Child, C. A. 1975. Pycnogonida of Western Australia. Smithsonian

Contributions to Zoology. 19, 1-29

Child, C. A. 1992. Pycnogonida of the Southeast Pacific Biological

Oceanographic Project (SEPBOP). Smithsonian. Contributions to

Zoology. 526, 43.

Clark, W. C. 1963. Australian Pycnogonida. Records of the Australian

Museum 26 (1), 1-81.

Flynn, T. T. 1919. Two new Australian Pycnogonida. Papers and

Proceedings: Royal Society of Tasmania. 91-100, pis XI 1, XIV.

Flynn, T. T. 1928. The Pycnogonida of the Marine Survey of South

Africa. Reports of the Fisheries and Marine Survey of the Union

of South Africa. 6 (Special Reports, 1): 1-36.

Haswell, W. A. 1884. On the Pycnogonida of the Australian coast,

with descriptions of new species. Proceedings of the Linnean

Society N. S.W. 9, 1021-1034.

Hoek, P. P. C. 1881. Report on the Pycnogonida dredged by HMS

Challenger 1 873-76. Reports of the Scientific Results of the Exploring

Voyage of HMS Challenger, 3 (10): 1-167; 21 pis, 2 figs.

Hooper, J. N. A. 1980. Some aspects of the reproductive biology of

Parapallene avida, Stock (Pycnogonida: Callipallenidae) from

northern New South Wales. The Australian Zoologist 20,

part 3: 473-483.

Poore G. C. B 2006 Crustaceans and sea spiders. p303. in: Melbourne’s

Wildlife : A Field Guide to the Fauna of Greater Melbourne.

CSIRO Publishing: Melbourne

Pycnogonida from Great Australian Bight

101

Staples, D. A. 1982. Pycnogonida of the Calliope River and Auckland

Creek, Queensland. Memoirs of the Queensland Museum 20,

455-71.

Staples, D. A. 1997. Sea spiders or pycnogonids. (Phylum Arthropoda).

Pp.1040-1072, in: Shepherd, S. A., and Davies, M. (eds). Marine

Invertebrates of Southern Australia. Part 111. South Australian

Research and Development institute and Flora of South Australia

Handbooks Committee: Adelaide.

Staples, D. A. 2002. Pycnogonum (Pycnogonida: Pycnogonidae) from

Australia with descriptions of two new species. Memoirs of the

Museum of Victoria 59(2): 541-553.

Staples, D. A. 2005. Pycnogonida of the Althorpe Islands, South

Australia. Transactions of the Royal Society of South Australia S.

A. 129(2): 158-169.

Staples, D. A. 2007. Pycnogonida from the Investigator Group of

Islands, South Australia. Transactions of the Royal Society South

Australia (in press).

Stock, J. H. 1973a. Pycnogonida from south-eastern Australia.

Beaufortia 20(266): 99-127.

Stock, J. H. 1973b. Achelia shepherdi n.sp. and other Pycnogonida

from Australia. Beaufortia 21: 91-97.

Stock, J. H. 1968. Pycnogonida collected by the Galathea and Anton

Bruun in the Indian and Pacific Oceans. Videnskabelige

Meddelelser Fra Dansk Naturhistorisk Forening, i kjpbenhavn

131: 7-65.

Stock, J. H. 1990 A new species of Austrodecus (Pycnogonida) from

New South Wales, Australia. Tiidschrift voor Entomologie

133: 269-272.

Stock, J. H. 1991 Deep-water Pycnogonida from the surroundings of

New Caledonia. Memoires du Museum national d’Histoire

naturelle 151: 125-212.

Williams, G. 1940. Contributions to the fauna of Rottnest Island, 11:

Pycnogonida of Western Australia. Journal of the Royal Society

of Western Australia. 25: 197-205.

Wilson, E.B. 1878 Synopsis of the Pycnogonida of New England.

Transactions of the; Connecticut Academy of Arts and Sciences.

5: 1-26.

Memoirs of Museum Victoria 64: 103-106 (2007)

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/Memoirs/

Notes on Candelabrum australe (Briggs, 1928) (Hydm^ oa, Anthoathecatae)

Jeanette E. Watson

Marine Biology Section, Museum of Victoria, GPO Box 666E, Melbourne, Victoria 3001, Australia (hydroid@bigpond.com).

Abstract Watson, J. E. 2007 Notes on Candelabrum australe Briggs, 1928 (Hydrozoa, anthoathecatae). Memoirs of Museum

Victoria 64: 103-106.

Candelabrum australe is a rare species known only from southern Australian waters and is reported for the first

time from New Zealand. The large cap-shaped hydranth is very active. The cnidome comprises at least nine size-classes

of nematocysts in four morphological categories. The hydranth is bisexual, the sexes borne separately on stout branched

blastostyles from which lobate actinula larvae are released.

Keywords Candelabrum australe , southern Australia, New Zealand, active hydranth, cnidome, bisexual, actinula larva.

Introduction

Two species of Candelabrum ( Myriothela australis Briggs,

1928 and Myriothela harrisoni Briggs, 1928) are known from

south-eastern Australia. Briggs (1928; 1929; 1930) gave

detailed histological descriptions of both species. His pale

flesh-pink specimens of Candelabrum australe were attached

to the thalli of seaweed drifted on the beach at Maroubra Bay,

New South Wales but were in poor condition; Candelabrum

harrisoni occurred in numbers hanging from the underside of

rocks in the shallow sublittoral at Bulli, south of Sydney, New

South Wales.

Candelabrum australe was first recorded from Port Phillip,

Victoria, by Ralph (1966). Since then it has been reported

occasionally from the same locality by scuba divers and tide

pool collectors. There are two preserved specimens of C.

australe in the Ralph collection held in the National Museum

of New Zealand (NMNZ no. 1216), collected in 1969 from the

Banks Peninsula near Christchurch in the South Island.

A fully grown specimen of C. australe was observed in

southern Port Phillip Bay by the author in June 2007 on the

thallus of the brown kelp Ecklonia radiata in shallow water 2

m deep. Two months later (August 2007) it was photographed

in situ and collected for laboratory examination. Mid-winter

water temperature at the time of collection was 10°C.

Segonzac and Vervoort (1995) reviewed the then known 18

species of the genus Candelabrum. Since then, Shuchert

(1996) described but did not name an infertile, juvenile

specimen of a putative new species from New Zealand. Hewitt

and Goddard (2001) described a new species, Candelabrum

fritchmanii from the Pacific coast of the USA, bringing to 20

the known species of Candelabrum. Briggs (1928) made only

passing mention of the nematocysts of C. australe and Manton

(1940) and Hewitt and Goddard (2001) provided accounts of

the cnidome of several species of Candelabrum.

Observations of living material in the present study now

supplement Briggs’ (1928; 1929) descriptions of C. australe and

provide detailed information on the cnidome of the species.

Family Candelabridae de Blainville, 1830

Solitary hydroids; hydranth elongated, body cylindrical to

tapering, divided into 3 regions: a basal region (hydrorhiza), a

mid-region (blastostyle) and an elongate body with a circular

distal mouth. Hydrorhiza short, stout with tubular or root-like

adhesive processes, with or without perisarc; body with

thickened mesolamella and gastrodermal villi and numerous

scattered, capitate tentacles, simple or compound; gonophores

developing directly on hydranth or on blastostyles in a budding

zone below body.

Candelabrum australe (Briggs 1928)

Myriothela australis Briggs, 1928: 307, pi. 32, pi. 33, fig. 3, pi. 34,

figs 1-4.— Briggs 1929: 244, figs 1-4, pis 42-44.— Briggs, 1939: 10-

Manton, 1940: 280 et seq. fig. 8a.— Dakin, Bennett and Pope, 1948:

208,-Ralph, 1866: 158, 162.

Candelebrum australe —Segonzac and Vervoort, 1995: 35.—

Hewitt and Goddard, 2001: 2280.

Description. Living material (supplementing Briggs 1928).

Contracted hydroid cap-like in appearance, the gonophore-

bearing blastostyle region forming a decorative circular basal

rim and the body a tapering crown.

Hydrorhiza comprising numerous short stolons covered by

perisarc radiating from below the base of the hydranth but

obscured by the living animal; stolons terminating in small

104

Jeanette E. Watson

Table 1. Nematocysts of Candelabrum australe

Nematocyst

Capsule

Dimensions

Shaft

Tube/thread

Body

tentacle

Blastostyle

tentacle

Desmoneme (fig. 3A)

Elongate ovoid

18-20 x 12-15

Long, strongly

coiled 1

Absent

Desmoneme (fig. 3B)

Elongate ovoid

10-12x7-9

Coiled

***

Stenotele (fig. 3C)

Ovoid

21 x 13

Undischarged

Absent

Stenotele (fig. 3D)

Ovoid

15 x 13

Length 12 jtm

Absent

Stenotele (fig. 3E)

Round

15x 11

Thick, length 10 pim

***

Stenotele (fig. 3F)

Ovoid

12 x 10

Undischarged

Merotrichous isorhiza (fig. 3G)

Ovoid

19-22 x 14—16

Long, spinous2

Merotrichous Isorhiza? (fig. 3H)

Paddle-shape

8-9 x 5-6

Undischarged

Mesotele (fig. 31)

Leaf-shaped

18-21 x 7-9

Length 18 pim, spinous3

Moderately long

* * *

Order of abundance of nematocysts: **** (very abundant) to * (rare).

Notes, a. The shafts of the largest desmonemes are long and thick, with spines lining the proximal inner 3rd of the coil. b. Nematocysts

identified here as merotrichous isorhizas may belong to 3 distinct size-classes or to 1 class with a capsule very variable in size. Those on the

blastostyle tentacles are somewhat larger, extremely abundant and densely packed along the surface of the tentacle; when disturbed, an immensely

long thread (tubule) much longer than those of the body tentacles is ejected. The thread is smooth proximally followed by a finely spinous section

c. 30 pim long, then a very long smooth distal thread, c. The shafts of the mesoteles are long and spindle-shaped with a moderately swollen

spinous head and long thread.

The living hydroid is dark orange in colour showing paler longitudinal bands when the body is extended; mature female gonophores paler

yellow; apices of the blastostyle tentacles and the apical cap of mature gonophores with a dark brown granular band.

Figure 1 . Candelabrum australe. Laboratory

photograph of partially extended hydranth

on Ecklonia radiata thallus. A, capitate

body tentacles; B, blastostyle tentacles; C,

mature gonophore. Scale bar: 2 cm.

Figure 2 A, female blastostyle with clusters

of tentacles and young and mature

gonophores containing larvae. B, actinula

larva several hours after liberation. Scale

bar: A, 2 mm; B, 0.5 mm.

Figure 3 A, large desmoneme from body

tentacles. B, small desmoneme. C-F,

stenoteles. G, large merotrichous isorhiza.

H, small ?merotrichous isorhiza. I,

mesotele. Scale bar: 30 jim.

circular disks firmly attached to the algal thallus; hydrorhiza

entirely covered by a thin greyish layer of mucus. Body not

extending into the blastostyle region.

Body tentacles capitate, globular, numbering about 1500

(Briggs 1928), crowded together on the contracted hydranth

but separated when body expanded; tentacles borne on stout

transparent peduncles and richly armed with nematocysts.

Blastostyles crowded on lower body, bearing clusters of 6-10

apically flattened tentacles on stout peduncles; tentacles armed

with 100s of large nematocysts.

Hydranth bisexual, gonophores fixed sporosacs, male and

female gonophores borne separately on stout branched

blastostyles among clusters of tentacles; blastostyles comprising

numerous developing and mature gonophores; mature

gonophores of both sexes spherical, c. 1 mm in diameter with

a flattened circular apical cap. Several larvae visible inside

Candelabrum australe from Port Philip, southern Australia

105

mature female gonophores. Actinula larvae were liberated

after 36 hours in the laboratory; larvae flattened, typically

lobate but variable in shape, capable of slow, barely perceptible

movement.

At least 9 size-classes of nematocysts in 4 morphological

categories in the cnidome of the hydranth, all size-classes

occurring in the body tentacles and 6 size-classes in the

blastostyle tentacles. Data on the nematocysts are summarized

in Table 1.

Remarks. The common brown kelp Ecklonia radiata grows in

depths of 1-20 m in southern Australia and is likely the

seaweed upon which Briggs found his New South Wales

specimens of Candelabrum australe. The New Zealand

material provided no information about substrate but E.

radiata is also a common coastal kelp near Christchurch in the

South Island. Although the few southern Australian records of

C. australe suggest it is a rare species, it is probably widely

distributed in the abundant Ecklonia habitat.

The smooth, long-lived Ecklonia thallus would provide an

excellent substrate for attachment of a large hydroid lacking a

firm hydrocaulus. The hydrorhiza is strongly adherent to the

alga by radiating disk-like stolonal plugs. At the site of

attachment to the algal thallus there is a distinct light-coloured

aureole indicating reaction of the hydrorhizal mucus sheath

with the alga.

The tapering body of the hydranth is remarkably extensile

and prehensile, extending rapidly from 2-6 cm, sweeping back

and forth over the algal substrate somewhat reminiscent of an

elephant’s trunk. It is highly sensitive to stimulus, contracting

rapidly when touched. Authors’ descriptions of species of

Candelabrum report a small circular mouth but this is probably

an artifact of preservation. In contrast, the mouth of living

C australe is widely open when actively exploring the

substrate.

Briggs (1929) gave a detailed description of the development

of the gonophores and formation of the egg of C. australe but

as his specimens were almost dead, he could not provide

information on larval development. Schuchert (1996) observed

a juvenile specimen of an undescribed species of Candelabrum

from New Zealand. The specimen moved about slowly for

several weeks in the laboratory before adhering to a suitable

surface. In the present laboratory study, following liberation,

several flesh-pink larvae of C. australe moved sluggishly for

several hours on the Ecklonia substrate before attaching by a

plug of mucus. Rapid adherence of the larva to the algal

substrate would be a vital adaptation in strong water movement

of the Ecklonia habitat.

Several morphological categories of nematocysts

comprising the cnidome of Candelabrum have been noted by

authors: Jaderholm (1905), Manton (1940), Millard (1975),

Segonzac and Vervoort (1995), Hewitt and Goddard (2001).

Manton (1940) provides a broad classification and illustration

of the cnidome of Candelabrum penola (Manton, 1940),

Candelabrum capensis (Manton, 1940) and Candelabrum

cocksii (Vigurs, 1849) including heteronemes (= mesoteles),

stenoteles, desmonemes and haplonemes (= meretrichous

isorhizas). Millard (1975) figures the nematocysts comprising

the cnidome of C. capensis and C. tentaculata (Millard, 1966)

and Hewitt and Goddard (2001) tabulate the cnidome of known

species of the genus. The cnidome of C. australe comprises

the same morphological categories of nematocysts as reported

by these authors.

Examination of the gross morphological features of the

New Zealand material confirmed its identity as C. australe ,

thus extending the range of the species from 34-44°S and

across the Tasman Sea. As none of the nematocysts were

discharged in the New Zealand material and the cnidome had

deteriorated in preservation, no detailed examination of the

nematocysts was possible.

The arrangement of the body desmoneme tentacles of

C. australe is such that they would provide little assistance in

capturing and passing prey to the mouth; their function is

clearly that of defence. Laboratory observations indicated that

the large active mouth of the hydranth is capable of engulfing

prey, suggesting the species could possibly be regarded as a

grazer rather than a static predator.

In contrast to the body tentacles, the cnidome of the

blastostyles is overwhelmingly dominated by meretrichous

isorhizas aggressively armed with extraordinarily long barbed

threads capable of entangling large predators of the

gonophores.

Manton (1940) postulated that the hydranth of C. penola

may be long-lived, taking some years to reach maturity.

Longevity would be advantageous for a large and active

hydranth, allowing time for investment of energy in growth,

feeding and reproduction. Such longevity requires a firm,

equally long-lived substrate such as Ecklonia for settlement

and growth. While the life-span of C. australe is still

unknown, it spans several years, as the same 2 individuals

were regularly observed over a period of at least 3 years on an

Ecklonia plant in a shallow tide pool at Port Phillip Heads (R.

Burn, pers. com.).

Acknowledgements

I thank Robert Burn for information on his observations of

Candelabrum australe at Port Phillip Heads and Trevor

McMurrich for photographs of the species. I also thank the

National Museum of New Zealand for loan of specimens.

References

Briggs, E. A. 1928. Studies in Australian athecate hydroids No. I. Two

new species of the genus Myriothela. Records of the Australian

Museum 16: 305-315.

Briggs, E. A. 1929. Studies in Australian athecate hydroids. No. II.

Development of the gonophores and formation of the egg in

Myriothela australis, Briggs. Records of the Australian Museum

17: 244-264.

Dakin, W. J., Bennett, I., and Pope, E. 1948. A study of certain aspects

of the ecology of the intertidal zone of the New South Wales coast.

Australian Journal of Science 1: 176-230.

Hewitt C. L., and Goddard, J. H. R. 2001. A new species of large and

highly contractile hydroid in the genus Candelabrum (Hydrozoa,

Anthoathecatae) from southern Oregon, USA. Canadian Journal

of Zoology 79: 2280-2288.

106

Jeanette E. Watson

Jaderholm, M. E. 1905. Hydroiden aus antarktischen und

subantarkischen Meeren, gesammelt von der schwedischen

Siidpolar-Expedition. Wissenschaftliche Ergebnisse der

Schwedischen Siidpolar Expedition 1901-1903 5: 1-41.

Manton, S. 1940. On two new species of the hy droid Myriothela. Scientific

Reports of the British Graham Land Expedition 1: 255-293.

Millard, N. A. H. 1975. Monograph on the Hydroida of southern

Africa. Annals of the South African Museum 68: 1-513.

Ralph, R M. 1966. Hydroida. Port Phillip Survey 1857-1963. Memoirs

of the National Museum of Victoria 27: 157-160.

Segonzac, M., and Vervoort, W. 1 995 First record of the genus Candelabrum

(Cnidaria, Hydrozoa, Athecata) from the Mid-Atlantic Ridge: a

description of a new species and a review of the genus. Bulletin du

Museum National d’Histoire Naturelle, Paris 4° ser 17: 31-64.

Shuchert 1996. The marine fauna of New Zealand: athecate hydroids

and their medusae (Cnidaria: Hydrozoa). New Zealand

Oceanographic Institute Memoir 106: 1-159.

Memoirs of Museum Victoria 64: 107-148 (2007)

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/Memoirs/

New apseudomorph tanaidaceans (Crustacea: Peracarida: Tanaidacea) from eastern

Australia: Apseudidae, Whiteleggiidae, Metapseudidae and Pagurapseudidae

Magdalena Blazewicz-Paszkowycz 1 - 2 And Roger N. Bamber 3

laboratory of Polar Biology and Oceanobiology, University of Lodz, Banacha 12/16, PL-90-237 Lodz, POLAND, (magdab@biol.uni.lodz.pl)

2 Museum Victoria, PO Box 666, Melbourne, Victoria 3001, Australia

department of Zoology, The Natural History Museum, Cromwell Road, London SW7 5BD, United Kingdom, (r.bamber@nhm.ac.uk)

Abstract Blazewicz-Paszkowycz, M., and Bamber, R. N. 2007 New apseudomorph tanaidaceans (Crustacea: Peracarida: Tanaidacea)

from eastern Australia: Apseudidae, Whiteleggiidae, Metapseudidae and Pagurapseudidae. Memoirs of Museum Victoria

64: 107-148.

Investigation of apseudomorph tanaidacean material collected between 1979 and 1984 from Bass Strait and held in

the collections of Museum Victoria, Melbourne, Australia, has revealed eight new species, five in Apseudidae (including

one new genus), two in Metapseudidae (including one new genus) and one in Pagurapseudidae. These taxa are described

below. The new apseudid genus Annexos shows great similarity to Apseudes sensu stricto, but is without an exopod on the

cheliped or on pereopod 1. Two new species of Apseudes show a common feature of maxilliped spination in eastern

Australian taxa; Spinosapseudes colobus sp. nov., the second species of this genus, is described from a similar geography

to the first, but is distinguished by the proportionately more compact articles of the antennular and antennal peduncles, the

mandibular palp and the pereopods. Pugiodactylus syntomos sp. nov. is predominantly distinguished by having compact

articles in the antenna, cheliped and pereopod 1; Labraxeudes heliodiscus gen. et sp. nov. (Metapseudidae) has a unique

combination of substantial rostrum, exopodites on the cheliped and pereopod 1, compact antenna, short uropod, simple

pereonite setation, compact propodi, dorsum of pereopod 1 basis without apophyses, robust cheliped and antennule

peduncle without inner row of conspicuous denticulation; Metapseudes wilsoni sp. nov., only the second species of this

genus to be discovered, is distinguished by its conspicuously more slender antennules and antennae with more pronounced,

pointed denticulations on the proximal antennule peduncle article, and one fewer article in the main flagellum of the

antennule; Similipedia diarris sp. nov., again the second species of this genus to be discovered, is distinguished by having

no squama on the antenna, no rostrum, and dorsal spiniform apophyses rather than setae on the pereonites.

Keywords Tanaidacea, Apseudomorpha, Australia, Bass Strait, Annexos, Apseudes, Gollumudes, Spinosapseudes, Pseudowhiteleggia,

Pugiodactylus, Labraxeudes, Metapseudes, Similipedia, Whiteleggia.

Introduction

Recent investigations of the Tanaidacea of Australia have

discovered high diversity of this group of the Peracarida,

including a relatively large number of previously undescribed

species and genera (see Blazewicz-Paszkowycz and Bamber,

2007 for literature). Most recently, Gupt (2006), Blazewicz-

Paszkowycz and Bamber (2007) and Bamber (in press) have

described a number of new taxa from Eastern Australia,

predominantly Moreton Bay, Brisbane, and Bass Strait.

Blazewicz-Paszkowycz and Bamber (2007) described, inter

alia, parapseudid taxa collected during the period 1979-1984

within Bass Strait (see Wilson and Poore, 1987) over a wide

depth range, and held in the collections of Museum Victoria,

Melbourne. The present paper continues this work by describing

further apseudomorph material from those and other collections

held at the Museum, including eight new species, five in

Apseudidae (including one new genus), two in Metapseudidae

(including one new genus) and one in Pagurapseudidae.

The type material and other studied materials are deposited

at Museum Victoria (Melbourne, Australia).

Morphological terminology is as in Bamber and Sheader

(2005) and Blazewicz-Paszkowycz and Bamber (2007), except

that the plumose sensory setae commonly occurring on

tanaidacean antennae and pereopod bases, inter alia, (“broom

setae” sens, auctt.) are referred to as penicillate setae to be

consistent with terminology in other crustacean groups (and

because brooms have so many different shapes around the world);

comb-rows of fine setules, occasionally present on maxillae and

pereopod articles, inter alia, (e.g. fig. 24E) are referred to as

microtrichia. Serially repetitive body-parts, such as the

subdivisions of the antennal flagella and of the uropod rami are

segments, while those with independent musculature (such as the

108

Magdalena Bfazewicz-Paszkowycz and Roger N. Bamber

Figure 1. Annexos abditospina gen. et sp. nov., holotype female, dorsal. Scale line = 1mm.

Apseudomorpha of eastern Australia

109

Figure 2. Annexos abditospina gen. et sp. nov.. A, antennule; B, antenna; C, right mandible; D, left mandible; E, maxillule; F, maxilla; G, labium;

H, maxilliped; FF, maxilliped endite; J. epignath. Scale line = 0.1 mm.

110

Magdalena Bfazewicz-Paszkowycz and Roger N. Bamber

Figure 3. Annexos abditospina gen. et sp. nov.. A, cheliped; B-G, pereopods 1-6 respectively; H, pleotelson and left uropod; I, pleopod.

Scale line = 0.1mm.

Apseudomorpha of eastern Australia

111

parts of the pereopods) are articles. The term “spines” is used in

the traditional (and etymologically correct) sense of rigid “thorn-

like” structures (avoiding the contextual oxymoron “spiniform

setae” sensu Watling, 1989) to distinguish them from the flexible

“hair-like” setae; non-articulating spiniform extensions of the

cuticle are mainly considered to be apophyses.

Measurements are made axially, dorsally on the body and

antennae, laterally on pereopods.

Sex determination is confusing in apseudomorphs owing

to the phenomenon of hermaphroditism at certain stages of

particular species which retain rudimentary oostegites and

genital cones at the same time (Drumm and Heard, studies in

progress). It is not the purpose of this paper to solve the

problem of apseudomorph hermaphroditism; therefore we

simplified the question and unless the marsupium was fully

developed (in case of the females) or secondary sexual

characters were apparent (in case of the males) the sex

determination was avoided. Consequently, the individuals

with both rudimentary oostegites and with genital cone were

called hermaphrodite.

Order Tanaidacea Dana, 1849

Suborder Apseudomorpha Sieg, 1980

Superfamily Apseudoidea Leach, 1814

Family Apseudidae Leach, 1814

Subfamily Apseudinae Leach, 1814

Remarks. The genus Apseudes has long been used as a convenient

taxon in which to describe symmetrical, dorsoventrally-flattened

apseudomorphs of a “standard” morphology with a spiniform

apophysis on the coxa of pereopod-1, largely as it was the first

apseudomorph genus to be named, preceding the next

{Par apseudes Sars, 1882 and Sphyrapus Sars, 1882) by 68

years. It has long been recognised that Apseudes sensu lato is

polyphyletic, and since 1970 a number of the (then) 60-odd

species which accord with the above definition has been split off

into new genera such as Fageapseudes Bacescu and G 11 ( 11 , 1971,

Tuberapseudes Bacescu and Gufu, 1971, Atlantapseudes

Bacescu 1978, Langapseudes Bacescu 1987, and Hoplomachus

Gufu, 2002. Gufu (2006) has recently undertaken a useful

reanalysis of the formerly polyphyletic genus, restricting

Apseudes and resurrecting Apseudopsis Norman, 1899, inter

alia, affording a valuable basis from which, in Gufu’s own

words, a more minute revision wifi be enabled in the future (for

example by multivariate analysis).

With the discovery in the present material of 4 species of

Apseudinae, their morphology has been compared with 58

specific taxa (as alluded to above) using a dataset based on 21

morphological features (where available), in an attempt to base

generic diagnoses on overall morphology rather than biasing

classification to that of individual characters (“Characters come

from the genus, not the genus from the characters”: Linne, 1751).

Having said that, the 1st taxon below shows sufficient distinction

in 1 major character to support its separation to a new genus.

Genus Annexos gen. nov.

Diagnosis. Coxa of pereopod 1 with conspicuous spine-like

apophysis. Rostrum triangular, cephalon without spines anterior

to the branchial chamber; pereonites 3 to 6 with anterior spine-

like apophyses; pleotelson longer than wide. Antennule with

internal margin of proximal peduncle article finely corrugated;

flagella multisegmented. Cheliped and pereopod 1 without

exopodite. Pereopods 1 to 3 with proximal inner hooks on basis.

5 pairs of pleopods; uropods filiform and multi-segmented.

Etymology. Contrived from an - without, and exopod, the only

character which removes this taxon from Apseudes being the

absence of an exopod on the cheliped and on pereopod 1.

Type species. Annexos abditospina sp. nov. by original

designation.

Gender. Feminine.

Remarks. This genus has close morphological similarity to the

genus Apseudes, notably the approximately 16 species of

Apseudes with anterolateral spiniform apophyses on the

pereonites but no lateral spiniform apophysis anterior to the

branchial chamber, including the type species A. talpa (Montagu,

1808) with its triangular rostrum and internal corrugation on the

antennule peduncle. However, Annexos gen. nov. is entirely

without exopodites on both the cheliped and pereopod 1, a

feature differentiating the genus from all other Apseudinae.

There are 3 genera within the Apseudinae which lack exopodites

on only pereopod 1, viz. Atlantapseudes Bacescu, 1978,

Typhlapseudes Beddard, 1886, and Mendamanus Bamber, 1998,

but all have an exopodite on the cheliped. The genus Fageapseudes

Bacescu and Gufu, 1971, lacks exopodites on both cheliped and

pereopod 1 but this genus has recently been reclassified into

Leviapseudinae (Bamber, 2007).

With only 1 species, it is difficult to decide which of the

other features of this species might be generic characters. The

proximal basal hooks on the pereopods are also found in

Apseudes atuini Bamber, 2005, from southwestern Australia,

although that species has these apophyses on pereopods 4 to 6

as well. The serrations on the body of the mandible, and the

robust proximal spines on the maxilliped are distinctive, but

Apseudes bucospinosus Gufu, 2006, from Heron I.,

Queensland, also has inner-distal “spiniform processes” on

the basis and proximal palp article of the maxilliped (from

which it derives its specific name), possibly analogous to the

spines of the present species.

Annexos abditospina sp. nov.

Figures 1-3

Material. Brooding female, holotype (NMV J53137) Australia,

Victoria, Eastern Bass Strait, 20 km SE of Port Albert (38°43.04'S,

144°18.02'E), 79 m, 18/11/1981, (BSS 178), Wilson, RS et al.

Paratypes: 20 hermaphrodites (NMV J55745), same locality as

holotype; 1 specimen dissected on slides (NMV J55945), same locality

as holotype; VIMS Cruise 81-T-l, NZOI RV Tangaroa, Stn 178, 20 km

SE of Port Albert, Victoria, 38°43.4'S 146°56.9'E, 26 m depth,

18 Nov 1981; coll. R. Wilson; 3 individuals (NMV J55776), Tasmania,

eastern Bass Strait, 20 km SSW of Babel I. (40°06.48’S, 148°24.18'E),

112

Magdalena Blazewicz-Paszkowycz and Roger N. Bamber

22 m, 14/11/1981 (BSS 166), R.S. Wilson; 1 individual (NMV J55777),

Tasmania, central Bass Strait, 23 km E of Cape Rochon, Three

Hummock I. (40°22.12'S, 145°17.00'E), 40 m, 03/11/1980, (BSS 112),

M.F. Gomon and G.C.B. Poore; 5 hermaphrodites (NMV J55778),

Victoria, eastern Bass Strait, 8 km S of South East Point, Wilsons

Promontory (39°12.54'S, 146°27.18'E), 65 m, 18/11/1981, (BSS 180),

R.S. Wilson; 1 individual (NMV J55779), eastern Bass Strait, 50 km

SE of Port Albert (38°54.18'S, 147°13.24'E), 58 m, 18/11/1981, (BSS

176), R.S. Wilson; 1 ovigerous female, 2 hermaphrodites, 5 individuals

(NMV J55780), eastern Bass Strait, 43 km SE of Port Albert

(38°53.42'S, 147°06.30'E), 58 m, 18/11/1981, (BSS 177), R.S. Wilson.

Description of female. Body dorsoventrally flattened, elongate,

holotype 9.2 mm long (tip of rostrum to posterior of pleotelson),

6 times as long as wide, narrower posteriorly. Cephalothorax

subrectangular, slightly longer than wide, anterior margin with

conspicuous triangular, pointed rostrum with notches just anterior

to ocular lobes. Eyes present; eyelobes rounded; no lateral

spiniform apophyses anterior of branchial chambers. 6 free

pereonites; pereonites 1 and 2 subequal in length, almost 1/3 as

long as cephalothorax, lateral margins uniformly convex, dorsal

sculpturing conspicuous; pereonites 3 to 6 with anterolateral

spiniform apophyses and expanded posterolaterally at attachment

of coxae; pereonite 3 as long as pereonite 2, pereonites 4, 5 and 6

subequal (5 longest), 1.3 times as long as pereonite 1 (all

pereonites respectively 2.7, 2.4, 2.1, 1.7, 1.6 and 1.5 times as

wide as long); conspicuous sickle-shaped ventral hyposphenium

on pereonite 1, blunt hyposphenium with distal, posteriorly-

directed spine, on pereonite 6. Pleon 1/3 as long as body, of 5 free

subequal pleonites bearing pleopods; pleonites dorsally convex,

more than 3 times as wide as long, laterally expanded by spiniform

apophyses. Pleotelson rectangular, slender, 2.2 times as long as

wide, with numerous plumose lateral setae.

Antennule peduncle 4-articled, proximal article 2.9 times

as long as wide, internal margin finely corrugated, outer

proximal penicillate setae, outer and inner tufts of simple

setae at midlength and distally; article-2 0.3 times as long as

article 1, with distal crown of inner and outer simple setae and

dorsal penicillate setae; article 3 one -third as long as article 2,

article 4 just shorter than article 3. Main flagellum of 19

segments; segments 11, 13 and 15 bearing aesthetascs;

accessory flagellum of 6 articles.

Antenna proximal peduncle article without apophyses;

article 2 inner margin finely denticulate, bearing elongate

squama with 17 plumose marginal setae; peduncle article 3 as

long as wide, with 1 seta; article 4 slightly shorter than article

5, and 3 times as long as article 3; article 5 with strong outer

setae. Flagellum of 15 segments.

Mouth parts. Labrum not seen. Left mandible, bearing

strong, crenulated pars incisive; lacinia mobilis with denticulate

cutting edge, setiferous lobe with 4 bifurcate or trifurcate setae;

pars molaris robust, blunt. Right mandible as left but without

lacinia mobilis; outer margin denticulate; mandibular palp of 3

articles, article 1 just longer than wide with 7 inner setae, article

2 3.5 times as long as article 1 with group of longer and shorter

simple inner setae in distal half; article 3 half length of article 2

with 10 inner simple setae increasing in length distally, 2 dorsal

subdistal simple setae, and 2 longer distal setae. Maxillule inner

endite with finely setose outer margin and blunt apophysis,

inner margin proximally denticulate with adjacent setulose

margin; 5 finely setulate distal setae, inner 3 distally compound;

outer endite with 11 distal spines and 2 subdistal setae, outer

margin finely setose, distally with microtrichia; palp of 2

articles, distally with 5 setae. Maxilla with serrations and setules

on outer margin; outer lobe of outer endite with 2 setae with

setules at midlength on outer margin, 8 distal setae, each distally

setulose; inner lobe of movable endite with dense group of

simple distal setae; outer lobe of inner endite with 6 simple, 3

trifurcate, 2 inner compound and 1 subdistal setulose spines;

inner lobe of fixed endite with rostral row of numerous setae

guarding 3 longer setae. Labium with distally-serrated outer

margin and setulose distal margin, palp with fine lateral setules

and 2 longer and 1 very-short distal setae. Maxilliped basis with

inner and distal setae and inner-distal stout spine; palp article 1

with paired distal spines on outer margin and stout inner-distal

spine; palp article 2 longer than wide, with rows of numerous

short setae on inner margin, 2 longer proximal setae as long as

article, outer margin with spine distally; palp article 3 wider

than long, with numerous simple filtering setae along inner

margin; palp article 4 with 5 distal setae, 1 outer subdistal seta

and 5 inner distal setae. Endite with flagellate inner caudodistal

seta, simple outer distal setae and stout, spatulate, distal spines;

5 coupling hooks. Epignath large, cup-shaped, distal spine

setulose.

Cheliped slender. Basis 2.4 times as long as wide, dorsally

naked, ventrally with 1 longer and 1 shorter proximal seta,

midventral spine and tuft of 3 distal setae; exopodite absent.

Merus elongate, narrower proximally, with midventral simple

setae and ventrodistal group of 3 setae and short spine. Carpus

4.7 times as long as wide, with simple setae along ventral

margin, dorsal and ventral distal setae much shorter. Chela

fingers shorter than palm, ventral margin of fixed finger with

10 setae, longer seta at inner base of fixed finger; 6 setae near

articulation of fixed finger; cutting edge of fixed finger with

row of fine setules but no apophyses; dactylus with no

apophyses on cutting edge, distal claw pointed.

Pereopod 1 with pronounced, setose spine-like apophysis

on coxa. Basis stout, 3 times as long as wide, with sparse

ventral setae, 3 distal setae around ventrodistal spine; inner

proximal hook-like apophysis; exopodite absent. Ischium with

3 simple ventrodistal setae. Merus half as long as basis, with

groups of ventral submarginal and dorsodistal setae, single

ventrodistal spine but no dorsodistal spine. Carpus 0.8 times

as long as merus, ventrally with 2 spines in distal half, and

single dorsodistal spine. Propodus slightly shorter than carpus,

with 4 ventral and 2 dorsal spines. Dactylus with mid-dorsal

fine setae, no apparent ventral denticulations; unguis short.

Pereopod 2 more slender. Coxa with small spiniform

apophysis. Basis 3.6 times as long as wide with 2 longer

marginal, numerous ventral marginal and tuft of ventrodistal

setae. Merus 0.8 times as long as carpus, with elongate ventral

setae and slender ventrodistal spine. Carpus elongate, with

rows of ventral and dorsodistal setae, and ventrodistal spine.

Propodus 1.2 times as long as carpus, dorsal and ventral

margins setose as figured, 2 ventral and 1 dorsodistal spines.

Dactylus slender, unguis finely pointed, the 2 together 0.75

times as long as propodus.

Apseudomorpha of eastern Australia

113

Figure 4. Apseudes tuski sp. nov., holotype female, dorsal. Scale line = 1mm.

114

Magdalena Bfazewicz-Paszkowycz and Roger N. Bamber

Figure 5. Apseudes tuski sp. nov.. A, antennule; B, antenna; C, left mandible; D, right mandible; E, maxillule; F, maxilla; G, labium; H, maxilliped;

FT, maxilliped endite. Scale line = 0.1mm.

Apseudomorpha of eastern Australia

115

Figure 6. Apseudes tuski sp. nov.. A, cheliped; B-G, pereopods 1-6 respectively; H, pleotelson and left uropod. Scale line = 0.1mm.

116

Magdalena Blazewicz-Paszkowycz and Roger N. Bamber

Pereopod 3 similar to pereopod 2, but basis with penicillate

seta, propodus with inner subdistal spine.

Pereopod 4 similar to pereopod 2 but basis stouter, 2.8

times as long as wide, without proximal hook-like apophysis,

with dorsoproximal and ventrodistal penicillate setae, merus

with midventral, ventrodistal and dorsodistal spines, carpus

twice as long as merus, with midventral spines and distal

crown of 4 spines about 0.5 as long as propodus, interspersed

by longer setae; propodus with dorsodistal tuft of 2 short and

6 longer setae; dactylus plus unguis shorter than propodus but

longer than longest dorsodistal propodal setae.

Pereopod 5 similar to pereopod 2, but without proximal

hook-like apophysis, propodus with mid-dorsal penicillate

seta and ventral row of 5 spines in distal half, dorsodistal setae

as long as dactylus; dactylus and unguis slender, together as

long as propodus.

Pereopod 6 basis with dorsal and ventral margins entirely

setose, merus and carpus without spines, propodus with

numerous ventral leaf-like propodal spines extending around

distal margin of article.

Pleopods all alike. Basis elongate, with 4 ventral plumose

setae, dorsal margin naked. Endopod longer than exopod; both

rami slender, linguiform, with plumose setae.

Uropod biramous, both rami filiform, multi-segmented. Basis

with 1 inner distal seta; exopod about 0.5 as long as endopod,

with 13 segments; endopod elongate with 24 segments.

Male unknown.

Etymology. From the Latin abditus - hidden, secret, and spina

- a thorn or spine, referring to the maxilliped palp inner spines

and the proximal spiniform apophysis on the basis of pereopods

1 to 3 (noun in apposition).

Remarks. See above under generic remarks.

Genus Apseudes Leach 1814

Apseudes tuski sp. nov.

Figures 4-6

Material. Female, holotype (NMV J471 19), 1 brooding female, Australia,

Victoria, eastern Bass Strait, 43 km SE of Port Albert (38°53.42'S,

147°06.30'E), 58 m, 18/11/1981, (BSS 177), R.S. Wilson; Paratypes: 37

females (NMV J55748), same locality as holotype; 1 female dissected on

slides (NMV J55942), same locality as holotype; 2 individuals (NMV

J28577), eastern Bass Strait, 10.8 km E of eastern edge of Lake Tyers

(37°50.55'S, 148°12.50'E), 25/09/1990, (MSL-EG 118), N. Coleman; 2

individuals (NMV J28625), Stn MSL-EG 58, eastern Bass Strait,

4.6 km S of Cape Conran (37°51.26'S, 148°43.44'E), 50 m, 28/09/1990,

(MSL-EG 58), Marine Science Laboratories; 7 individuals (NMV

J28624), Australia, Victoria, eastern Bass Strait, 5.3 km ESE of Pt.

Ricardo (37°50.29'S, 148°40.35'E), 43 m, 28/09/1990, (MSL-EG 54),

Marine Science Laboratories; 2 individuals (NMV J55781), Western

Port, off Crib Point (38°21.10'S, 145°14.00'E), 18 m, 29/03/1965,

(CPBS-0 60), AJ. Gilmour; 1 individual (NMV J55782), eastern Bass

Strait, 28 km SSW of Mario (37°59’S, 148°27'E), 51 m, 30/07/1983,

(BSS 207), M.F. Gomon and R.S. Wilson; 2 individuals (NMV J28623),

eastern Bass Strait, 15.1 km WSW of Pt. Ricardo (37°51.38'S,

148°28.14'E), 34 m, 26/09/1990, (MSL-EG 49); 1 individual (NMV

J28575), eastern Bass Strait, 11.7 km W of Pt. Ricardo (37°49.53'S,

148°30.08’E), 27 m, 02/1991, (MSL-EG 103), N. Coleman; 1 ovi

female, eastern Bass Strait, 8 km S of South East Point, Wilsons

Promontory (39°12.54'S, 146°27.18'E), 65 m, 18/11/1981, (BSS 180),

R.S. Wilson; 1 hermaphroditic, 81-T-l, Stn 166, (NMV J55784), eastern

Bass Strait, 20 km SSW of Babel I. (40°06.48’S, 148°24.18'E), 22 m,

14/11/1981, (BSS 166), R.S. Wilson; 1 ovi female, (NMV J55785),

western Bass Strait, 35 km SSW of Cape Otway, Victoria (39°07.00'S,

143°14.36'E), 84 m, 20/11/1981, (BSS 183), R.S. Wilson.

Description of female. Body dorsoventrally flattened, elongate,

holotype 5.3 mm long (tip of rostrum to posterior of pleotelson),

5.2 times as long as wide, narrower posteriorly. Cephalothorax

subrectangular, slightly longer than wide, anterior margin with

conspicuous but blunt rostrum with rounded “shoulders” at base.

Eyes present; eyelobes rounded; no lateral spiniform apophyses

at anterior margin of branchial chambers. 6 free pereonites, all

without lateral spiniform apophyses; pereonite 1 shortest, about

one-quarter as long as cephalothorax, pereonite 2 1.5 times as

long as pereonite 1, both with lateral margins uniformly convex;

pereonites 3 , 4 and 6 subequal, twice as long as pereonite 1, with

anterolateral indentations reflecting dorsal sculpturing and

expansions over coxae of pereopods; pereonite 5 just longest,

1.2 times as long as and of similar morphology to pereonite 4

(all pereonites respectively 4.0, 2.3, 1.7, 1.6, 1.4 and 1.5 times as

wide as long); ventral hyposphenia on pereonites 2 and 6. Pleon

twice as long as pereonite 5, of 5 free subequal pleonites bearing

pleopods; pleonites dorsally convex, 2.5 times as wide as long,

laterally expanded by spiniform apophyses. Pleotelson

rectangular, short, one-third length of whole pleon, 1 . 1 times as

long as wide, with bunches of lateral setae on similar rounded

protuberances to those of pereonites 3 to 6.

Antennule peduncle 4-articled, article 1 3.2 times as long as

wide, with inner margin denticulate, setose as figured; 2 0.45

times as long as 1st, with simple inner and longer outer-distal

setae; 3 less than half length of article 2, article 4 half as long as

article 3, naked. Main flagellum of 8 segments, segments 6 and

8 bearing aesthetascs; accessory flagellum of 5 segments.

Antenna peduncle article 1 simple; article 2 bearing 2 inner

and 1 outer marginal seta and elongate squama with 8 marginal

setae; peduncle article 3 as long as wide, naked; article 4

slightly longer than article 5, and 4 times as long as article 3.

Flagellum of 7 segments.

Mouth parts. Labrum not seen. Left mandible with outer

margin naked, bearing narrow crenulated pars incisiva and

lacinia mobilis, setiferous lobe with 3 trifurcate setae, pars

molaris robust, blunt; mandibular palp of 3 articles, article 1

naked, articles 2 and 3 with 9 ventral setae in distal half,

distally with additional 4 longer simple setae. Right mandible

as left but without lacinia mobilis. Maxillule inner endite with

finely setose outer margin and 5 finely setulate distal setae;

outer endite with 11 distal spines and 2 subdistal setae, outer

margin finely setose; palp of 2 articles, distally with 5 setae.

Maxilla with tuft of setae on outer margin; outer and inner

lobes of outer endite with bilaterally setulose setae; outer lobe

of inner endite with bilaterally setulose, plumose and trifurcate

distal and subdistal spines as figured, outer margin denticulate,

inner margin with microtrichia; inner lobe of fixed endite with

rostral row of numerous setulose setae guarding 4 longer setae.

Labium with fine serrations on outer margin and setulose

Apseudomorpha of eastern Australia

117

Figure 7. Apseudes poorei sp. nov., holotype female, dorsal. Scale line = 1mm.

118

Magdalena Bfazewicz-Paszkowycz and Roger N. Bamber

Figure 8. Apseudes poorei sp. nov.. A, antennule; B, antenna; C, left mandible; C\ pars molaris of same; D right mandible; E, maxillule;

F, maxilla; G, maxilliped; G\ maxilliped endite; H, epignath. Scale line = 0.1mm.

Apseudomorpha of eastern Australia

119

Figure 9. Apseudes poorei sp. nov.. A, cheliped; B-E, pereopods 1-4 respectively; F, pereopod 6; G, pereopod 5; H, pleopod; I, pleotelson and

right uropod. Scale line = 0.1mm.

120

Magdalena Blazewicz-Paszkowycz and Roger N. Bamber

distal margin, palp with fine lateral setules and 3 simple distal

setae. Maxilliped basis with 3 distal setae; palp article 1 with

single inner and outer distal setae; palp article 2 longer than

wide, with 2 rows of filtering setae on inner margin, the longest

as long as article 3, outer margin with 3 spines, distal spine

large and robust; palp article 3 longer than wide, with 9 simple

setae along inner margin; palp article 4 with 10 distal setae,

and single inner and outer subdistal setae. Maxilliped endite

with setulose inner caudodistal seta and stout, spatulate, distal

spines; 2 coupling hooks. Epignath not seen.

Cheliped slender. Basis 2.9 times as long as wide, dorsally

with single fine seta, ventrally with simple proximal seta,

midventral spine and 2 distal setae; exopodite present, 3 -articled,

article 2 with 2 setules, article 3 with 4 plumose setae. Merus

elongate, narrowing proximally, with 1 midventral seta and

4 subdistal setae on ventral “shoulder”. Carpus 6.6 times as

long as wide, with sparse longer and shorter simple setae along

ventral margin, short setae at mid-length and distal ly on dorsal

margin. Chela fingers shorter than palm, ventral margin with

7 setae; 3 outer setae on fixed finger, cutting edge with 8 fine

setae but no apophyses; dactylus with 3 subdistal setae but no

apophyses on cutting edge, distal claw pointed.

Pereopod 1 with pronounced spine-like apophysis on coxa.

Basis stout, 2.6 times as long as wide, with dorsal and ventral

marginal setae and ventrodistal spine; exopodite present,

3 -articled, article 3 with 4 distal plumose setae. Ischium with

2 simple ventrodistal setae. Merus half as long as basis, with

ventrodistal but no dorsodistal stout spine. Carpus 0.75 times

as long as merus, with dense tuft of dorsodistal setae

surrounding short, stout spine, ventrally with 2 stout spines.

Propodus as long as carpus, with 4 ventral and 2 dorsodistal

stout spines. Dactylus stout, with 2 middorsal fine setae and

ventral denticulations; unguis short.

Pereopod 2 more slender. Basis 4 times as long as wide

with sparse setae. Merus 0.9 times as long as carpus, with

slender ventrodistal spine. Carpus elongate, with dorsodistal

seta as long as article, sparse setae otherwise, and ventrodistal

slender spine. Propodus as long as carpus, 2 ventral spines,

dorsally with 1 distal and subdistal spines. Dactylus slender

with fine dorsal setae, unguis slender, the 2 together just

shorter than propodus.

Pereopod 3 similar to pereopod 2, but basis and propodus

with penicillate setae, longest seta on ischium longer than mems.

Pereopod 4 basis more robust, twice as long as wide, with

dorsoproximal penicillate setae, longest seta on ischium longer

than merus, merus with 2 shorter ventrodistal spines and long

dorsodistal seta almost as long as carpus, carpus with paired

ventral spines, longer distal spines; propodus with

dorsoproximal penicillate seta, dorsodistal tuft of 6 short and

2 long finely denticulate setae, distal spines as long as dactylus;

dactylus plus unguis two-thirds as long as propodus.

Pereopod 5 similar to pereopod 4; setae on ischium and

merus proportionately shorter, dactylus plus unguis

proportionately longer, propodus with dorsodistal spines.

Pereopod 6 basis with setae along entire dorsal and ventral

margins, paired long dorsal setae on merus and carpus, carpus

with slender dorsodistal spine, 18 ventral leaf-like propodal

spines extending around distal margin of article.

Pleopods all similar, basis with 2 ventral and 1 dorsal

plumose setae, rami elongate, inner ramus setose all round,

outer ramus shorter, with naked inner proximal margin.

Uropod biramous, both rami filiform, multi-segmented. Basis

with outer row of setae; exopod one-quarter as long as endopod,

with 8 segments; endopod elongate, with about 24 segments.

Male unknown.

Etymology. The species in named after the Polish Prime

Minister Donald Tusk who was elected as this species was

being described..

Remarks. Apseudes tuski sp. nov. is most similar to that group of

Apseudes sensu lato with no spiniform apophyses on the

cephalon or pereon, and rounded ocular lobes usually with eyes,

similar to A. latreilli (Milne-Edwards, 1828) and A. africanus

Tattersall, 1925. The new species appears closest to

A. erythraeicus Bacescu, 1984 (q.v.) from the Red Sea, but that

species has a dorsodistal spine on the merus, more articles in the

antennular main flagellum, proportionately more compact

antennular peduncle articles, more setae on the antennal squama

and a pointed rostrum. Indeed, in the absence of a dorsodistal

spine on the merus, A. tuski approaches the genus Apseudopsis

Norman, 1899 sensu Gufu (2006); however, the short cephalon,

the presence of eyes and the multiarticulated uropod exopod

prevent placing the present species in that essentially

Mediterranean - North-Atlantic genus, and Gufu (2006) points

out that the denticulation of the inner margin of the proximal

antennular peduncle article, well-developed in A. tuski, is a

feature of Apseudes sensu stricto.

The comparatively blunt rostrum, and the relatively short,

blunt marginal spines on pereopod 1, particularly the very

short dorsodistal spine on the merus are valuable distinguishing

features of A. tuski, while the peculiar outer spination of the

proximal maxilliped palp article appears to be unique.

Apseudes poorei sp. nov.

Figures 7-9

Material. Female, holotype (NMV J55747); Australia, Victoria, Western

Port, off Crib Point (38°20.49'S, 145°13.51'E), 13 m, 30/03/1965,

(CPBS-N 41), AJ. Gilmour. Paratypes: 1 female with oostegites, 1

juvenile, (NMV J53142), 2 specimens dissected on slides (NMV

J55943), same locality as holotype; 1 male (NMV J55790), eastern Bass

Strait, 8 km S of South East Point, Wilsons Promontory (39°12.54’S,

146°27.18'E), 65 m, 18/11/1981, (BSS 180), R.S. Wilson; 1 individual

(NMV J55791), eastern Bass Strait, 37 km NNE of Eddystone Point

(40°43.48'S, 148°37.12'E), 67 m, 14/11/1981, (BSS 164), R.S. Wilson;

2 individuals (1 adult male), (NMV J55792), Tasmania, eastern Bass

Strait, 30 km N of North Point, Flinders I. (39°26.18'S, 147°48.42'E),

49 m, 17/11/1981, (BSS 173), R.S. Wilson; 3 individuals (NMV

J55793), central Bass Strait, 35 km NE of Cape Wickham, (39°16.00’S,

144°05.24’E), 82 m, 23/11/1981, R.S. Wilson; 3 individuals (NMV

J55794), central Bass Strait, 47 km E of Cape Rochon, Three Hummock

I. (40°23.48'S, 145°32.00'E), 66 m, 03/11/1980, (BSS 113), M.F.

Gomon and G.C.B. Poore; 2 mancas, (NMV J55795), central Bass

Strait, 47 km E of Cape Rochon, Three Hummock I. (40°23.48’S,

145°32.00'E), 66 m, 03/11/1980, (BSS 113), M.F. Gomon and G.C.B.

Poore; 6 individuals (2 mancas), (NMV J55796), eastern Bass Strait, 28

km SSW of Mario (37°59'S, 148°27'E), 51 m, 30/07/1983, (BSS 207),

M.F. Gomon and R.S. Wilson; 1 hermaphroditic, (NMV J55797),

Apseudomorpha of eastern Australia

121

central Bass Strait, 38 km SW of Cape Paterson (38°55.30'S,

145°17.00'E), 70 m, 12/11/1981, (BSS 155), R.S. Wilson; 1 individual,

(NMV J55801), central Bass Strait, 38 km SW of Cape Paterson

(38°55.30'S, 145°17.00'E), 70 m, 12/11/1981, (BSS 155), R.S. Wilson; 1

ovi female (with well developed genital cone), (NMV J55798), central

Bass Strait, 44 km NE of Cape Wickham, King I. (39°22.00'S,

144°18.18'E), 60 m, 23/11/1981, (BSS 203), R.S. Wilson; 1 male (NMV

J55799), Tasmania, eastern Bass Strait, 30 km N of North Point

(39°26.18'S, 147°48.42'E), 49 m, 17/11/1981, (BSS 173), R.S. Wilson; 6

individuals (4 females ovi), (NMV J55800), central Bass Strait,

44 km NE of Cape Wickham, King I. (39°22.00'S, 144°18.18'E), 60 m,

23/11/1981, (BSS 203), R.S. Wilson.

Description of female. Body dorsoventrally flattened, elongate,

holotype 10.1 mm long (tip of rostrum to posterior of pleotelson),

6.5 times as long as wide, narrower posteriorly. Cephalothorax

subrectangular, almost subcircular, as long as wide, anterior

margin with triangular, blunt rostrum with notches just anterior

to ocular lobes. Eyes present; eyelobes rounded; no lateral

spiniform apophyses at anterior margin of branchial chambers. 6

free pereonites, all without lateral spiniform apophyses;

pereonite 1 shortest, 0.4 times length of cephalothorax, pereonite

2 half as long as cephalothorax, both with lateral margins

uniformly convex, pereonite 2 with slightly angular anterolateral

comers; pereonites 3 to 6 subequal in length (5th longest), 1.7

times as long as pereonite 1, indented behind anterolateral

rounded shoulders and mostly expanded posterolaterally at

attachment of coxae; all pereonites respectively 2.7, 1.8, 1.5,

1.5, 1.2 and 1.3 times as wide as long; ventral hyposphenium on

pereonite 6. Pleon 2.4 times as long as pereonite 6, of 5 free

subequal pleonites bearing pleopods; pleonites dorsally convex,

2.5 times as wide as long, laterally expanded by spiniform

apophyses. Pleotelson rectangular, 0.4 times length of whole

pleon, 1.6 times as long as wide, with numerous lateral setae.

Antennule peduncle 4-articled, article 1 2.7 times as long

as wide, with denticulations along proximal half of inner

margin, setose as figured; article 2 0.3 times as long as article

1, with inner and outer distal tufts of long setae; article 3 0.4

times as long as article 2, article 4 one-third as long as 3rd,

naked. Main flagellum of 15 segments, segments 13 and 15

bearing aesthetascs; accessory flagellum of 5 segments.

Antenna peduncle article 1 with inner denticulate

apophysis; article 2 bearing inner denticulations and elongate

squama with 13 marginal setae; peduncle article 3 as long as

wide, with 1 seta; article 4 slightly longer than article 5, both

with penicillate setae. Flagellum of 1 1 segments, most proximal

segments with long outer setae.

Mouth parts. Labrum not seen. Left mandible outer margin

finely setose, bearing strongly denticulated pars incisiva and

lacinia mobilis, setiferous lobe with 4 trifurcate setae; pars

molaris robust, distally spinose. Right mandible as left but

without lacinia mobilis; mandibular palp of 3 articles, article 1

longer than wide with 6 long setae along inner margin, article 2

nearly 3 times as long as article 1 with 2 rows of longer and

shorter simple setae in distal half; article 3 half length of article

2 with numerous inner simple setae increasing in length towards

tip of article, longer distal seta as long as article. Maxillule

inner endite with finely setose outer and inner margins, rounded

outer apophysis and 5 finely setulate distal setae; outer endite

with 11 distal spines and 2 subdistal setae, margins finely setose;

palp of 2 stout articles, distally with 5 setae. Maxilla with

smooth outer margin; outer lobe of outer endite with 2 setae on

outer margin setulose at mid-length; other setae of outer endite

simple; outer lobe of inner endite with simple setae, stout

bifurcate and trifurcate spines and plumose inner and subdistal

setae; inner lobe of fixed endite with rostral row of numerous

setae guarding 5 longer setae. Labium not seen. Maxilliped

basis with inner distal seta and stout spine; palp article 1 with

seta on outer margin and inner distal seta and stout spine; palp

article 2 longer than wide, with rows of numerous short setae

and few proximal longer filtering setae on inner margin, outer

margin with slender distal spine; palp article 3 longer than wide,

with rows of filtering setae along inner margin; palp article 4

longer than wide, with 9 distal and 1 subdistal setae. Endite

with flagelliform inner caudodistal seta and stout, spatulate,

inner distal spines, slender compound outer spines and outer

simple setae; 5 coupling hooks. Epignath large, cup-shaped,

distal spine distally setulose.

Cheliped not slender. Basis 3.6 times as long as wide,

dorsally with 3 plumose setae, ventrally with 3 proximal seta,

midventral spine and tuft of 3 distal setae; exopodite present,

3 -articled, article 2 naked, distal article with 5 plumose setae.

Merus elongate, with 3 midventral and 4 subdistal setae.

Carpus 4.2 times as long as wide, with 4 longer simple setae

along ventral margin, sparse shorter setae along dorsal margin.

Chela fingers shorter than palm, palm wider than long, ventral

margin of fixed finger with dense row of setae; 4 setae near

articulation of fixed finger and 2 at axis of gape; cutting edge

of fixed finger with row of fine setules interspersing flat,

rounded “teeth”, but no apophyses, distal claw pointed;

dactylus with 3 subdistal setae but no apophyses on cutting

edge, distal claw pointed.

Pereopod 1 with pronounced, setose, spiniform apophysis

on coxa. Basis stout, twice as long as wide, with dorsoproximal

seta, ventrodistal setae and small ventrodistal spine; exopodite

present, 3 -articled, article 2 naked, article 3 with 5 distal

plumose setae. Ischium with 2 simple ventrodistal setae. Merus

0.8 times as long as basis, with midventral group of 4 setae,

and 4 dorsodistal simple setae surrounding slender spine,

shorter, stouter ventrodistal spine. Carpus less than half as

long as merus, as long as wide, with 2 ventral and 1 dorsodistal

stout spines. Propodus longer than merus, with 3 ventral and 2

dorsal stout marginal spines interspersed with simple setae.

Dactylus stout, with mid-dorsal fine seta, unguis short, both

together 0.7 times as long as propodus.

Pereopod 2 more slender. Coxa without spiniform

apophysis. Basis 3.5 times as long as wide with tuft of

ventrodistal setae, plumose midventral setae and mid-dorsal

penicillate seta. Merus 0.9 times as long as carpus, with groups

of midventral, ventrodistal and dorsodistal setae and slender

ventrodistal spine, inner distal seta as long as carpus; carpus

with similar setation and spination. Propodus just longer than

carpus, dorsally and ventrally setose, with 2 ventral, 2 inner

and 1 dorsodistal spines. Dactylus slender with 2 dorsal setae,

unguis slender, the 2 together just shorter than propodus.

Pereopod 3 similar to pereopod 2, but basis with long inner

setae, carpus with inner distal spines.

122

Magdalena Bfazewicz-Paszkowycz and Roger N. Bamber

Figure 10. Spinosapseudes colobos sp. nov., holotype female, dorsal. Scale line = 1mm.

Apseudomorpha of eastern Australia

123

Figure 11. Spinosapseudes colobos sp. nov.. A, antennule; B, antenna; C, right mandible; D, left mandible; E, maxillule; F, maxilla; G, labium;

H, maxilliped; FF, maxilliped endite. Scale line = 0.1mm.

124

Magdalena Blazewicz-Paszkowycz and Roger N. Bamber

Figure 12. Spinosapseud.es colobos sp. nov.. A, cheliped; B-G, pereopods 1-6 respectively; H, pleopod; I, uropod. Scale line = 0.1mm.

Apseudomorpha of eastern Australia

125

Figure 13. Spinosapseudes colobos sp. nov., male cheliped. Scale line = 0.1mm.

Pereopod 4 basis stouter, 3 times as long as wide, with 2

plumose setae and dorsal and ventral penicillate setae; merus

two-thirds as long as carpus with paired ventrodistal spines

and longer dorsodistal spine; carpus dorsally naked, with

paired ventral spines and ventrodistal spines amongst slender

setae; propodus with dorsoproximal penicillate seta, 2 ventral

spines amongst row of fine marginal setae, dorsodistal tuft of

numerous short and 5 long fine setae; dactylus plus unguis

shorter than propodus.

Pereopod 5 similar to pereopod 4, but basis with

ventroproximal spine, simple dorsal setae; merus with slender

dorsodistal and shorter, paired ventrodistal spines; propodus

with ventral row of fine denticulations in proximal half.

Pereopod 6 basis with dorsal and ventral plumose marginal

setae, merus without spines, propodus with 24 ventral leaf-like

propodal spines extending to distal margin of article.

Pleopods all alike. Basis elongate, with 2 dorsal and 2

ventral plumose setae. Endopod slightly longer than exopod;

both rami slender, with plumose marginal setae, largely

confined to distal half on exopod.

Uropod biramous, both rami filiform, multi-segmented.

Basis with long setae distally on inner and outer margins;

exopod less than one-quarter as long as endopod, with 13

segments; endopod elongate, 5.5 times as long as pleotelson,

with more than 40 segments.

Male unknown.

Etymology. Named for Gary Poore of Museum Victoria, who

collected much of the material analysed herein, in gratitude for

his assistance in making all the tanaidacean material held at

Melbourne available for study.

Remarks. In many ways, Apseudes poorei sp. nov. is close to

the previous species, A. tuski, with a generally similar body,

mouthpart and pereopod morphology (although differing in

detail); conversely, it too has inner distal spines on the

maxilliped basis and proximal palp article, as found in Annexos

abditospina, also described above (although there are few other

similarities between that and the present species). Along with

A. bucospinosus, there seems to be a common theme of

maxilliped spination amongst the eastern Australian species of

Apseudinae. Other distinctions of A. poorei from A. tuski

include the presence of a dorsodistal spine on the merus of

pereopod 1, the extreme length of that merus, the proportionately

longer pleotelson, 1 fewer ventral propodal spine on pereopod

1, longer flagella on the antennule and antenna, the inner

apophysis on the proximal antennal peduncle article, a longer

uropod endopod, and the presence of plumose setae on the

bases of pereopods 2 and 4; all but the 1st of these also

distinguish Apseudes poorei from the otherwise similar

A. erythraeicus (see discussion under A. tuski).

126

Magdalena Blazewicz-Paszkowycz and Roger N. Bamber

Genus Spinosapseudes Gufu, 1996

Spinosapseudes colobos sp. nov.

Figures 10-13

Material. Female, holotype (NMV J55746), Australia, Victoria, central

Bass Strait, 66 km S of Rodondo I. (39°49.30'S, 146°18.30'E), 82 m,

13/11/1981 (BSS 158 G), R.S. Wilson. Paratypes: 1 male, allotype

(NMV J55745), same locality as holotype; 10 females without oostegites,

5 males (NMV J47125), 1 female dissected, (J55944), same locality as

holotype; 1 female (NMV J55767), Victoria, central Bass Strait, 26 km

SE of Aireys Inlet (38°39.48'S, 144°18.12'E), 79 m, 19/11/1981, R.S.

Wilson; 5 females, 7 males, 17 juveniles (NMV J55768), central Bass

Strait, 100 km SSE of Cape Liptrap, Victoria (39°45.54'S, 145°33.18'E),

74 m, 13/11/1981, R.S. Wilson; 3 females, 5 males, 2 mancas (NVM

J55769), central Bass Strait, 100 km SSE of Cape Liptrap, Victoria

(39°45.54'S, 145°33.18'E), 74 m, 13/11/1981, R.S. Wilson; 1 female

(NMV J55770), central Bass Strait, 65 km ENE of Cape Rochon,

Three Hummock I. (40°10.54' S, 145°44.18' E), 75m, 13/11/1981, (BSS

157), R.S. Wilson; 1 male (NMV J55771), Victoria, central Bass Strait,

26 km SE of Aireys Inlet (38°39.48'S, 144°18.12'E), 79 m, 19/11/1981,

R.S. Wilson; 4 female, 4 males (NMV J55772), Tasmania, central

Bass Strait, 47 km E of Cape Rochon, Three Hummock I. (40°23.48’S,

145°32.00'E), 66 m, 03/11/1980, (BSS 113), M.F. Gomon and G.C.B.

Poore; 1 juvenile (NMV J55773) Tasmania, central Bass Strait, 47 km

E of Cape Rochon, Three Hummock I. (40°23.48’S, 145°32.00’E), 66

m, 03/11/1980, (BSS 113), M.F. Gomon and G.C.B. Poore, 4 females,

5 males, 8 mancas (NMV J55775), eastern Bass Strait, 63 km E of

North Point, Flinders I. (39°44.48'S, 148°40.36'E), 124 m, 14/11/1981,

(BSS 167), R.S. Wilson; 1 male (NMV J55774) eastern Bass Strait, 20

km SSW of Babel I. (40°06.48'S, 148°24.18'E), 22 m, 14/11/1981, (BSS

166), R.S. Wilson.

Description of female. Body dorsoventrally flattened, elongate,

holotype 9.5 mm long (tip of rostrum to posterior of pleotelson),

6.7 times as long as wide, narrower posteriorly. Cephalothorax

subrectangular, 1.2 times as long as wide, anterior margin with

conspicuous pointed rostrum with rounded “shoulders” at base.

Eyes present; eyelobes modified to prominent spine-like

apophyses directed anterolaterally ; conspicuous lateral spiniform

apophyses at anterior margin of branchial chambers. 6 free

pereonites; pereonites 1 and 2 subequal, about 0.4 times as long

as cephalothorax, lateral margins uniformly convex; pereonite 3

as long as pereonite 2, with anterolateral spine-like apophyses

and expanded posterolaterally at attachment of coxae; pereonites

4, 5 and 6 subequal (4 longest), 1.2 times as long as pereonite 2,

with anterolateral spine-like apophyses and expanded

posterolaterally at attachment of coxae (all pereonites

respectively 2.3, 2.0, 1.6, 1.3, 1.25 and 1.25 times as wide as

long); ventral hyposphenia present on all pereonites. Pleon 3.6

times as long as pereonite 6, of 5 free subequal pleonites bearing

pleopods plus pleotelson; pleonites 2.54 times as wide as long,

laterally expanded by spiniform apophyses. Pleotelson long and

slender, almost half length of whole pleon, 2.8 times as long as

wide, lateral margins undulating, with paired distal setae.

Antennule peduncle article 1 elongate, 3.7 times as long as

wide, setose as figured, inner margin finely corrugated; article

2 0.3 times as long as article 1, with 2 groups of inner marginal

setae and tuft of outer distal setae, longest of these longer than

article; article 3 half length of article 2, with long outer seta;

article 4 half as long as article 3, with inner distal seta. Main

flagellum of 15 segments, segments 10, 12 and 13 bearing

aesthetascs; accessory flagellum of 6 segments.

Antenna peduncle article 1 simple; article 2 twice as long

as wide, with proximal inner and outer marginal denticulations

and 2 outer setae, and bearing elongate squama with 16

marginal setae; peduncle article 3 as long as wide, with 1 seta;

article 4 slightly longer than article 5, and 3 times as long as

article 3, with inner penicillate seta; article 5 with outer

penicillate seta and simple and penicillate setae at inner distal

corner. Flagellum of 11 segments.

Mouth parts. Labrum rounded, simple setose. Right

mandible with outer margin finely denticulate, bearing strong,

crenulated pars incisiva, setiferous lobe with 7 distally

compound setae and 1 simple seta, pars molaris robust, blunt,

distally with marginal spinules; mandibular palp of 3 articles,

article 1 just longer than wide with row of 5 inner setae; article

2 5 times as long as wide with 2 parallel rows of inner simple

setae in distal 3rd and row of 4 mesial setae in distal half;

article 3 about two-thirds as long as article 2 with row of inner

simple setae increasing in length towards distal end of article,

3 distal mesial setae, and 3 longer distal setae. Left mandible

as right but with crenulate lacinia mobilis. Maxillule inner

endite marginally setose with outer blunt apophysis, distally

with 5 plumose spines; outer endite with 1 shorter (“dwarfed”

sensu Lang, 1968) and 12 longer stout and blunt distal spines

and 2 subdistal setae, outer and inner margins finely setose;

palp of 2 articles, distally with 7 setae. Maxilla with microtrichia

on outer margin; outer lobe of outer endite with 2 setae with

mid-length setulation on outer margin, distally with 9 similar

setae; inner lobe of outer endite with curved simple setae; outer

lobe of inner endite with setulose spines distally and subdistally ;

inner lobe of fixed endite with rostral row of numerous setae

guarding 10 longer setae with mid-length setulation, innermost

seta finely bilaterally denticulate. Labium with setulose distal

margin, palp with conspicuous lateral setules and 3 fine distal

setae. Maxilliped basis irregularly serrated on outer distal

margin and with 2 inner distal plumose setae; palp article 1

with 2 outer distal setae and 2 plumose inner setae; palp article

2 longer than wide, with rows of numerous shorter simple and

longer plumose setae on inner margin, outer margin with

simple strong distal seta; palp article 3 longer than wide, with

numerous simple setae along expanded inner margin; palp

article 4 with 13 distal setae. Endite with 4 coupling-hooks,

simple outer distal setae, simple whip-like inner caudodistal

seta and stout, spatulate, distal spines (“chitinous formations”

sensu Lang, 1968). Epignath not seen.

Cheliped relatively slender. Basis 1.75 times as long as

wide, dorsally with spine-like apophysis in distal half, ventrally

with proximal setae, midventral spine and tuft of 5 distal setae;

exopodite present, 3 -articled, distal article with 6 setae. Merus

elongate, with paired dorsal and 3 mid-ventral setae, ventrodistal

spine-like apophysis amongst tuft of setae. Carpus more than 3

times as long as wide, with row of setae along ventral margin

mostly longer than carpal width, 1 proximal and 2 distal simple

setae on dorsal margin. Chela fingers about as long as palm,

ventral margin with 10 setae, 7 distal setae around claw of fixed

finger; 3 setae near articulation of fixed finger; dactylus slender,

as long as fixed finger, distal claw pointed.

Apseudomorpha of eastern Australia

127

Pereopod-1 with pronounced spine-like apophysis on coxa.

Basis stout, 2.8 times as long as wide, with ventral setae in

proximal half, tuft of ventrodistal setae and short spine;

exopodite present, 3 -articled, article 3 with 5 distal setae.

Ischium with 5 simple ventrodistal setae. Merus two-thirds as

long as basis, with rows of 7 ventral setae and 4 fine outer

mesial setae, 4 dorsodistal simple setae, ventrodistal spine.

Carpus shorter than merus, with dorsodistal spine adjacent to

group of long simple setae, and ventrally with 2 spines in distal

0.5 interspersed with simple setae. Propodus half as long as

carpus plus merus, with 2 dorsal spines, longer dorsal setae, 4

ventral spines. Dactylus slender, about 0.7 length of propodus,

with ventral denticulations; unguis short.

Pereopod 2 more slender, basis 3.9 times as long as wide.

Merus 0.9 times as long as carpus, with elongate setae along

ventral margin, but restricted to distal corner dorsally. Carpus

elongate, with rows of ventral and dorsal setae. Propodus just

shorter than carpus, similarly setose but with 1 submarginal

dorsal and ventrodistal spine. Dactylus slender with fine

subdistal seta, with unguis and dactylus as long as propodus.

Pereopod 3 similar to pereopod 2, but basis with longer

marginal setae, carpus and propodus with mesial spines.

Pereopod 4 coxa with spine -like apophyses, basis 3.6 times

as long as wide, with penicillate setae, merus with sinuous

dorsal margin and 2 ventral spines amongst longer setae, carpus

1.7 times as long as merus with ventral and distal spines and

setae, distal setae more than half as long as propodus; propodus

shorter than carpus, with proximo-dorsal penicillate seta,

subdistal and distal rows of short setae, 4 longer distal setae

exceeding unguis; dactylus plus unguis shorter than propodus.

Pereopod 5 similar to pereopod 4, coxa with apophyses,

distal short setae forming a crown around tip of propodus.

Pereopod 6 similar to pereopod 5, but basis with rows of

marginal setae, ventrally simple but dorsally plumose; merus

with single plumose dorsal seta; carpus with simple dorsal

marginal setae; propodus with ventroproximal and mesial

short spines, row of fine leaf-like spines around dorsal margin

and along distal two-thirds of ventral margin.

Pleopods all alike. Basis with 4 inner (ventral) plumose

setae. Endopod longer than exopod without proximal

articulation; both rami slender, with numerous marginal

plumose setae. Inner proximal seta on endopod more robust.

Uropod biramous, both rami filiform, multi-segmented. Basis

with row of outer setae; exopod one-fifth as long as endopod,

with 7 segments; endopod elongate, with about 40 segments.

Male. Slightly larger than female (dissected specimen

10.3 mm long); sexual dimorphism shown by an increased

number of aesthetascs on the antennule, and large ventral penial

tubercle on pereonite 6. Cheliped more robust, basis 1.5 times as

long as wide; carpus subtriangular, only slightly longer than

wide; propodus stout, longer than carpus plus merus, fixed finger

with conspicuous proximal tooth-like apophysis on cutting edge;

dactylus with smaller proximal apophysis on cutting edge.

Etymology. From the Greek kolobos - shortened, with reference

to the articles of the antennular and antennal peduncles and

mandibular palp, and the pereopod bases, being conspicuously

shorter than those of the generotype S. setosus (Lang, 1968).

Remarks. Of the numerous species attributed to the genus

Apseudes sensu lato (including Spinosapseudes Gufu, 1996

and Tuberapseudes Bacescu and Gufu, 1971), only 13 have a

conspicuous spine -like apophysis anterior to the branchial

chamber, and, apart from A. bruneinigma Bamber, 1999, all

have a telson at least twice as long as wide and anterolateral

spine-like apophyses on pereonites from 3 to 6. Only 5 of these,

A. abyssalis Bfazewicz-Paszkowycz and Larsen, 2004, A.

rotundifrons Bacescu, 1981, A. tenuimanus Sars 1882, A.

( Tuberapseudes ) echinata Sars 1882, and A. setosus Lang, 1968,

have no dorsodistal spine on the merus of pereopod 1, and of

these only A. setosus has the combination of a strongly pointed

rostrum, more than 5 segments in the antennule accessory

flagellum, and ventral but no dorsal setae on the pleopod basis.

Gufu (1996) erected the genus Spinosapseudes for A.

setosus Lang, 1968 (until now monotypic), named after the

large spine -like apophyses on the cephalon and pereonites,

and on the coxae of the posterior pereopods, and distinguished

by the morphology of pereopod 1 being more similar to that of

Carpoapseudes species, rather than the fossorial (i.e.

apparently adapted for digging) appearance of this pereopod

in Apseudes sensu stricto (as in the type species A. talpa

Montagu, 1808).

While the present species shows a more fossorial

morphology to its pereopod 1, it has numerous features in

common with Spinosapseudes setosus, notably the coxa 1

apophyses of the posterior pereopods, but also the plumose

dorsal setae on pereopod 6, the spine-like apophyses of

pereonites 3 to 6 and of the cheliped merus, the chaetotaxy of

the mouthparts and pleopods, and the number of segments in

antennular and antennal flagella and uropod exopod.

Spinosapseudes colobos sp. nov. is accordingly placed in the

same genus, but, in addition to the pereopod 1 morphology, is

clearly distinguished from S. setosus by the proportionately

more compact articles of the antennular and antennal peduncles,

the mandibular palp and the pereopods. Both species are only

known from the Tasman Sea - Bass Strait region.

Genus Gollumudes Bamber, 2000

Gollumudes larakia (Edgar, 1997)

Apseudes larakia Edgar, 1997, 279-286, figs 1-3.

Gollumudes larakia. Gutu, 2006: 97-99.

Material. 4 individuals (J47131), Australia, Tasmania, eastern Bass

Strait, 37 km NNE of Eddystone Point (40°43.48'S, 148°37.12'E), 67

m, 14/11/1981, (BSS 164), R.S. Wilson; 1 individual (J53143), 50 m

south of Twin Reefs, Venus Bay (38°41'S, 145°39'E), 9 m, 07/03/1982,

(CPA 7), M. McDonald; 1 individual (NVM J55756), western Bass

Strait, 30 km SSW of Warrnambool (38°38.12'S, 142 35.00'E), 59 m,

20/11/1981, (BSS 188), R.S. Wilson; 3 individuals (NVM J55757),

western Bass Strait, 15 km S of Port Fairy (38°32.00’S, 142 28.36'E),

52 m, 20/11/1981, (BSS 187), R.S. Wilson; 1 individual (NVM J55760),

western Bass Strait, 15 km S of Port Fairy (38°32.00’S, 142 28.36’E),

52 m, 20/11/1981, (BSS 187), R.S. Wilson; 2 individuals (NVM

J55764), western Bass Strait, King I., 59 km W of Stokes Point

(40°07’S, 143°14’E), 185 m, 11/10/1980, (BSS 104), G.C.B. Poore; 2

individual (NVM J55766), Victoria, western Bass Strait, 5 km S of

Point Reginald (38°48.00'S, 143°14.30'E), 47 m, 20/11/1981, (BSS

128

Magdalena Bfazewicz-Paszkowycz and Roger N. Bamber

Figure 14. Pugiodactylus syntomos sp.nov., holotype female, dorsal. Scale line = 1 mm.

Apseudomorpha of eastern Australia

129

Figure 15. Pugiodactylus syntomos sp. nov.. A, antennule; B, antenna; C, mandible; D, maxilla; E, maxilliped; E', maxilliped endite; F, epignath;

G, cheliped. Scale line = 0.1 mm.

130

Magdalena Blazewicz-Paszkowycz and Roger N. Bamber

Figure 16. Pugiodactylus syntomos sp.nov.. A, cheliped; B to E, pereopods 1 to 4 respectively; F, pereopod-6; G, pereopod-5; H, pleopod; I, uropod.

Scale line = 0.1 mm.

Apseudomorpha of eastern Australia

131

185), R.S. Wilson; 1 individual (NVM J55758), western Bass Strait, 5

km SW of Bluff Point (40°48.06'S, 144°38.00’E), 42 m, 02/02/1981,

(BSS 126 G), M.F. Gomon; 1 individual (NVM J55759), 50 m E of

Petrel Rock, Venus Bay (38°39'S, 145°42'E), 8 m, 05/03/1982, (CPA 1)

M. McDonald and M.F. Gomon; 5 individuals (NVM J55761), 1 km E

of Harmers Haven, 500 m offshore (38°34'S, 145°40'E), 11 m,

06/03/1982, (CPA 14), C. Larsen and G. Barber, 1 individual (NVM

J55762), 1 km E of Harmers Haven, 300 m offshore (38°34'S, 145°40'E),

6 m, 06/03/1982 (CPA 15), R.S. Wilson and C. Larsen; 1 individual

(NVM J55763), Cape Paterson E side (38°41'S, 145°36'E), 6 m,

05/03/1982, (CPA 12), R.S. Wilson, G. Barber, et al.; 1 individual

(NVM J55765) Bennison Channel 1.0 km S of Granite I. (38°49'S,

146°23'E), 6.0 m, 23/11/1983, (CIN 28), G.J. Morgan.

Remarks. Gu(u (2001) corrected the description of this species,

pointing out that, contrary to that description, both cheliped and

pereopod 1 have an exopodite. Edgar (1997) recorded large

numbers of this species in shallow water (1-8 m depth) around

Darwin, Northern Territory, in association with algae and coral

rubble. Gu(u (2006) and Bamber (in press) recorded specimens

from Moreton Bay, Queensland, also in shallow water. The

present material extends the range of this species further south

to Bass Strait, and to substantially greater depth.

Subfamily Pugiodactylinae G 11(11 1995

Genus Pugiodactylus Gu(u 1995

Pugiodactylus syntomos sp. nov.

Figures 14-16

Material. Female, holotype (NVM J55749), Australia, Tasmania, western

Bass Strait, 59 km W of Stokes Point, King I. (40°07'S, 143°14'E), 185

m, 11/10/1980, (BSS 104 G), G.C.B. Poore. Paratypes: 2 females, 1

male (NVM J47118), same locality as holotype; 1 specimen dissected on

slides (NVM J55941), western Bass Strait, King I., 59 km W of Stokes

Point (40°07'S, 143°14'E), 185 m, 11/10/1980 (BSS 104), G.C.B. Poore;

4 individuals (NMV J55786), eastern Bass Strait, 70 km ENE of North

Point, Flinders I. (39°28.24'S, 148°41.48'E), 110 m, 28/03/1979, (BSS

35), G.C.B. Poore; 1 female with rudimental oostegites, 3 males, 2

juveniles, 1 manca, (NMV J55787), eastern Bass Strait, 85 km NE of

North Point, Hinders I. (39°02.24'S, 148°30.36'E), 120 m, 15/11/1981,

(BSS 169), R.S. Wilson; 1 ovi female, 1 male, (NMV J55788), Victoria,

western Bass Strait, 5 km S of Point Reginald, Victoria (38°48’S,

143°14.30’E), 47 m, 20/11/1981, (BSS 185), R.S. Wilson; 1 ovi females,

1 male (NMV J55789), 50 m S of Twin Reefs, Venus Bay (38°41'S,

145°39'E), 9 m, 07/03/1982, (CPA 7), M. McDonald.

Description of female. Body (fig. 14), dorsoventrally flattened,

elongate, holotype 2.6 mm long (tip of rostrum to posterior of

pleotelson), 5.6 times as long as wide, narrower posteriorly.

Cephalothorax subcircular, slightly longer than wide, naked,

anterior margin with conspicuous triangular pointed rostrum.

Eyes and eyelobes present. 6 free pereonites; pereonite 1 shortest,

0.3 times as long as cephalothorax, lateral margins straight, coxal

apophyses of pereopod 1 evident; pereonite 2 1.25 times as long

as pereonite 1 with rounded anterolateral tubercle on each side;

pereonite 3 with anterolateral spine-like apophyses, 1.5 times as

long as pereonite 1; pereonite 4 slightly longer than pereonite 3,

subrectangular; pereonite 5 longest, twice as long as pereonite 1 ;

pereonite 6 simple, narrowest, just longer than pereonite 1 (all

pereonites respectively 2.7, 2.1, 1.5, 1.2, 1.0 and 1.6 times as

wide as long). Pleon 2.5 times as long as pereonite 6, of 5 free

subequal pleonites bearing pleopods plus pleotelson; pleonites

more than 4 times as wide as long, laterally expanded by spiniform

apophyses. Pleotelson pentagonal, half length of whole pleon,

1.2 times as long as wide.

Antennule slender, peduncle article 1 elongate, 4 times as

long as wide, with 2 longer dorsal simple setae, 2 shorter inner

simple setae, and 3 subdistal outer penicillate setae; article 2 0.35

times as long as article 1, distally with 3 simple setae at least as

long as article and 2 outer penicillate setae; article 3 less than half

length of article 2 with inner distal seta; article 4 two-thirds as

long as article 3, naked. Main flagellum of 5 segments, segment

2 with 1 aesthetasc; accessory flagellum of 3 segments.

Antenna proximal article-4 naked; article 2 with simple

inner seta and bearing elongate squama with 5 marginal setae;

peduncle article 3 shorter than wide, with 1 inner seta; article

4 slightly longer than article 5, and 3 times as long as article 3;

article 5 with paired elongate inner distal simple setae, and

outer and inner distal pairs of penicillate setae. Flagellum of

5 segments.

Mouth parts. Labrum not seen. Mandible with strong,

crenulated pars incisiva, small lacinia mobilis, setiferous lobe

with 5 mainly bifurcate setae, pars molaris stout with denticulate

distal margin; mandibular palp of 3 articles, article 1 3 times as

long as wide with 6 ventral setae, distal 4 setae longer than

article; article 2 slender, 1.3 times as long as article 1, with 2

parallel rows of 5 longer and 9 shorter simple setae in distal half;

article 3 0.6 times as long as of article 2 with 9 inner simple setae

increasing in length distally, 2 longer distal setae as long as

article. Maxillule (not figured) outer endite with setose margins

and 10 distal spines, inner endite with outer apophysis and 4

plumose distal spines. Maxilla with fine setae on outer margin;

outer lobe of moveable endite with 2 simple setae on outer

margin and 6 simple distal setae; inner lobe of movable endite

with simple distal setae; outer lobe of fixed endite with 3 simple

setae, 5 blunt spines (inner 3 bifurcate) and 2 subdistal finely

denticulate spines; inner lobe of fixed endite with rostral row of

22 setae guarding 5 longer plumose setae. Labium not seen.

Maxilliped basis naked; palp article 1 with single inner distal

seta as long as article 2, and outer blunt, triangular apophysis;

palp article 2 longer than wide, with 2 rows of numerous filtering

setae on inner margin, 1 outer distal seta longer than article 3;

palp article 3 nearly twice as long as wide, with 7 inner simple

setae; palp article 4 with 9 inner and distal setae. Endite with

simple distal setae, slender outer bifurcate spines and stout,

spatulate, inner spines; 4 coupling hooks. Epignath large, cup-

shaped, with distally setulose distal seta.

Cheliped basis twice as long as wide, dorsally naked,

ventrally with midventral apophysis and 1 longer and 1 shorter

distal setae; exopodite present, 3 articled, distal article with 4

to 6 marginal setae. Merus elongate, with single proximal and

2 distal ventral setae. Carpus 2.5 times as long as wide, with 2

shorter proximal and 3 longer distal simple setae along ventral

margin. Chela as long as carpus; propodus wide, with 2 dorsal

setae, 3 longer distal setae at insertion of dactylus, fixed finger

with 3 ventral setae, 2 subdistal setae and row of 6 slender

setae along cutting edge, cutting edge crenulated and armed

132

Magdalena Blazewicz-Paszkowycz and Roger N. Bamber

with fine spinules and small, proximal tooth-like apophysis

(stronger in male); dactylus longer than fixed finger, with fine

setae but no apophyses on cutting edge, distal claw pointed.

Pereopod-1 with pronounced spine -like apophysis on coxa.

Basis 4.2 times as long as wide, with 3 proximal penicillate setae

on dorsal margin, ventrally subdistal and distal simple setae;

exopodite present, 3 -articled, article 3 with 5 distal setae. Ischium

with 2 simple ventrodistal setae. Merus 0.3 times as long as basis,

wider distally, with ventrodistal spine, 4 ventral setae and 1

dorsodistal simple seta. Carpus stout, nearly twice as long as

mems, with 4 ventral marginal spines interspersed with simple

setae, dorsally with single central and paired distal simple setae.

Propodus as long as merus, ventral margin with 4 spines

interspersed with simple setae, single dorsodistal spine and seta.

Dactylus and unguis fused, naked, 1.4 times as long as propodus.

Pereopod-2 more slender. Basis 4.7 times as long as wide;

ischium slightly longer than wide, with single dorsal and

ventral setae. Merus 0.6 times as long as carpus, with 4 ventral

setae and single dorsodistal seta. Carpus with 3 ventral spines

in distal 0.5 interspersed with simple setae, dorsal setae as

pereopod 1. Propodus as long as carpus, with 5 slender ventral

spines, 3 dorsodistal setae and distal pectinate spine. Dactylus

with fine distal seta, unguis slender, shorter than dactylus, the

2 together 0.7 times as long as propodus.

Pereopod 3 similar to pereopod 2.

Pereopod 4 similar to pereopod 2 but basis with midventral

penicillate seta, merus proximally naked, merus half length of

carpus, carpus with 8 slender ventral spines in 2 rows; propodus

with dorsodistal tuft of 5 finely denticulate setae.

Pereopod 5 similar to pereopod 2 but carpus without spines.

Pereopod 6 similar to pereopod 5, but basis with

dorsoproximal group of 5 penicillate setae, propodus with row

of 8 ventral leaf-like spines in distal half.

Pleopods 5 pairs, all alike, but progressively smaller

towards the posterior; basis attenuated, naked; slender rami

each with 2 plumose distal setae, outer ramus longer and with

additional single dorsal plumose seta.

Uropod biramous, both rami filiform, multi-segmented. Basis

with 1 inner distal seta; exopod 0.3 times as long as endopod,

with 4 segments; endopod elongate, with 15 segments.

Male. Essentially as female, small penial tubercle ventrally

on pereonite 6; dimorphism of the cheliped, male cheliped being

slightly more robust, with larger tooth proximal of midpoint of

cutting edge of fixed finger, dactylar setal row of 9 setae.

Etymology. From the Greek - syntomos - meaning shortened,

as, compared with other species in the genus, are the cheliped

carpus, pereopod 1 merus and carpus, the antenna and the

rostrum of the present species.

Remarks. There are 4 previously described species of

Pugiodactylus, all from the general region of Australasia, P.

antarcticus (Beddard, 1886) from the Antarctic at 8-232 m depth,

P. agartthus Gufu and Iliffe, 1997 from Niue I., South Pacific in

2 m, P. coralensis Gufu, 1998, from Malaysia (1-3 m depth), and

P. daicovicii Gufu, 2006, from Moreton Bay, Australia (depth not

given, probably between 5 and 15 m). Unlike the present species,

all the others have a conspicuous slender pointed tip to the rostmm

and slender articles and squama on the antenna. Only P. agartthus

has as few segments in the uropod exopod as P. syntomos sp. nov.,

but that species has far more segments in the antennular flagella.

Overall, and perhaps not surprisingly, P. syntomos is most

similar to the other eastern Australian species, P. daicovicii (of

which no description is given for the mouthparts, unfortunately),

but a clear distinction, other than the robustness of the merus and

carpus of pereopod 1 in the present species (merus as long as its

distal width, compared with twice as long in P. daicovicii, vide

Gufu, 2006), is that P. daicovicii has no pleopods. The stout

chela of P. syntomos is typical of the genus, but the cheliped

carpus of this species is far shorter than those of the other

species, none of which have the elongate outer distal seta on

article 2 of the maxilliped palp (not known for P. daicovicii ).

Family Whiteleggiidae Gufu 1972

Genus Whiteleggia Fang 1970

Whiteleggia multicarinata (Whitelegge, 1901)

Apseudes multicarinata. Whitelegge, 1901: 203, 204-208

Whiteleggia multicarinata. Lang, 1970, 605-615, figs 3-8.

Material. 19 females, 8 males (NVM J55755). Australia, Tasmania,

central Bass Strait, 20 km NNE of North Point, Flinders I. (40°38'S,

145°23'E), 37 m, 04/11/1980, (BSS 117), M.F. Gomon and G.C.B.

Poore; 33 females, 17 males (NVM J47123 eastern Bass Strait, 63 km

E of North Point, Flinders I. (39°44.48'S, 148°40.36'E), 124 m,

14/11/1981, (BSS 167), R.S. Wilson; 2 males, 1 female (NVM J53139),

eastern Bass Strait, 63 km E of North Point, Flinders I. (39°44.48'S,

148°40.36'E), 124 m, 14/11/1981, (BSS 167), R.S. Wilson.

Remarks. The only previous published records of this species

are of the type material, off New South Wales, Australia, at 37 to

108 m depth, and further specimens described by Lang (1970)

from Dr Th. Mortensen’s Pacific Expedition in 1914. Lang

(1970) cited the sampling site as off South Africa (35°05'S

15°05'E), but those coordinates are a misprint: the sampling on

that date was from the Endeavour, at 37°05'S 150°05'E, on sand

and mud in depths of 70 to 100 m, i.e. off Merimbula, New

South Wales (see numerous references to the sample site in, for

example, Augener, 1924). Thus, reassuringly, all records of this

species are from off south-eastern Australia. The present material

extends the range further south and west, and into slightly deeper

water. Much of the present material was collected together with

the following species; distinction of the females is particularly

difficult, the only reliable feature being the short peduncular

articles of the antenna in Pseudowhiteleggia typica.

Genus Pseudowhiteleggia Lang, 1970

Pseudowhiteleggia typica Lang, 1970

Pseudowhiteleggia typica Lang, 1970, 616-626, figs 9-15.

Material. 24 females (8 ovigerous), 10 males (NMV J47121), Australia,

Victoria, central Bass Strait, 65 km S of Cape Schanck (39°08.18'S,

144°43.54'E), 66 m, 23/11/1981, (BSS 201 G), R.S. Wilson; 17 females

(NMV J53138), Tasmania, central Bass Strait, 20 km NNE of North

Point, Flinders I. (40°38'S, 145°23'E), 37 m, 04/11/1980 (BSS 117),

M.F. Gomon and G.C.B. Poore, 24 females, 9 males (NMV J55754),

Apseudomorpha of eastern Australia

133

Figure 17. Labraxeudes heliodiscus gen. et sp. nov., holotype female, dorsal. Scale line = 1mm.

134

Magdalena Bfazewicz-Paszkowycz and Roger N. Bamber

Figure 18. Labra.xeudes heliodiscus gen. et sp. nov.. A, antennule; B, antenna; C, left mandible, with detail of pars incisiva, lacinia mobilis, setal

lobe and molar process; D, right mandible; E, maxillule; F, maxilla, G, labium; H, maxilliped; I, maxilliped endite. Scale line = 0.1 mm.

Apseudomorpha of eastern Australia

135

Figure 19. Labraxeudes heliodiscus gen. et sp. nov.. A, cheliped; B-G, pereopods 1-6 respectively; H, uropod. Scale line = 0.1 mm.

136

Magdalena Blazewicz-Paszkowycz and Roger N. Bamber

western Bass Strait, 35 km SSW of Cape Otway, Victoria (39°07.00'S,

143°14.36'E), 84 m, 20/11/1981, (BSS 183), R.S. Wilson.

Remarks. This species would seem not to have been recorded

since the type material described by Lang, collected from

Galathea station 544 at 50 m depth off the east coast of

Australia (29°57'S 153°22'E).

Family Metapseudidae Lang 1970

Subfamily Metapseudinae Lang 1970

Genus Labraxeudes gen. nov.

Diagnosis. Metapseudid with conspicuous rostrum, lateral simple

setae on cephalon and pereonites, denser simple setae on pleonites

and pleotelson, pleotelson with large, rounded lateral apophyses;

antennule compact, without spine-like apophyses along inner

margin of proximal peduncle article, flagella of few articles;

antenna basal peduncle articles compact, little or not longer than

wide, with squama; mandible with palp; cheliped robust, with

exopodite; pereopod 1 with exopodite, coxa with rounded spine-

like apophysis, basis with plumose setae but without dorsal

apophyses; 5 pairs of pleopods; uropods of few segments.

Etymology. From - labrax - the Greek for a sea-bass (also the

specific name of the sea-bass, Dicentrarchus labrax ), a pun on

Bass Strait, the region of the type locality, and a suffix from

Apseudes.

Type species. Labraxeudes heliodiscus sp. nov. by original

designation.

Remarks. This genus has morphological similarities with

Apseudomorpha Miller, 1940, Cyclopoapseudes Menzies,

1953, and Julmarichardia Gu(u 1989, lying somewhere between

the last 2; the first 2 of these genera are without exopodites on

the cheliped or pereopod 1, and numerous details of the rostrum,

pereopod and uropod morphology are inconsistent, although

the unusual pleotelson morphology mirrors that of species of

Cyclopoapseudes. Julmarichardia species have a slightly

similar rostrum morphology and do have exopodites on the

cheliped and pereopod 1; however, that genus is characterized

by having the propodus of pereopods 2 to 6 substantially longer

than the carpus, by the proximal antennule peduncle article

having inner spine-like apophyses, by the basis of pereopod 1

having marginal apophyses dorsally and by a slender antenna.

The combination of substantial rostrum, exopodites on the

cheliped and pereopod 1, compact antenna, short uropod,

simple pereonite setation, compact propodi, dorsum of

pereopod 1 basis without apophyses, robust cheliped and

antennule peduncle without inner row of conspicuous

denticulation shown by Labraxeudes gen. nov. is unique

amongst Metapseudinae.

Labraxeudes heliodiscus sp. nov.

Figures 17-19

Material. Brooding female, holotype (NVM J47 1 27), Australia, Victoria,

Red Rock, Phillip I. (38°28'S, 145°14'E), 29/09/1974, W.F. Seed, B.

Leonard, B and R. Lennie; 2 females, paratypes (NVM J55750), 1

dissected on slides (NVM J55940) same sample as holotype.

Description of female. Body compact, holotype 2.9 mm long (tip

of rostrum to posterior of pleotelson), 3.8 times as long as wide,

narrower posteriorly. Cephalothorax subrectangular, as long as

wide including rostrum (1.3 times as wide as long without

rostrum), anterior margin with conspicuous subcircular, flattened

rostrum with finely denticulate anterior margin. Eyes present on

robust eyelobes; paired lateral setae behind eyelobes and on

laterally swollen branchial chambers. 6 free pereonites, all with

lateral margins uniformly convex, appearing as posterolateral

rounded apophyses on pereonites 3 to 6, each with 3 or 4

conspicuous simple setae; pereonite 1 about one-third as long as

cephalothorax; pereonite 2 shortest, 0.9 times as long as pereonite

1; pereonites 3 and 4 subequal (4th longest), 1.3 times as long as

pereonite 1; pereonites 5 and 6 subequal, as long as pereonite 1

(all pereonites respectively 3.4, 3.8, 2.6, 2.4, 2.9 and 2.7 times as

wide as long). Pleon 2.6 times as long as pereonite 1, of 5 free

subequal pleonites bearing pleopods plus pleotelson; pleonites

dorsally convex, more than 3 times as wide as long, with paired

mid-dorsal setae, laterally expanded by spiniform apophyses

each bearing 3 simple setae distally. Pleotelson distally rounded,

one-quarter as long as whole pleon, expanded laterally into

rounded apophyses bearing long simple setae, thus 2.5 times as

wide as long, long paired dorsal simple setae in posterior half,

distal margin with 3 long simple setae on each side.

Antennule peduncle article 1 arcuate, compact, 2.7 times

as long as wide, inner margin with triangular subdistal

apophysis bearing 2 simple setae, outer margin with proximal

penicillate seta, fine denticulations in distal 3rd with row of 4

adjacent simple setae; article 2 one-third as long as article 1,

with outer distal pair of plumose setae, dorsodistal simple seta

and inner subdistal pair of shorter simple setae; article 3 half

length of article 2, with outer distal plumose seta and inner

subdistal pair of shorter simple setae; article 4 0.7 times as

long as article 3, with inner distal seta. Main flagellum of 4

segments, segment 3 bearing single aesthetasc; accessory

flagellum of 2 segments, each with 2 distal setae.

Antenna peduncle article 1 with inner denticulate apophysis

and rounded denticulate outer margin; article 2 1.4 times as

long as article 1, inner margin bearing pair of simple setae and

subdistal spinous apophysis, outer margin with penicillate seta

and distal squama with 5 simple marginal setae; peduncle

article 3 shorter than wide, one-quarter the length of article 2,

with 1 inner seta; article 4 twice as long as article 3, with

paired inner penicillate setae; article 5 slightly longer than

article 1, with inner and outer penicillate setae and paired

inner simple setae. Flagellum of 4 segments.

Mouth parts. Labrum not seen. Left mandible bearing strong,

crenulated pars incisiva, lacinia mobilis robust with 5 strong

denticulations, setiferous lobe with 1 compound, 3 bifurcate and

1 simple setae, pars molaris robust, blunt, margin with row of

finely denticulate teeth; mandibular palp of 3 articles, article 1

just longer than wide with 4 setae on inner rounded apophysis,

article 2 1 .75 times as long as article 1 with 3 longer and 7 shorter

finely denticulate setae in distal half; article 3 two-thirds length

of article 2 with 8 inner finely denticulate setae in distal half and

Apseudomorpha of eastern Australia

137

Figure 20. Metapseudes wilsoni sp. nov.

138

Magdalena Bfazewicz-Paszkowycz and Roger N. Bamber

Figure 21. Metapseudes wilsoni sp. nov.. A, holotype female, dorsal; B, male, dorsal; C, cheliped of female; D, cheliped of subadult male;

E, cheliped of mature male. Scale line = 2.5 mm.

Apseudomorpha of eastern Australia

139

Figure 22. Metapseudes wilsoni sp. nov.. A, antennule; B, antenna; C, left mandible; D, maxillule; E, maxilla; F, labium; G, maxilliped;

G', maxilliped endite; H, epignath. Scale line = 0.1 mm.

140

Magdalena Blazewicz-Paszkowycz and Roger N. Bamber

Figure 23. Metapseudes wilsoni sp. nov., A-F, pereopods 1-6 respectively; G, pleopod; H, uropod. Scale line = 2.5 mm.

Apseudomorpha of eastern Australia

141

1 outer subdistal seta. Right mandible as left. Maxillule inner

endite with 5 finely setulate distal setae; outer endite with 8 distal

spines and 2 subdistal setae, outer and inner margins finely setose;

palp lost in dissection. Maxilla with fine setae on outer margin;

outer lobe of moveable endite with 3 simple subdistal setae (1

mesially setulose) and 3 simple distal setae; inner lobe of

moveable endite with 6 simple and 3 setulose setae; outer lobe of

inner endite with 4 outer simple setae, 3 stout trifurcate spines,

and 1 inner and 2 subdistal setulose setae; inner lobe of fixed

endite with rostral row of 14 setae guarding 2 longer setae.

Labium with smooth outer margin, palp with fine lateral setules

and 3 simple distal spines. Maxilliped basis naked; palp article 1

with single distal seta on outer margin and long simple inner seta

longer than article 2; palp article 2 longer than wide, with rows of

numerous short setae and 6 longer simple setae along inner

margin, outer margin denticulate and with single distal seta; palp

article 3 as long as wide, with 8 simple setae along inner margin;

palp article 4 with 7 distal setae and 1 subdistal seta. Endite with

flagellate inner caudodistal seta and stout distal spines along

setulose margin and three coupling hooks. Epignath not seen.

Cheliped robust, basis 1.8 times as long as wide, dorsally

naked, ventrally with midventral spine and 2 plumose distal

setae; exopodite present, 3 -articled, article 2 naked, article 3

with 4 plumose setae. Merus subrectangular, with paired

ventrodistal simple setae. Carpus 1.25 times as long as wide,

with 3 simple setae along ventral margin. Chela fingers shorter

than palm, ventral margin of fixed finger with 6 setae; 1 seta near

articulation of fixed finger; cutting edge with row of 6 setae but

no apophyses, distal claw stout; dactylus naked with central and

proximal apophyses on cutting edge, distal claw pointed.

Pereopod 1 with rounded spine-like apophysis on coxa

bearing row of fine setules and 3 distal plumose setae. Basis

stout, 2.3 times as long as wide, dorsal margin with 6 plumose

setae but no apophyses, ventral margin with 6 plumose setae, 2

subdistal simple setae and ventrodistal spine; exopodite present,

3 -articled, article 2 naked, article 3 with 6 distal plumose setae.

Ischium with 1 shorter and 2 longer simple ventrodistal setae.

Merus just over half as long as basis, expanded distally, with 3

ventral simple setae, ventrodistal spine and adjacent simple seta

and curved dorsodistal spine and 2 adjacent simple setae. Carpus

half as long as merus, with 2 ventral spines and intervening

simple seta, dorsal margin with numerous simple setae and

single dorsodistal spine. Propodus as long as merus, with 4

ventral spines alternating with simple setae, 5 simple dorsal

setae and 2 dorsodistal spines. Dactylus stout, more than half as

long as propodus, with mid-dorsal fine seta; unguis short.

Pereopod 2 more slender. Coxa with 2 plumose setae. Basis

2.6 times as long as wide with 2 dorsal and 3 ventral plumose

setae, and 2 simple ventrodistal setae. Merus 1.6 times as long

as carpus, with elongate dorsodistal plumose seta, 2 ventral

simple setae and ventrodistal spine. Carpus elongate, with 2

ventral spines and ventrodistal seta, 3 dorsal simple setae and

dorsodistal spine. Propodus just longer than merus, with 4

ventral and 2 dorsodistal spines with interspersed setae.

Dactylus curved, with fine mid-dorsal seta, unguis slender.

Pereopod 3 similar to pereopod 2, but basis with longer

mesial plumose seta, merus with 3 ventrodistal spines, carpus

with 2 dorsodistal spines, propodus with 3 dorsodistal spines.

Pereopod 4 similar to pereopod 3 but with no mesial seta

on basis, longer anterior and posterior distal spines on carpus,

propodus with mid-dorsal plumose sensory seta, dorsodistal

tuft of 4 shorter and 2 longer finely denticulate setae; dactylus

with fine ventrodistal seta.

Pereopod 5 similar to pereopod 4, basis with proximal

penicillate setae and 4 dorsal plumose setae longer than basis

width, 5 ventral plumose setae; ischium with 2 ventrodistal

setae, longer of which exceeds distal edge of merus; merus

shorter than carpus, with plumose dorsal seta longer than

carpus, 3 shorter ventral plumose setae and 2 ventrodistal

spines; carpus with ventral spines and distal crown of plumose

setae; propodus with 2 plumose distal setae.

Pereopod 6 basis with 4 dorsal and 8 ventral plumose setae;

merus with 3 dorsal plumose setae and 1 plumose and 2 simple

ventral setae; carpus with 4 ventral and 3 dorsal plumose setae

and dorsodistal spine; propodus with 2 ventral spines and

crown of 10 shorter and 1 longer distal setae.

Pleopods all similar, all setae plumose; basis with 1 ventral

seta, outer ramus with 2 articles, proximal article with single

outer seta, distal article with 3 outer and 3 distal setae, inner

ramus with 8 setae around entire margin.

Uropod biramous, exopod just longer than proximal

segment of endopod, of 2 segments, distally with 2 setae

exceeding tip of endopod; endopod of 3 segments.

Etymology. From the Greek: helios - the sun, and discos - a

flat circular plate or disc, with reference to the shape of the

rostrum; noun in apposition.

Remarks. See the generic remarks above. The holotype has 8

eggs in its brood pouch.

Genus Metapseudes Stephensen 1927

Metapseudes wilsoni sp. nov.

Figures 20-23

Material. Ovigerous female, holotype (NVM J23601) Australia,

Victoria, eastern Bass Strait, 11.2 km E of eastern edge of Lake Tyers

(37°51.25'S, 148°13.10'E), 32 m, 25/09/1990, (MSL-EG 27), Marine

Science Laboratories. Paratypes: 117 specimens including males and

ovigerous females (NVM J55751), 2 dissected on slides (NVM J55939);

same locality as holotype.

Description of female. Body not particularly dorsoventrally

flattened, holotype 2 mm long (tip of rostrum to posterior of

pleotelson), 4.9 times as long as wide. Cephalothorax

subrectangular, 1.35 times as long as wide, naked; anterior

margin with conspicuous square rostrum. Eyelobes and eyes

present, with black pigment. 6 free pereonites, lateral margins

uniformly convex, with paired anterolateral setae on each side;

pereonites 1 and 2 subequal, about one -third as long as

cephalothorax; pereonite 3 longest, 1.25 times as long as

pereonite 1; pereonites 4 and 5 slightly shorter, pereonite 6

shortest, 0.8 times as long as pereonite 1 (all pereonites

respectively 2.2, 2.3, 1.8, 2.0, 2.0 and 2.5 times as wide as

long). Pleon twice as long as pereonite 5, of 5 free subequal

pleonites bearing pleopods plus pleotelson; pleonites some 9

times as wide as long, not laterally expanded, with paired

142

Magdalena Blazewicz-Paszkowycz and Roger N. Bamber

dorsolateral and lateral setae. Pleotelson 0.75 times as long as

wide, as long as pereonite 5, with single midlateral, subdistal

and distal marginal setae on each side, and pair of mid-

dorsolateral setae.

Antennule peduncle article 1 stout, 3 times as long as wide,

with conspicuous denticulations along inner and outer margins,

outer margin with longer subdistal seta and groups of proximal,

mesial and distal penicillate setae; inner margin with 2 simple

setae in distal one -third; peduncle article 2 0.3 times as long as

article 1, with inner proximal denticulations, inner, dorsal and

outer distal setae, and outer distal group of penicillate setae;

article 3 one-quater length of article 1, article 4 one-fifth as

long as 2nd, with inner distal seta. Main flagellum of 2

segments, proximal segment with 3 simple distal setae, distal

segment with 2 longer distal setae, 1 shorter subdistal seta and

2 aesthetascs; accessory flagellum of 2 segments.

Antenna peduncle article 1 with denticulate inner margin;

article 2 distally denticulate on inner margin, naked, 0.7 times

length of article 1; peduncle article 3 as long as article 2, with 1

inner distal penicillate seta; article 4 just longer than article 3,

with 2 distal penicillate setae. Flagellum of 2 segments, distal

segment with 2 shorter and 1 longer distal setae. Squama absent.

Mouth parts. Labrum not seen. Left mandible with narrow

crenulated pars incisiva, lacinia mobilis as long as pars incisiva

and distally crenulate, setiferous lobe with 4 simple setae, pars

molaris elongate, stout, blunt with spinose extension at dorsal

rim; mandibular palp of 3 articles, article 1 naked, article 2 as

long as article 1 with dorsodistal seta, article 3 half as long as

article 2 with 3 shorter and 1 longer distal setae, the longer as

long as article 2. Right mandible as left. Maxillule inner endite

with 4 setulate distal setae; outer endite with 9 distal spines, 2

shorter than the rest, outer margin finely setose; palp of 2 articles,

article 2 one-third length of 1st and with 2 distal setae. Maxilla

outer lobe of moveable endite with 2 subdistal and 4 distal simple

setae; inner lobe of moveable endite distally with 7 simple setae;

outer lobe of fixed endite distally with 3 simple outer setae and 3

trifurcate inner setae, subdistally with setulose seta; inner lobe of

fixed endite with rostral row of 13 setae guarding 2 longer

plumose setae. Labium with denticulate outer margin, palp

elongate, with paired outer setae, fine distal setules and single

distal spine. Maxilliped basis with simple inner distal seta; palp

article 1 with outer distal spine on apophysis and single inner

distal setulose seta; palp article 2 longer than wide, with sparse

row of 6 simple and 2 setulose setae on inner margin, stout outer

distal seta; palp article 3 0.6 times as long as wide, with 4 simple

stout setae on inner distal margin; palp article 4 with 7 distally-

denticulate distal setae. Endite with setulose distal and outer

marginal setae, inner margin with fine setules, and 4 coupling

hooks. Epignath elongate cup-shaped, with setulose distal spine.

Cheliped robust, basis as long as wide with small

ventrodistal seta; exopodite absent. Merus subrectangular,

ventrodistal shoulder with single seta. Carpus twice as long as

wide, with simple dorsodistal seta, midventrally with paired

simple setae among slight marginal crenulations. Chela fingers

shorter than palm; palm with paired distal setae at articulation

of dactylus; fixed finger with 3 ventral setae, cutting edge with

sparse setae; dactylus with 3 distal setae, distal claw pointed.

Pereopods generally all somewhat similar.

Pereopod 1 basis compact, 2.7 times as long as wide, with

simple setae and 2 triangular apophyses along dorsal margin, 2

fine setae on ventral margin; exopodite absent. Ischium naked.

Merus 0.4 times as long as basis, with long inner distal seta and

1 outer distal spine. Carpus 0.8 times as long as merus, with 3

ventral spines, 2 dorsodistal spines and 3 distal simple setae.

Propodus as long as mems, with 4 ventral spines, 2 stout

dorsodistal spines, dorsodistal and ventrodistal simple setae, and

mid-dorsal penicillate seta. Dactylus stout, with fine midventral

denticulation; unguis short, slender, one-third length of dactylus.

Pereopod 2 similar to but more slender than pereopod 1,

basis 3 times as long as wide, dorsally with single triangular

apophysis, ischium with single ventrodistal seta, merus with

single ventrodistal and dorsodistal setae, carpus with 5 ventral

short spines in 2 rows, and 2 mid-distal short spines; propodus

2.3 times as long as wide, with 4 ventral, 1 mesial and 2

dorsodistal short spines, and 2 fine dorsal and 1 longer

dorsodistal setae; dactylus with ventral seta; unguis stout.

Pereopod 3 similar to pereopod 2, but dorsal margin of

basis with 2 apophyses; merus dorsodistally naked.

Pereopod 4 similar to pereopod 2, but propodus with mid-

dorsal penicillate seta, and dorsodistal tuft of 2 simple and 5

finely denticulate setae, more conspicuous “heel” on dactylus.

Pereopod 5 as pereopod 2 but with dorsodistal spine on

merus, fewer spines on carpus and propodus, more conspicuous

“heel” on dactylus.

Pereopod 6 similar to pereopod 5, but carpus without

spines but with 4 distal simple setae, propodus with distal tuft

of 8 finely denticulate setae.

Pleopods all alike. Basis naked, both rami slender, subequal

in length, with 2 (exopod) or 3 (endopod) distal setae.

Uropod basis elongate, with 1 longer and 1 shorter outer

distal setae. Exopod of 2 segments, endopod of 4 segments,

setose as figured.

Male. Generally as female, body shorter (4.6 times as long

as wide). Cheliped dimorphic, proportionately larger, carpus

1.6 times as long as wide, chela nearly twice as long as carpus,

propodal palm 1.45 times as long as wide, fixed finger excavate

to give wide separation from dactylus, cutting edge distally

denticulate and setulose; dactylus longer than carpus. Cheliped

of subadult male transitional, dactylus cutting edge with

proximal rounded apophysis.

Etymology. Named for Dr Robin Wilson of Museum Victoria,

who undertook much of the Bass Strait sampling.

Remarks. The only genus of the Metapseudinae without an

antennal squama is Metapseudes\ this genus is further

distinguished from the others in having a simply setose trunk,

no plumose setae on the basis of pereopod 1, and a simple

rostrum. The only species previously known from this genus is

M. aucklandiae Stephensen, 1927, described from New Zealand

in shallow waters (Stephensen, 1927), and usefully redescribed

from the type and other material by Gardiner (1973) (depth range

0-113 m). The 2 species have similar lateral dentition of the

basal 2 articles of the antennule, rostrum, trunk setation,

mouthpart morphology, pleopod and uropod morphology, no

exopodites on the cheliped or pereopod 1 and, of course, no

antennal squama.

Apseudomorpha of eastern Australia

143

Figure 24. Similipedia diarris sp. nov., holotype female, dorsal. Scale line = 1mm.

144

Magdalena Bfazewicz-Paszkowycz and Roger N. Bamber

Figure 25. Similipedia diarris sp. nov.. A, antennule; B, antenna; C, left mandible; D, maxillule; E, maxilla; F, labium; G, maxilliped;

G' maxilliped endite; H epignath. Scale line = 0.1 mm.

Apseudomorpha of eastern Australia

145

Figure 26. Similipedia diarris sp. nov.. A, cheliped; B to G, pereopods 1 to 6 respectively; H, uropod; I, uropod. Scale line = 0.1 mm.

146

Magdalena Blazewicz-Paszkowycz and Roger N. Bamber

The most evident difference between these species is that

Metapseudes wilsoni sp. nov. has conspicuously more slender

antennules and antennae (proximal antennule peduncle article

of M. aucklandiae 1.6 times as long as wide) with more

pronounced, pointed denticulations on the proximal antennule

peduncle article, and 1 fewer article in the main flagellum of the

antennule (Stephensen, 1927, erroneously showed the 4th

peduncle article split as 2 basal flagellar articles), but also 2

(rather than 1) distal setae on the maxillule palp, no indentation

in the anterior margin of the rostrum, a more slender cheliped in

the female (carpus of M. aucklandiae 1.7 times as long as wide),

fewer dorsal apophyses on the pereopod bases, and a more

slender pereopod 2 (propodus of M. aucklandiae about 1.2 times

as long as wide).

Family Pagurapseudidae Lang 1970

Genus Similipedia G 11(11 1989

Similipedia diarris sp. nov.

Figures 24-26

Material. Female, holotype (NMV J47 126), Australia, Victoria, eastern

Bass Strait, 8 km S of South East Point, Wilsons Promontory

(39°12.54'S, 146°27.18'E), 65 m, 18/11/1981, (BSS 180 S), R.S.

Wilson. Paratypes: 42 females (7 brooding), same locality as holotype;

paratypes (NVM J55752), 2 dissected on slides (NMV J55938), same

locality as holotype.

Description of female. Body dorsoventrally flattened, holotype

3.2 mm long (tip of rostrum to posterior of pleotelson), 5.3

times as long as wide, narrower posteriorly. Cephalothorax

subrectangular, slightly longer than wide, naked, swollen

around branchial chambers; anterior margin with conspicuous

v-shaped rostral excavation. Eyes present; eyelobes with

apophyses directed anterolaterally. 6 free pereonites; pereonites

1 and 2 subequal, about one-third as long as cephalothorax,

lateral margins uniformly convex; pereonite 1 with anterodorsal

row of 7 spiniform apophyses. Pereonite 3 1.5 times as long as

pereonite 1, with 4 anterodorsal spiniform apophyses, lateral

pair appearing as anterolateral apophyses; pereonite 4 longest,

1.7 times as long as pereonite 1, with 4 anterodorsal spiniform

apophyses, anterolateral spiniform apophyses, mid-lateral

spiniform apophyses anterior to conspicuous posterolateral

swelling over coxal attachment; pereonite 5 just longer than

pereonite 1, with anterodorsal and mid-dorsal rows of spiniform

apophyses and expanded posterolaterally at attachment of

coxae; pereonite 6 as long as pereonite 1, laterally uniformly

convex with anterodorsal and mid-dorsal rows of spiniform

apophyses (all pereonites respectively 2.4, 2.3, 1.6, 1.2, 1.9 and

1.8 times as wide as long). Pleon twice as long as pereonite 5,

of 5 free subequal pleonites bearing pleopods plus pleotelson;

pleonites dorsally convex, some 6 times as wide as long,

laterally expanded by spiniform apophyses and with paired

mid-dorsal spines. Pleotelson as long as wide, as long as

pleonites 2 to 5 inclusive, naked.

Antennule peduncle article 1 elongate, 6.7 times as long as

wide, with conspicuous inner and outer spine-like marginal

apophyses, distally with inner tooth-like apophysis and larger

outer denticulate apophysis, as long as peduncle article 3 and

bearing 2 setae; article 2 0.3 times as long as article 1, with

distal expansion bearing 3 inner and 3 outer setae; article 3

three-quarters length of 2nd, article 4 one -third as long as 3rd,

naked. Main flagellum of 6 segments, sparsely setose as

figured; accessory flagellum of 4 segments.

Antenna peduncle article 1 simple with outer seta; article 2

naked, without squama; peduncle article 3 as long as wide,

with 1 seta; articles 4 and 5 of equal length, and 3.3 times as

long as article 3, each with distal penicillate setae. Flagellum

of 1 segment with 2 distal setae.

Mouth parts. Labrum sparsely setose. Left mandible with

distal outer margin bearing group of spinous apophyses; strong,

bifurcate, crenulated pars incisiva, lacinia mobilis as long as

pars incisiva, setiferous lobe with 1 simple and 3 longer,

distally expanded and setulose setae, pars molaris elongate,

blunt; mandibular palp of 3 articles, article 1 naked, article 2

twice as long as wide with inner row of 11 simple setae in

distal half, article 3 as long as article 2 but more slender, 5

times as long as wide, with 12 inner simple setae increasing in

length distally, and 2 longer distal setae, the longer 1.3 times as

long as article. Right mandible as left but without lacinia

mobilis. Maxillule inner endite with 5 midlaterally-setulate

distal setae and outer marginal apophysis; outer endite with 11

distal spines, 1 shorter than the rest, outer margin finely setose,

inner margin with microtrichia; palp absent. Maxilla with

microtrichia on outer margin; outer lobe of moveable endite

with 2 simple setae on outer margin and 4 simple distal setae;

inner lobe of moveable endite distally with 7 simple outer and

5 plumose inner setae; outer lobe of fixed endite with marginal

microtrichia, distally with 6 outer simple setae, 5 stouter blunt

or bifurcate spines, and inner plumose seta; inner lobe of fixed

endite with rostral row of 22 setae guarding 5 longer plumose

setae, inner margin finely denticulate. Labium glabrous, palp

marginally densely setose with single distal spine. Maxilliped

basis with tuberculate inner margin, sparse short setae and 2

mid-distal setae; palp article 1 with single distal seta on outer

margin, paired inner setae and 3 sharp denticulations on inner

margin; palp article 2 longer than wide, with rows of numerous

short tooth-like tuberculations on inner margin adjacent to row

of small, simple setae, outer margin with 1 simple seta

subdistally; palp article 3 as long as wide, with 5 simple setae

on expanded inner margin; palp article 4 with 5 distally

denticulate distal setae, and 1 longer and 1 shorter simple

subdistal setae. Endite with simple, flagellate inner and outer

caudodistal setae, blunt bifurcate or spatulate, distal spines,

margin of dense fine distal setules and 4 coupling hooks.

Epignath slender, marginally densely setose, with prominent

proximal lobe and setose distal spine.

Cheliped robust, basis twice as long as wide, dorsally with

central and distal groups of 3 spine -like apophyses, ventrally

with small marginal setae, paired ventrodistal setae and 4

denticulations along the distal half; exopodite absent. Merus

subrectangular, ventrally and distally with sparse setae,

ventrodistal shoulder with 2 spine -like apophyses. Carpus 2.4

times as long as wide, with small, simple setae proximally and

distally on dorsal margin, ventrally with spine-like apophyses

becoming smaller distally and sparse simple setae. Chela

Apseudomorpha of eastern Australia

147

fingers shorter than palm; palm with sparse ventral (3) and

dorsal (5) setae, fixed finger with 4 ventral and 4 dorsodistal

setae around distinct distal claw, 3 setae near articulation of

dactylus; cutting edge of fixed finger crenulate; dactylus with

fine dorsal setae, proximal setae and distal apophyses on

cutting edge, distal claw pointed.

Pereopods generally all similar.

Pereopod 1 coxa with spinous apophysis; basis slender, 6.4

times as long as wide, with simple setae along both margins

and row of 12 spines along dorsal margin; exopodite absent.

Ischium with single, simple ventrodistal and dorsodistal setae.

Merus 0.3 times as long as basis, with rows of simple dorsal

and ventral setae as figured. Carpus 1.8 times as long as merus,

with sparse dorsal marginal setae, ventral margin with 10

spines interspersed with fine simple setae. Propodus shorter

than carpus, 1.5 times as long as merus, with dorsodistal and

distal simple setae, ventral margin with 7 spines interspersed

with fine simple setae. Dactylus slender, one-third length of

propodus, with fine inner and outer setae and slight ventrodistal

expansion adjacent to unguis; unguis short, slender, half length

of dactylus.

Pereopod 2 similar to pereopod 1, but basis 5.4 times as long

as wide, dorsally with row of 7 unequal spine-like apophyses

and no setae. Ventrodistal swelling on dactylus larger.

Pereopod 3 similar to pereopod 2, but dorsal margin of

basis with fewer, smaller apophyses; propodus with mesial row

of 5 setae.

Pereopod 4 similar to pereopod 2 but basis with

dorsoproximal tuft of penicillate setae; merus half as long as

subequal carpus or propodus; propodus with mid-dorsal

penicillate seta, dorsodistal tuft of 6 finely denticulate setae;

ventrodistal swelling on dactylus more pronounced.

Pereopod 5 as pereopod 4 but with only single penicillate seta

on basis, mesial setae but only 2 simple distal setae on propodus.

Pereopod 6 similar to pereopod 5.

Pleopods all alike. Basis elongate, with single dorsal seta.

Both rami slender, with 2 distal and 1 subdistal setae; endopod

shorter than exopod.

Uropod basis with paired distal setae, endopod of 10

slender segments, exopod of 2 segments shorter than proximal

2 segments of endopod.

Etymology. From the Greek “dia” - asunder, and “rhis” - a

snout, referring to the cleft rostral margin of the cephalon (noun

in apposition).

Remarks. Within the subfamily Hodometricinae, only 3 genera,

viz. Pagurapseudopsis Shiino, 1963, Parapagurapseudopsis

Silva Brum, 1974 (including Brumia Bacescu, 1981), and

Similipedia Gufu, 1989 have a full 5 pairs of pleopods in the

adult. Of these 3, Pagurapseudopsis is distinct in having an

exopodite on pereopod 1, and the basis of this pereopod is

substantially larger than that of the remaining legs;

Parapagurapseudopsis has an exopodite on the cheliped

(rudiment only in Pagurapseudopsis)-, both of these genera

have a palp on the maxillule. With no maxillule palp, pereopod

1 of similar morphology to the remaining pereopods, and

exopodites missing from both the cheliped and pereopod 1, the

present species accords with Similipedia.

The only previously described species of Similipedia is

S. eminescui Gufu, 1989, from the north-east Mozambique

Channel at 6 m depth, to which much of the morphology of

S. diarris sp. nov. (habitus, rostral concavity, antennular basis

apophyses, pereopod and pleopod structure, ventrodistal

swelling on the pereopod dactyli) is very similar. The present

species is distinguished from S. eminescui by having no squama

on the antenna (very reduced squama evident in S. eminescui ),

no rostrum (small eminence in the centre of the rostral concavity

in S. eminescui ), dorsal spiniform apophyses on the pereonites

(only setae in S. eminescui ), more segments in the antennular

flagella, 1 less segment in the antennal flagellum, more slender

mandibular palp articles, and the more elaborate outer distal

apophysis on the proximal antennule peduncle article.

None of the specimens of Similipedia eminescui had retained

their chelipeds, so the description of the cheliped from S. diarris

adds to our knowledge of this genus, particularly that the cheliped

exopodite is absent. Gu(u (1989) also gave no description of the

maxilla of his species.

Acknowledgements

We are greateful to Dr Gary Poore and Dr Robin Wilson for

collecting the materials and make it available for our studies.

The research has been financed by EU Marie Curie Grant ,

cS?

UttJlEttdQf fiCTHMS OIF 040613 -DiPoT.

References

Augener, H. 1924. Papers from Dr. Th. Mortensen’s Pacific Expedition

1914-1916. No. 18. Polychaeta II. Polychaten von Neuseeland I:

Errantia. Videnskabelige Meddelelser fra Dansk naturhistorisk

F0renig i K0benhavn 75: 241-441.

Bacescu, M. 1984. Considerations sur deux sous-especes nouvelles

d'Apseudes -A. spinosus albidus ssp. n. et A. robustus erythraeicus

ssp. n. Travaux du Museum d‘Histoire naturelle “Grigore Antipa”

25: 91-98.

Bamber, R. N. (in press). Tanaidaceans (Crustacea: Peracarida:

Tanaidacea) from Moreton Bay, Queensland. Proceedings of the

Thirteenth International Marine Biological Workshop. In: Davie,

P. (ed.). The Marine Flora and Fauna of Moreton Bay, Queensland,

Australia. Queensland Museum: Brisbane.

Bamber, R. N. 2007. Suborders Apseudomorpha Sieg, 1980 and

Neotanaidomorpha Sieg, 1980. In: Larsen, K., and Shimomura,

M. (eds.), Tanaidacea (Crustacea: Peracarida) from Japan III. The

Kurile-Kamchatka Trench. Zootaxa 1599: 13-40.

Bamber, R. N. and Sheader, M. 2005. Apseudomorph Tanaidacea

(Crustacea: Malacostraca: Peracarida) from shallow waters off

Sabah, Malaysia. Systematics and Biodiversity 2: 281-303.

Bfazewicz-Paszkowycz, M., and Bamber, R.N. 2007. Parapseudid

tanaidaceans (Crustacea: Tanaidacea: Apseudomorpha) from

Eastern Australia. Zootaxa 1401: 1-32.

Edgar, G. J. 1997. A new genus and three new species of apseudomorph

tanaidacean (Crustacea) from the Darwin region. Pp. 279-299, In:

Hanley, J. R., Caswell, G., Megirian, D., and Larson, H. K. (eds.).

Proceedings of the Sixth International marine Biological Workshop.

The MarineFlora and Fauna of Darwin Harbour, Northern

Territory, Australia. Museums and Art Galleries of the Northern

Territory and the Australian Marine Sciences Association: Darwin.

148

Magdalena Bfazewicz-Paszkowycz and Roger N. Bamber

Gardiner, L. F. 1973. New species of the genera Synapseudes and

Cyclopoapseudes with notes on morphological variation,

postmarsupial development, and phylogenetic relationships within

the family Metapseudidae (Crustacea: Tanaidacea). Zoological

Journal of the Linnean Society 53: 25-58.

Guf.u, M. 1989.Tanaidacea (Crustacea) collected by the “Benthedi”

French expedition (1977) in South-Western Indian Ocean. 1. Travaux

du Museum d’Histoire naturelle “ Grigore Antipa ” 30: 135-160.

Guf.u, M. 1996. The description of Spinosapseudes n.g., and amended

diagnoses of two genera of Tanai dacea (Crustacea). Revue

Roumaine de Biologie, Serie de Biologie Animale 41(2): 87-93.

Guf.u, M. 2001. Description of the first interstitial species belonging to

the order Tanaidacea (Crustacea: Peracarida). Travaux du Museum

d’Histoire naturelle “Grigore Antipa” AS: 85-92.

Gufii. M. 2006. New apseudomorph taxa (Crustacea, Tanaidacea) of

the world ocean. Curtea Veche: Bucharest. 318 pp.

Lang, K. 1968. Deep-Sea Tanaidacea. Galathea Reports 9: 23-209,

pis I-X.

Lang, K. 1970. Taxonomische und phylogenetische Untersuchungen

liber die Tanaidaceen 4. Aufteilung der Apseudiden in vier Familien

nebst Aufstellung von zwei Gattungen und einer Art der neuen

Familie Leiopidae. Arkivfor Zoologi 22: 595-626, pi. 4.

Linne, C. von, 1751. Philosophia Botanica, in qua explicantur

fundamenta botanica, cum definitionibus partium, exemplis

terminorum, observationibus rariorum, adjectis fguris aeneis.

Apud Godofr. Kieserwetter: Stockholm. 362 pp.

Shiino, S. M. 1978. Tanaidacea collected by French scientists

on board the survey ship „Marion-Dufresne“ in the regions

around the Kerguelen islands and other subantarctic islands in

1972, ,74, ,75, ,76. Science Report of Shima Marineland. Part 5,

122 pp.

Stephensen, K. 1927. Crustacea from the Auckland and Campbell

Islands. Papers from Dr. Th. Mortensen's Pacific Expedition 1914—

1916, XL. Videnskabelige Meddelelser fra Dansk naturhistorisk

Forening i Kqbenhavn 83: 371-390.

Watling, L. 1989. A classification system for crustacean setae based on

the homology concept. In: Felgenhauer, B. E., Watling, L., and

Thistle, A. B. (eds). Functional Morphology of Feeding and

Grooming. Crustacean Issues 5: 15-27.

Wilson, R. S. and Poore, G.C.B. 1987. The Bass Strait Survey:

biological sampling stations, 1979-1984. Occasional Papers from

the Museum of Victoria 3, 1-14.